Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAAGGCAAGTCTGAAGTGAAAGCCCGGTGCTTAACGCCGGGACTGCTTTGGAAACTGTTTAGCTGGAGTGCCGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.516543
feces0.389588
adult0.340467
child0.237037
united states of america0.221044
obsolete_juvenile stage0.139130
city0.124031
biopsy0.117073
rural community0.093750
control0.085409
infant0.080000
biopsy site0.079734
metabolic syndrome0.079208
india0.077670
LOWER IN crohn's disease0.076923
LOWER IN ulcerative colitis0.076677
rectum0.074766
state of colorado0.073394
female0.062500
metabolic syndrome x0.059406
toronto0.059406
africa0.059406
left colon0.059406
age 130.059406
chuquisaca department0.059406
right colon0.058537
age 5-13 years0.057692
caecum0.057554
finland0.056872
juvenile organism0.056075
bolivia0.056075
united kingdom0.055300
kingdom of spain0.054545
age0.052632
male0.041237
heterosexual0.040816
msw0.040816
gay0.040816
age 2-4 years0.040404
mild0.040404
LOWER IN severe0.040404
sigmoid colon0.040404
children0.040404
commonwealth of pennsylvania0.040404
central african republic0.040404
bangui0.040404
denver0.040404
homosexual0.040404
msm0.040404
new delhi0.040404
oslo0.040404
age 30-400.040404
small village0.040404
estonia0.040404
LOWER IN age < 1 year0.040404
LOWER IN mouth mucosa0.040404
colombia0.040000
LOWER IN infant0.040000
LOWER IN rural community0.040000
autistic disorder0.039604
terminal ileum0.039604
american diet0.039604
age < 3 years0.039604
kingdom of denmark0.039604
small intestine0.038835
LOWER IN duodenum0.038835
LOWER IN female0.038095
commonwealth of virginia0.038095
belgium0.036697
LOWER IN mouth0.036697
LOWER IN feces0.036364
kingdom of norway0.036036
duodenum0.035398
sus scrofa0.035398
pig0.035398
italy0.034783
diet0.033613
colon0.030075
resistant starch type 4 diet0.020619
columbia0.020619
normal stool0.020619
LOWER IN hard stool0.020619
LOWER IN premature birth0.020619
LOWER IN cron diet0.020619
native american0.020619
arapaho0.020619
cheyenne0.020619
age 200.020619
LOWER IN egypt0.020619
azerbaijan0.020619
LOWER IN inflammatory bowel disease0.020619
lima0.020619
shantytown0.020619
irritable bowel syndrome0.020619
LOWER IN gangcha region0.020619
gannan tibetan autonomous prefecture0.020619
cron diet0.020619
thailand0.020619
hmong0.020619
LOWER IN karen0.020619
Fraction of dbbact annotations with this term covered by the query
TermScore
male1.000000
biopsy0.800000
biopsy site0.750000
metabolic syndrome0.666667
heterosexual0.666667
msw0.666667
gay0.666667
metabolic syndrome x0.500000
resistant starch type 4 diet0.500000
toronto0.500000
age 2-4 years0.500000
columbia0.500000
normal stool0.500000
LOWER IN hard stool0.500000
mild0.500000
LOWER IN severe0.500000
LOWER IN premature birth0.500000
sigmoid colon0.500000
children0.500000
LOWER IN cron diet0.500000
native american0.500000
arapaho0.500000
cheyenne0.500000
commonwealth of pennsylvania0.500000
africa0.500000
central african republic0.500000
bangui0.500000
denver0.500000
homosexual0.500000
msm0.500000
age 200.500000
LOWER IN egypt0.500000
azerbaijan0.500000
LOWER IN inflammatory bowel disease0.500000
lima0.500000
shantytown0.500000
left colon0.500000
irritable bowel syndrome0.500000
new delhi0.500000
india0.500000
LOWER IN gangcha region0.500000
gannan tibetan autonomous prefecture0.500000
oslo0.500000
age 30-400.500000
cron diet0.500000
thailand0.500000
hmong0.500000
LOWER IN karen0.500000
LOWER IN myanmar0.500000
age 130.500000
LOWER IN india0.500000
glasgow0.500000
el salvador0.500000
small village0.500000
gallbladder0.500000
bile0.500000
cholelithiasis0.500000
estonia0.500000
age<17 years0.500000
LOWER IN russia0.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
spondyloarthritis0.500000
spondylitis0.500000
canada0.500000
atherosclerosis0.500000
bogota0.500000
LOWER IN municipality of santiago de cali0.500000
LOWER IN bucaramanga0.500000
LOWER IN barranquilla0.500000
tunapuco0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
LOWER IN thailand0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
age one year0.500000
LOWER IN age one month0.500000
LOWER IN madagascar0.500000
LOWER IN antananarivo0.500000
LOWER IN age <1 year0.500000
chuquisaca department0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
LOWER IN mouth mucosa0.500000
forearm0.500000
LOWER IN crohn's disease0.444444
LOWER IN ulcerative colitis0.428571
rural community0.428571
child0.400000
obsolete_juvenile stage0.400000
colombia0.400000
right colon0.400000
LOWER IN infant0.400000
LOWER IN rural community0.400000
homo sapiens0.352201
starch diet0.333333
autistic disorder0.333333
rectum0.333333
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.968421
feces0.852632
united states of america0.463158
