Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGATTAGCAAGTCTGATGTGAAAGGCAGGGGCTCAACCCCTGGACTGCATTGGAAACTGCCAGTCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.547784
feces0.489689
adult0.339909
child0.246154
rural community0.160329
united states of america0.142431
china0.117647
city0.114068
zoological garden0.109091
control0.108108
pig0.107623
sus scrofa0.107623
obsolete_juvenile stage0.101695
monkey0.084507
india0.076923
jiangsu province0.070175
infant0.068966
italy0.067797
small village0.065076
age 5-13 years0.064725
LOWER IN crohn's disease0.064103
age 2-4 years0.063694
united kingdom0.058997
hunter gatherer0.052516
biopsy0.052061
thailand0.051613
chuquisaca department0.051613
jiangxi province0.050314
bolivia0.049080
farm0.048900
age0.048193
kingdom of spain0.047904
state of tennessee0.047904
female0.041885
canada0.040000
nigeria0.039604
papio anubis0.039604
colombia0.039474
weaned0.039216
age 4-7 weeks0.039216
corn and soybean diet0.039216
biopsy site0.039216
left colon0.039216
age >940.039216
age 130.039216
LOWER IN ulcerative colitis0.038961
right colon0.038835
LOWER IN duodenum0.038710
rectum0.038462
state of colorado0.038095
finland0.038095
LOWER IN united states of america0.037736
kingdom of norway0.037736
juvenile organism0.037736
ethiopia0.037736
caecum0.033333
skin0.032520
gay0.026667
metabolic syndrome0.026667
amerindian0.026667
venezuela0.026667
gorilla gorilla0.026667
olive baboon0.026667
new delhi0.026490
hmong0.026490
LOWER IN diarrhea0.026490
bangladesh0.026490
taiwan0.026490
taipei city0.026490
homosexual0.026490
msm0.026490
nanchang city prefecture0.026490
age 8-120.026490
age 60-790.026490
age 30-500.026490
toronto0.026490
glasgow0.026490
oslo0.026490
age 30-400.026490
myanmar0.026490
karen0.026490
age 13-140.026490
kebbi state0.026490
age 10-15 years0.026490
hadza0.026490
LOWER IN age < 1 year0.026490
zambia0.026490
tunapuco0.026490
wastewater treatment plant0.026490
chlorocebus aethiops0.026490
LOWER IN mouth mucosa0.026490
LOWER IN infant0.026316
autistic disorder0.026144
LOWER IN city0.026144
LOWER IN child0.026144
age < 3 years0.026144
tanzania0.026144
peru0.026144
kingdom of denmark0.026144
french republic0.025974
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.000000
rural community0.857143
small village0.750000
hunter gatherer0.750000
india0.666667
nigeria0.666667
age 5-13 years0.666667
gay0.666667
metabolic syndrome0.666667
amerindian0.666667
venezuela0.666667
gorilla gorilla0.666667
papio anubis0.666667
olive baboon0.666667
biopsy0.600000
colombia0.600000
LOWER IN crohn's disease0.555556
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
age 2-4 years0.500000
child0.500000
columbia0.500000
normal stool0.500000
LOWER IN hard stool0.500000
non c. diff diarrhea0.500000
LOWER IN clostridium difficile intestinal infectious disease0.500000
biopsy site0.500000
mild0.500000
LOWER IN severe0.500000
guangzhou city prefecture0.500000
stroke0.500000
endospore enriched fraction0.500000
lysis0.500000
new delhi0.500000
hmong 2nd generation0.500000
hmong0.500000
sudan0.500000
LOWER IN diarrhea0.500000
bangladesh0.500000
native american0.500000
arapaho0.500000
cheyenne0.500000
jordan0.500000
taiwan0.500000
taipei city0.500000
quito0.500000
denver0.500000
homosexual0.500000
msm0.500000
age 200.500000
himalayas0.500000
raji0.500000
metabolic syndrome x0.500000
nanchang city prefecture0.500000
thailand0.500000
azerbaijan0.500000
age 19-240.500000
age 8-120.500000
commonwealth of pennsylvania0.500000
LOWER IN inflammatory bowel disease0.500000
age 3-60.500000
lima0.500000
shantytown0.500000
age 60-790.500000
chuquisaca department0.500000
age 30-500.500000
left colon0.500000
irritable bowel syndrome0.500000
LOWER IN irritable bowel syndrome0.500000
age >940.500000
toronto0.500000
glasgow0.500000
oslo0.500000
age 30-400.500000
myanmar0.500000
karen0.500000
cron diet0.500000
age 13-140.500000
age 130.500000
LOWER IN india0.500000
kebbi state0.500000
age 10-15 years0.500000
urinary schistosomiasis0.500000
schistosomiasis0.500000
el salvador0.500000
gallbladder0.500000
bile0.500000
cholelithiasis0.500000
estonia0.500000
LOWER IN age 1-3 weeks0.500000
LOWER IN age 3-60.500000
hadza0.500000
preweaned0.500000
age 2-4 weeks0.500000
suckling0.500000
low anterior resection0.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
spondyloarthritis0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.897959
homo sapiens0.829932
adult0.326531
united states of america0.210884
china0.163265
child0.163265
control0.122449
rural community0.088435
city0.068027
pig0.061224
sus scrofa0.061224
obsolete_juvenile stage0.061224
zoological garden0.061224
monkey0.047619
italy0.040816
india0.040816
jiangsu province0.040816
infant0.040816
farm0.034014
age 2-4 years0.034014
small village0.034014
age 5-13 years0.034014
LOWER IN crohn's disease0.034014
united kingdom0.034014
jiangxi province0.027211
biopsy0.027211
female0.027211
thailand0.027211
bolivia0.027211
chuquisaca department0.027211
kingdom of spain0.027211
hunter gatherer0.027211
age0.027211
state of tennessee0.027211
weaned0.020408
age 4-7 weeks0.020408
corn and soybean diet0.020408
biopsy site0.020408
rectum0.020408
LOWER IN ulcerative colitis0.020408
LOWER IN united states of america0.020408
nigeria0.020408
colombia0.020408
state of colorado0.020408
right colon0.020408
left colon0.020408
age >940.020408
kingdom of norway0.020408
age 130.020408
juvenile organism0.020408
finland0.020408
LOWER IN duodenum0.020408
canada0.020408
papio anubis0.020408
skin0.020408
