Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGATGGACAAGTCTGATGTGAAAGGCTGGGGCTCAACCCCGGGACTGCATTGGAAACTGCCCGTCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.638873
feces0.556233
adult0.403236
united states of america0.250803
child0.211684
obsolete_juvenile stage0.138462
control0.128997
china0.125582
city0.117245
rural community0.091896
jiangsu province0.075758
infant0.071713
biopsy0.068376
monkey0.065217
kingdom of spain0.063830
india0.059701
pig0.059172
sus scrofa0.059172
zoological garden0.058824
female0.057803
biopsy site0.051724
obesity0.051502
LOWER IN crohn's disease0.051502
age0.049383
hunter gatherer0.043353
age 5-13 years0.043197
high bmi0.042735
state of california0.042705
state of tennessee0.042283
united kingdom0.040568
state of oklahoma0.034783
nigeria0.034783
colombia0.034682
left colon0.034483
age 130.034483
age 30-500.034483
age 8-120.034483
africa0.034483
chuquisaca department0.034483
right colon0.034188
rectum0.033898
duodenum0.033898
finland0.033613
belgium0.033613
state of colorado0.033613
juvenile organism0.033333
bolivia0.033333
river0.033333
research facility0.031088
caecum0.029851
water0.028037
small village0.026316
venezuela0.026258
amerindian0.026258
sea urchin0.026087
LOWER IN low bmi0.026087
zambia0.026087
bangladesh0.026087
glasgow0.026087
lima0.026087
shantytown0.026087
age 13-140.026087
age 3-60.026087
new delhi0.026087
madagascar0.026087
antananarivo0.026087
himalayas0.026087
age 50-60 years0.026087
nanning city prefecture0.026087
age 60-790.026087
wastewater treatment plant0.026087
state of michigan0.025974
lytechinus variegatus0.025751
american diet0.025751
age < 3 years0.025751
nepal0.025751
french republic0.025586
LOWER IN ulcerative colitis0.025586
russia0.025424
ethiopia0.025424
LOWER IN adult0.024896
australia0.024341
farm0.024291
diet0.024194
skin0.024096
fresh water0.023904
mus musculus0.023810
wild0.023077
state of florida0.022814
canada0.017699
heterosexual0.017621
msw0.017621
gay0.017621
metabolic syndrome0.017621
gorilla gorilla0.017621
papio anubis0.017621
olive baboon0.017621
eagle harbor0.017544
azerbaijan0.017544
papio kindae0.017544
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.000000
biopsy0.800000
hunter gatherer0.750000
biopsy site0.750000
small village0.750000
rural community0.714286
obesity0.666667
state of oklahoma0.666667
venezuela0.666667
amerindian0.666667
nigeria0.666667
LOWER IN crohn's disease0.666667
india0.666667
heterosexual0.666667
msw0.666667
age 5-13 years0.666667
gay0.666667
metabolic syndrome0.666667
gorilla gorilla0.666667
papio anubis0.666667
olive baboon0.666667
colombia0.600000
pig0.555556
sus scrofa0.555556
homo sapiens0.515723
sea urchin0.500000
eagle harbor0.500000
high bmi0.500000
LOWER IN low bmi0.500000
obsolete_juvenile stage0.500000
left colon0.500000
azerbaijan0.500000
zambia0.500000
papio kindae0.500000
kinda baboon0.500000
bangladesh0.500000
age 130.500000
native american0.500000
arapaho0.500000
cheyenne0.500000
toronto0.500000
glasgow0.500000
spondyloarthritis0.500000
spondylitis0.500000
non c. diff diarrhea0.500000
LOWER IN clostridium difficile intestinal infectious disease0.500000
sudan0.500000
lima0.500000
shantytown0.500000
mild0.500000
LOWER IN severe0.500000
age 30-500.500000
age 8-120.500000
jordan0.500000
age 13-140.500000
centererians0.500000
age 3-60.500000
LOWER IN premature birth0.500000
remission0.500000
plant diet0.500000
age 30-50 years0.500000
LOWER IN age 50-80 years0.500000
sigmoid colon0.500000
children0.500000
new delhi0.500000
LOWER IN diarrhea0.500000
LOWER IN cron diet0.500000
schizophrenia0.500000
africa0.500000
madagascar0.500000
antananarivo0.500000
himalayas0.500000
tharu0.500000
agrarian0.500000
commonwealth of pennsylvania0.500000
raute0.500000
age 17-290.500000
denver0.500000
quito0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
LOWER IN nephrolithiasis0.500000
age <=24 hours0.500000
LOWER IN age >= 7 days0.500000
homosexual0.500000
msm0.500000
age 200.500000
LOWER IN egypt0.500000
metabolic syndrome x0.500000
nanchang city prefecture0.500000
hmong0.500000
chepang0.500000
age 19-240.500000
LOWER IN central african republic0.500000
LOWER IN bangui0.500000
LOWER IN inflammatory bowel disease0.500000
age 60-790.500000
chuquisaca department0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.848214
homo sapiens0.839286
adult0.361607
united states of america0.339286
child0.138393
china0.138393
control0.116071
obsolete_juvenile stage0.080357
city0.066964
rural community0.049107
jiangsu province0.044643
infant0.040179
biopsy0.035714
monkey0.035714
kingdom of spain0.035714
female0.035714
research facility0.031250
india0.031250
pig0.031250
sus scrofa0.031250
zoological garden0.031250
obesity0.026786
biopsy site0.026786
state of california0.026786
LOWER IN crohn's disease0.026786
age0.026786
high bmi0.022321
hunter gatherer0.022321
united kingdom0.022321
age 5-13 years0.022321
state of tennessee0.022321
colombia0.017857
state of oklahoma0.017857
left colon0.017857
nigeria0.017857
age 130.017857
juvenile organism0.017857
finland0.017857
right colon0.017857
belgium0.017857
rectum0.017857
age 30-500.017857
age 8-120.017857
caecum0.017857
africa0.017857
state of colorado0.017857
duodenum0.017857
bolivia0.017857
chuquisaca department0.017857
mus musculus0.017857
water0.017857
river0.017857
sea urchin0.013393
lytechinus variegatus0.013393
state of florida0.013393
LOWER IN low bmi0.013393
venezuela0.013393
amerindian0.013393
LOWER IN adult0.013393
zambia0.013393
wild0.013393
bangladesh0.013393
american diet0.013393
glasgow0.013393
french republic0.013393
australia0.013393
lima0.013393
shantytown0.013393
