Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAAGGCAAGTCTGAAGTGAAAGCCCGGTGCTTAACGCCGGGACTGCTTTGGAAACTGTTTAGCTGGAGTGCCGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.531829
feces0.393917
adult0.356053
united states of america0.226826
child0.220472
obsolete_juvenile stage0.141593
city0.125984
biopsy0.119403
rural community0.095541
control0.088889
biopsy site0.081356
infant0.081301
metabolic syndrome0.080808
india0.079208
LOWER IN crohn's disease0.078431
LOWER IN ulcerative colitis0.078176
rectum0.076190
state of colorado0.074766
female0.064000
metabolic syndrome x0.060606
toronto0.060606
africa0.060606
left colon0.060606
age 130.060606
chuquisaca department0.060606
age 5-13 years0.060606
right colon0.059701
caecum0.059259
finland0.057971
juvenile organism0.057143
bolivia0.057143
united kingdom0.056338
kingdom of spain0.055556
age0.053571
heterosexual0.041667
msw0.041667
homosexual0.041667
gay0.041667
msm0.041667
mild0.041237
LOWER IN severe0.041237
sigmoid colon0.041237
children0.041237
commonwealth of pennsylvania0.041237
central african republic0.041237
bangui0.041237
denver0.041237
new delhi0.041237
oslo0.041237
age 30-400.041237
small village0.041237
estonia0.041237
LOWER IN age < 1 year0.041237
LOWER IN mouth mucosa0.041237
colombia0.040816
LOWER IN infant0.040816
LOWER IN rural community0.040816
terminal ileum0.040404
american diet0.040404
age < 3 years0.040404
kingdom of denmark0.040404
LOWER IN duodenum0.040000
small intestine0.039604
LOWER IN female0.038835
commonwealth of virginia0.038835
belgium0.038095
LOWER IN mouth0.037383
LOWER IN feces0.037037
duodenum0.036697
kingdom of norway0.036697
sus scrofa0.036036
pig0.036036
male0.035714
diet0.034483
colon0.031008
resistant starch type 4 diet0.021053
columbia0.021053
normal stool0.021053
LOWER IN hard stool0.021053
LOWER IN premature birth0.021053
LOWER IN cron diet0.021053
native american0.021053
arapaho0.021053
cheyenne0.021053
age 200.021053
LOWER IN egypt0.021053
azerbaijan0.021053
LOWER IN inflammatory bowel disease0.021053
lima0.021053
shantytown0.021053
irritable bowel syndrome0.021053
LOWER IN gangcha region0.021053
gannan tibetan autonomous prefecture0.021053
cron diet0.021053
thailand0.021053
hmong0.021053
LOWER IN karen0.021053
LOWER IN myanmar0.021053
LOWER IN india0.021053
glasgow0.021053
Fraction of dbbact annotations with this term covered by the query
TermScore
biopsy0.800000
biopsy site0.750000
metabolic syndrome0.666667
heterosexual0.666667
msw0.666667
homosexual0.666667
gay0.666667
msm0.666667
metabolic syndrome x0.500000
resistant starch type 4 diet0.500000
toronto0.500000
columbia0.500000
normal stool0.500000
LOWER IN hard stool0.500000
mild0.500000
LOWER IN severe0.500000
LOWER IN premature birth0.500000
sigmoid colon0.500000
children0.500000
LOWER IN cron diet0.500000
native american0.500000
arapaho0.500000
cheyenne0.500000
commonwealth of pennsylvania0.500000
africa0.500000
central african republic0.500000
bangui0.500000
denver0.500000
age 200.500000
LOWER IN egypt0.500000
azerbaijan0.500000
LOWER IN inflammatory bowel disease0.500000
lima0.500000
shantytown0.500000
left colon0.500000
irritable bowel syndrome0.500000
india0.500000
new delhi0.500000
LOWER IN gangcha region0.500000
gannan tibetan autonomous prefecture0.500000
oslo0.500000
age 30-400.500000
cron diet0.500000
thailand0.500000
hmong0.500000
LOWER IN karen0.500000
LOWER IN myanmar0.500000
age 130.500000
LOWER IN india0.500000
glasgow0.500000
el salvador0.500000
small village0.500000
cholelithiasis0.500000
bile0.500000
gallbladder0.500000
estonia0.500000
age<17 years0.500000
LOWER IN russia0.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
spondylitis0.500000
spondyloarthritis0.500000
atherosclerosis0.500000
bogota0.500000
LOWER IN municipality of santiago de cali0.500000
LOWER IN bucaramanga0.500000
LOWER IN barranquilla0.500000
tunapuco0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
LOWER IN thailand0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
age one year0.500000
LOWER IN age one month0.500000
LOWER IN madagascar0.500000
LOWER IN antananarivo0.500000
LOWER IN age <1 year0.500000
LOWER IN forearm0.500000
LOWER IN arm0.500000
chuquisaca department0.500000
age 5-13 years0.500000
LOWER IN mouth mucosa0.500000
forearm0.500000
LOWER IN crohn's disease0.444444
LOWER IN ulcerative colitis0.428571
rural community0.428571
child0.411765
obsolete_juvenile stage0.400000
colombia0.400000
right colon0.400000
LOWER IN infant0.400000
LOWER IN rural community0.400000
homo sapiens0.366667
adult0.337838
starch diet0.333333
rectum0.333333
LOWER IN systemic lupus erythematosus0.333333
terminal ileum0.333333
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.967742
feces0.849462
united states of america0.473118
adult0.376344
child0.150538
control0.129032
city0.086022
obsolete_juvenile stage0.086022
biopsy0.064516
rural community0.053763
infant0.053763
metabolic syndrome0.043011
biopsy site0.043011
rectum0.043011
LOWER IN ulcerative colitis0.043011
female0.043011
caecum0.043011
state of colorado0.043011
LOWER IN crohn's disease0.043011
india0.043011
metabolic syndrome x0.032258
toronto0.032258
africa0.032258
right colon0.032258
left colon0.032258
kingdom of spain0.032258