adult0.368421
child0.168421
control0.126316
city0.084211
obsolete_juvenile stage0.084211
biopsy0.063158
rural community0.052632
infant0.052632
metabolic syndrome0.042105
biopsy site0.042105
rectum0.042105
LOWER IN ulcerative colitis0.042105
female0.042105
caecum0.042105
state of colorado0.042105
LOWER IN crohn's disease0.042105
india0.042105
metabolic syndrome x0.031579
toronto0.031579
africa0.031579
right colon0.031579
left colon0.031579
kingdom of spain0.031579
age 130.031579
juvenile organism0.031579
finland0.031579
united kingdom0.031579
age0.031579
age 5-13 years0.031579
bolivia0.031579
chuquisaca department0.031579
diet0.021053
male0.021053
LOWER IN female0.021053
LOWER IN feces0.021053
autistic disorder0.021053
italy0.021053
age 2-4 years0.021053
mild0.021053
LOWER IN severe0.021053
commonwealth of virginia0.021053
terminal ileum0.021053
sigmoid colon0.021053
colon0.021053
children0.021053
american diet0.021053
commonwealth of pennsylvania0.021053
central african republic0.021053
bangui0.021053
denver0.021053
heterosexual0.021053
msw0.021053
homosexual0.021053
gay0.021053
msm0.021053
colombia0.021053
belgium0.021053
new delhi0.021053
duodenum0.021053
small intestine0.021053
kingdom of norway0.021053
oslo0.021053
age 30-400.021053
LOWER IN infant0.021053
small village0.021053
age < 3 years0.021053
estonia0.021053
LOWER IN age < 1 year0.021053
LOWER IN rural community0.021053
kingdom of denmark0.021053
LOWER IN duodenum0.021053
sus scrofa0.021053
pig0.021053
LOWER IN mouth mucosa0.021053
LOWER IN mouth0.021053
resistant starch type 4 diet0.010526
starch diet0.010526
LOWER IN control diet0.010526
columbia0.010526
normal stool0.010526
LOWER IN hard stool0.010526
vagina0.010526
pregnancy0.010526
LOWER IN premature birth0.010526
LOWER IN systemic lupus erythematosus0.010526
LOWER IN cron diet0.010526
LOWER IN caloric restriction diet0.010526
state of oklahoma0.010526
native american0.010526
arapaho0.010526
cheyenne0.010526
state of ohio0.010526
state of arizona0.010526
age 200.010526
LOWER IN egypt0.010526
germany0.010526
azerbaijan0.010526
Exp. ID User ID Description Date Region Flag Sequences
487amnonhigher in metabolic syndrome patients following resistant starch diet compared to control flour diet ( high in resistant starch type 4 diet starch diet diet compared to control diet in homo sapiens feces united states of america metabolic syndrome metabolic syndrome x )2019-02-24v4No1 / 6
10amnon high in male compared to female in homo sapiens feces toronto 2016-10-27v4No1 / 11
51amnonlower in stool compared to biopsies ( high in biopsy site biopsy compared to feces in homo sapiens united states of america )2017-01-19v4No1 / 14
564amnonhighfreq autistic disorder, feces, italy, age 2-4 years, child, homo sapiens2019-11-18v3No1 / 20
404amnon high in normal stool compared to hard stool in homo sapiens feces columbia city adult 2018-11-20v4No1 / 21
487amnonhighfreq homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 23
410amnonlower in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america biopsy biopsy site rectum )2018-11-22v4No1 / 26
191amnonlower in preterm birth vaginal samples ( high in control compared to premature birth in homo sapiens vagina female united states of america pregnancy )2017-09-05v4No1 / 37
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 39
19amnoncommon in biopsies of children (IBD study) (common rectum, terminal ileum, sigmoid colon, caecum, colon, biopsy, children, homo sapiens, united states of america)2016-11-14v4No1 / 40
564amnoncommon autistic disorder, feces, italy, age 2-4 years, child, homo sapiens2019-11-18v3No1 / 42
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in american diet diet compared to cron diet caloric restriction diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 61
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 77
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 79
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 121
380amnon high in gannan tibetan autonomous prefecture compared to gangcha region in tibet autonomous region feces homo sapiens tibetan plateau adult 2018-10-03v4No1 / 123
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 125
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 138
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens united states of america feces )2017-04-11v4No1 / 139
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
404amnon high in medellin metropolitan area bogota compared to municipality of santiago de cali bucaramanga barranquilla in homo sapiens feces adult colombia city 2018-11-20v4No1 / 237
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 343
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org