LOWER IN ulcerative colitis0.013393
age 13-140.013393
age 3-60.013393
diet0.013393
new delhi0.013393
russia0.013393
age < 3 years0.013393
madagascar0.013393
antananarivo0.013393
nepal0.013393
himalayas0.013393
state of michigan0.013393
age 50-60 years0.013393
nanning city prefecture0.013393
age 60-790.013393
mouse0.013393
small village0.013393
farm0.013393
fresh water0.013393
skin0.013393
wastewater treatment plant0.013393
ethiopia0.013393
eagle harbor0.008929
azerbaijan0.008929
papio kindae0.008929
kinda baboon0.008929
native american0.008929
arapaho0.008929
cheyenne0.008929
ulcerative colitis0.008929
italy0.008929
toronto0.008929
Exp. ID User ID Description Date Region Flag Sequences
351amnoncommon sea urchin, lytechinus variegatus, research facility, eagle harbor, state of florida, united states of america, digestive system2018-07-30v4No1 / 11
404amnon high in high bmi obesity compared to lean body mass low bmi in homo sapiens feces adult colombia city 2018-11-20v4No1 / 14
276amnonhighfreq feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 15
371amnonNEGATIVELY correlated with age in amerindians ( high in infant obsolete_juvenile stage compared to adult in feces homo sapiens venezuela hunter gatherer amerindian )2018-09-06v4No1 / 15
409amnonhighfreq homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 15
365amnonhighfreq homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 16
411amnonhighfreq zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 16
365amnonhighfreq homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 17
294amnonhigh freq. in non-IBS healthy controls (highfreq homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 18
121amnonhighfreq homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 19
401amnonhighfreq homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 19
197amnonhighfreq feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 20
242amnonhigh freq. in native-americans (highfreq homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 20
394amnonhighfreq homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 20
409amnonhighfreq homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 20
247amnonhighfreq homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 21
398amnonhigh freq. in feces of healthy adults from belgium (highfreq homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 21
409amnonhighfreq homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 21
284amnonhighfreq homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 22
293amnonhighfreq homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 22
10amnonhighfreq homo sapiens, feces, toronto2016-10-27v4No1 / 23
73amnonhighfreq homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 23
132amnonhighfreq homo sapiens, feces, united states of america2017-04-16v4No1 / 23
303amnonhighfreq homo sapiens, feces, germany, adult2018-03-12v4No1 / 23
312amnonhighfreq feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 23
390amnonlower in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in non c. diff diarrhea compared to clostridium difficile intestinal infectious disease in homo sapiens feces australia hospital diarrhea )2018-11-04v4No1 / 23
394amnonhighfreq homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 23
239amnonhighfreq homo sapiens, feces, united states of america2017-11-08v4No1 / 24
365amnonhighfreq homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 24
566amnonhighfreq adult, homo sapiens, china, feces2019-11-24v4No1 / 24
53amnonhighfreq lima, homo sapiens, feces, city, shantytown2017-01-21v4No1 / 25
62amnonhighfreq homo sapiens, feces, obsolete_juvenile stage, child, united states of america2017-02-13v4No1 / 26
410amnonlower in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america biopsy biopsy site rectum )2018-11-22v4No1 / 26
438amnonhighfreq feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 26
438amnonhighfreq homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 27
319amnonhighfreq homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 28
365amnonhighfreq homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 28
438amnonhighfreq homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 29
36amnonhigher in centernarians ( high in centererians compared to adult in homo sapiens feces sichuan province )2016-12-06v4No1 / 30
320amnoncommon homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 30
438amnonhighfreq homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 30
191amnonlower in preterm birth vaginal samples ( high in control compared to premature birth in homo sapiens vagina female united states of america pregnancy )2017-09-05v4No1 / 37
51amnoncommon homo sapiens, biopsy site, biopsy, united states of america2017-01-19v4No1 / 38
320amnonhigher in CD patients with remission ( high in remission compared to crohn's disease in homo sapiens feces adult )2018-04-19v4No1 / 38
390amnoncommon homo sapiens, feces, australia, hospital, diarrhea2018-11-04v4No1 / 38
74amnonHigher in plant diet compared to animal product diet ( high in diet plant diet compared to animal product diet in homo sapiens feces united states of america )2017-02-27v4No1 / 39
131amnonnegatively correlated with age (30-80 years) ( high in age age 30-50 years compared to age 50-80 years in homo sapiens feces south korea )2017-04-16v4No1 / 39
19amnoncommon in biopsies of children (IBD study) (common rectum, terminal ileum, sigmoid colon, caecum, colon, biopsy, children, homo sapiens, united states of america)2016-11-14v4No1 / 40
352amnoncommon homo sapiens, feces, new delhi, india2018-07-30v4No1 / 41