age 130.032258
juvenile organism0.032258
finland0.032258
united kingdom0.032258
age0.032258
chuquisaca department0.032258
bolivia0.032258
age 5-13 years0.032258
diet0.021505
male0.021505
LOWER IN female0.021505
LOWER IN feces0.021505
mild0.021505
LOWER IN severe0.021505
commonwealth of virginia0.021505
terminal ileum0.021505
sigmoid colon0.021505
colon0.021505
children0.021505
american diet0.021505
commonwealth of pennsylvania0.021505
central african republic0.021505
bangui0.021505
denver0.021505
heterosexual0.021505
msw0.021505
homosexual0.021505
gay0.021505
msm0.021505
colombia0.021505
belgium0.021505
new delhi0.021505
duodenum0.021505
small intestine0.021505
kingdom of norway0.021505
oslo0.021505
age 30-400.021505
LOWER IN infant0.021505
small village0.021505
age < 3 years0.021505
estonia0.021505
LOWER IN age < 1 year0.021505
LOWER IN rural community0.021505
kingdom of denmark0.021505
LOWER IN duodenum0.021505
sus scrofa0.021505
pig0.021505
LOWER IN mouth mucosa0.021505
LOWER IN mouth0.021505
resistant starch type 4 diet0.010753
starch diet0.010753
LOWER IN control diet0.010753
columbia0.010753
normal stool0.010753
LOWER IN hard stool0.010753
vagina0.010753
pregnancy0.010753
LOWER IN premature birth0.010753
LOWER IN systemic lupus erythematosus0.010753
LOWER IN cron diet0.010753
LOWER IN caloric restriction diet0.010753
state of oklahoma0.010753
native american0.010753
arapaho0.010753
cheyenne0.010753
state of ohio0.010753
state of arizona0.010753
age 200.010753
LOWER IN egypt0.010753
germany0.010753
azerbaijan0.010753
state of california0.010753
LOWER IN child0.010753
LOWER IN inflammatory bowel disease0.010753
Exp. ID User ID Description Date Region Flag Sequences
487amnonhigher in metabolic syndrome patients following resistant starch diet compared to control flour diet ( high in resistant starch type 4 diet starch diet diet compared to control diet in homo sapiens feces united states of america metabolic syndrome metabolic syndrome x )2019-02-24v4No1 / 6
10amnon high in male compared to female in homo sapiens feces toronto 2016-10-27v4No1 / 11
51amnonlower in stool compared to biopsies ( high in biopsy site biopsy compared to feces in homo sapiens united states of america )2017-01-19v4No1 / 14
404amnon high in normal stool compared to hard stool in homo sapiens feces columbia city adult 2018-11-20v4No1 / 21
487amnonhighfreq homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 23
410amnonlower in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to ulcerative colitis severe in homo sapiens child united states of america biopsy biopsy site rectum )2018-11-22v4No1 / 26
191amnonlower in preterm birth vaginal samples ( high in control compared to premature birth in homo sapiens vagina female united states of america pregnancy )2017-09-05v4No1 / 37
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 39
19amnoncommon in biopsies of children (IBD study) (common rectum, terminal ileum, sigmoid colon, caecum, colon, biopsy, children, homo sapiens, united states of america)2016-11-14v4No1 / 40
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in american diet diet compared to cron diet caloric restriction diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 61
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
516amnoncommon adult, state of ohio, united states of america, feces, homo sapiens2019-05-29v4No1 / 77
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 79
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to ulcerative colitis severe in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, india, new delhi, duodenum, small intestine)2018-07-30v4No1 / 121
380amnon high in gannan tibetan autonomous prefecture compared to gangcha region in tibet autonomous region feces homo sapiens tibetan plateau adult 2018-10-03v4No1 / 123
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 125
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 138
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens united states of america feces )2017-04-11v4No1 / 139
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common cholelithiasis, kingdom of spain, adult, bile, gallbladder, homo sapiens)2019-07-14v3No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
312amnoncommon feces, homo sapiens, french republic, adult, spondylitis, spondyloarthritis2018-04-09v4No1 / 197
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
404amnon high in medellin metropolitan area bogota compared to municipality of santiago de cali bucaramanga barranquilla in homo sapiens feces adult colombia city 2018-11-20v4No1 / 237
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 343
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
256amnoncommon sus scrofa, pig, united kingdom, caecum, right colon, left colon2017-11-26v4No1 / 490
352amnon high in small intestine duodenum compared to feces in homo sapiens india new delhi 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
517amnon high in feces compared to forearm arm skin in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 606
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 752
517amnon high in forearm arm skin compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org