ethiopia0.020408
caecum0.020408
autistic disorder0.013605
LOWER IN city0.013605
czech republic0.013605
LOWER IN control0.013605
new delhi0.013605
hmong0.013605
LOWER IN diarrhea0.013605
bangladesh0.013605
taiwan0.013605
taipei city0.013605
homosexual0.013605
gay0.013605
msm0.013605
metabolic syndrome0.013605
nanchang city prefecture0.013605
age 8-120.013605
LOWER IN child0.013605
belgium0.013605
age 60-790.013605
age 30-500.013605
amerindian0.013605
venezuela0.013605
toronto0.013605
glasgow0.013605
oslo0.013605
age 30-400.013605
myanmar0.013605
karen0.013605
age 13-140.013605
LOWER IN infant0.013605
kebbi state0.013605
age 10-15 years0.013605
age < 3 years0.013605
LOWER IN finland0.013605
tanzania0.013605
hadza0.013605
LOWER IN ileum0.013605
LOWER IN age < 1 year0.013605
french republic0.013605
zambia0.013605
gorilla gorilla0.013605
peru0.013605
tunapuco0.013605
Exp. ID User ID Description Date Region Flag Sequences
521amnonhigh freq. in weaned pigs (highfreq pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 9
564amnon high in control compared to autistic disorder in feces italy age 2-4 years child homo sapiens 2019-11-18v3No1 / 14
564amnonhighfreq control, feces, italy, age 2-4 years, child, homo sapiens2019-11-18v3No1 / 18
564amnonhighfreq autistic disorder, feces, italy, age 2-4 years, child, homo sapiens2019-11-18v3No1 / 20
290amnon high in rural community small village compared to city in homo sapiens feces adult china 2018-02-01v4No1 / 21
404amnon high in normal stool compared to hard stool in homo sapiens feces columbia city adult 2018-11-20v4No1 / 21
552amnonhighfreq feces, homo sapiens, czech republic2019-09-05v3No1 / 22
390amnonlower in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in non c. diff diarrhea compared to clostridium difficile intestinal infectious disease in homo sapiens feces australia hospital diarrhea )2018-11-04v4No1 / 23
410amnonlower in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america biopsy biopsy site rectum )2018-11-22v4No1 / 26
333amnonhigher in stroke patients compared to healthy controls ( high in stroke compared to control in homo sapiens feces guangzhou city prefecture adult china )2018-05-15v4No1 / 30
401amnonhigher in endospore enriched (lysis resistant) replicates ( high in endospore enriched fraction lysis compared to control in homo sapiens feces united states of america adult )2018-11-18v4No1 / 31
352amnoncommon homo sapiens, feces, new delhi, india2018-07-30v4No1 / 41
400amnonhigher in children of hmong migrands born in the usa compared to non-migrant usa people ( high in hmong 2nd generation hmong compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 41
564amnoncommon autistic disorder, feces, italy, age 2-4 years, child, homo sapiens2019-11-18v3No1 / 42
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 44
207amnonlower in people hospitalized with diarrhea compared to healthy controls ( high in control compared to diarrhea in feces homo sapiens israel )2017-10-05v4No1 / 47
121amnoncommon homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 50
564amnoncommon control, feces, italy, age 2-4 years, child, homo sapiens2019-11-18v3No1 / 50
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 66
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
529amnoncommon homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v3No1 / 79
339amnoncommon homo sapiens, feces, adult, india2018-05-24v4No1 / 81
562amnoncommon age 5-13 years, child, ecuador, quito, feces2019-11-05v4No1 / 82
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 85
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
438amnoncommon homo sapiens, feces, age 19-24, china2018-12-30v4No1 / 101
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
438amnoncommon feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 111
517amnoncommon feces, homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department2019-05-29v4No1 / 113
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
294amnon high in control compared to irritable bowel syndrome in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 121
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 125
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 125
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to biopsy rectum biopsy site in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 126
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 138
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 146
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 168
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
521amnoncommon in pre-weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
411amnoncommon zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 200
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon adult, homo sapiens, china, feces2019-11-24v4No1 / 221
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 345
565amnoncommon african lion safari, captive, zoological garden, red kangaroo, macropus rufus, canada, skin2019-11-21v3No1 / 360
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
565amnoncommon toronto zoo, captive, zoological garden, olive baboon, papio anubis, canada, skin2019-11-21v3No1 / 368
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
160amnoncommon in wastewater treatment plant effluent in autumn in china (common autumn, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 469
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 474
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org