51amnoncommon feces, homo sapiens, united states of america2017-01-19v4No1 / 42
241amnoncommon in babies age < 3 years in russia (common homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 44
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 44
207amnonlower in people hospitalized with diarrhea compared to healthy controls ( high in control compared to diarrhea in feces homo sapiens israel )2017-10-05v4No1 / 47
121amnoncommon homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 50
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in american diet diet compared to cron diet caloric restriction diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 61
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 63
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 66
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
425amnoncommon homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 73
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
74amnoncommon united states of america, feces, homo sapiens2017-02-27v4No1 / 76
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v4No1 / 76
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
122amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 77
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 77
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
339amnoncommon homo sapiens, feces, adult, india2018-05-24v4No1 / 81
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
562amnoncommon age 5-13 years, child, ecuador, quito, feces2019-11-05v4No1 / 82
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in homo sapiens feces adult age 50-60 years nanning city prefecture china )2018-01-27v4No1 / 83
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
227amnonhiger in first 24hrs compared to later timepoints in baby nasopharynx ( high in age age <=24 hours compared to age >= 7 days in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v4No1 / 85
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 85
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 97
438amnoncommon homo sapiens, feces, age 19-24, china2018-12-30v4No1 / 101
425amnon high in antananarivo madagascar compared to central african republic bangui in homo sapiens africa child duodenum 2018-12-08v4No1 / 103
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
438amnoncommon feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 111
517amnoncommon feces, homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department2019-05-29v4No1 / 113
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v4No1 / 120
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
294amnon high in control compared to irritable bowel syndrome in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 121
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 121
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 125
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
39amnoncommon in obese lepr-db mice (common mus musculus, research facility, feces, obesity)2016-12-09v4No1 / 132
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, obese body mass index status, db/db mouse, obesity2017-10-22v4No1 / 137
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 138
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens united states of america feces )2017-04-11v4No1 / 139
212amnonhigher in obese mice fed quinoa diet compared to ain-93g rodent diet ( high in diet quinoa food product compared to ain-93g rodent diet in mouse mus musculus feces research facility united states of america obese body mass index status db/db mouse obesity )2017-10-22v4No1 / 143
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 146
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 146
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 168
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
567amnon high in pair of nares anterior naris compared to nasopharynx in belgium adult homo sapiens 2019-12-05v4No1 / 186
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
411amnoncommon zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 200
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon adult, homo sapiens, china, feces2019-11-24v4No1 / 221
411amnoncommon zambia, feces, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 224
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 237
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 279
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
510amnoncommon kingdom of spain, water, estuary, estuary water, fresh water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
532amnon high in control compared to short bowel syndrome in homo sapiens feces czech republic adult 2019-07-21v1No1 / 334
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 343
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth 0.5m jiulong river fujian province china )2017-11-23v4No1 / 356
565amnoncommon toronto zoo, captive, zoological garden, olive baboon, papio anubis, canada, skin2019-11-21v3No1 / 368
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
424amnoncommon sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 452
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
160amnoncommon in wastewater treatment plant effluent in autumn in china (common autumn, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 469
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
160amnoncommon in wastewater treatment plant effluent in spring in china (common wastewater treatment plant, effluent, spring, china)2017-07-12v4No1 / 573
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181

Problems / suggestions? Please email info AT dbbact DOT org