Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAAGGCAAGTCTGAAGTGAAAGCCCGGTGCTTAACGCCGGGACTGCTTTGGAAACTGTTTGGCTGGAGTGCCGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.606639
feces0.481847
adult0.450939
child0.284024
united states of america0.211891
control0.153718
obsolete_juvenile stage0.136986
city0.133929
china0.131868
rural community0.077071
LOWER IN crohn's disease0.076923
africa0.076336
jiangsu province0.070922
small village0.063325
metabolic syndrome0.062992
colombia0.062663
LOWER IN ulcerative colitis0.062500
india0.062016
biopsy0.061069
rectum0.057554
infant0.057554
age0.057143
metabolic syndrome x0.047244
age 50-60 years0.047244
nanning city prefecture0.047244
thailand0.047244
state of colorado0.045627
kingdom of spain0.044118
female0.042781
caecum0.038961
medellin metropolitan area0.032258
state of oklahoma0.032258
heterosexual0.032258
msw0.032258
age 2-4 years0.032000
jordan0.032000
sigmoid colon0.032000
children0.032000
LOWER IN diarrhea0.032000
madagascar0.032000
antananarivo0.032000
commonwealth of pennsylvania0.032000
central african republic0.032000
bangui0.032000
denver0.032000
nanchang city prefecture0.032000
hmong0.032000
age 8-120.032000
age 3-60.032000
age 60-790.032000
age 30-500.032000
toronto0.032000
oslo0.032000
age 30-400.032000
age 130.032000
el salvador0.032000
LOWER IN age < 1 year0.032000
chuquisaca department0.032000
LOWER IN infant0.031746
autistic disorder0.031496
terminal ileum0.031496
tibet autonomous region0.031496
kingdom of denmark0.031496
age 5-13 years0.031496
finland0.031250
biopsy site0.031008
juvenile organism0.031008
LOWER IN duodenum0.031008
bolivia0.031008
united kingdom0.030769
tibetan plateau0.030075
czech republic0.030075
belgium0.029630
kingdom of norway0.029197
LOWER IN adult0.028986
state of california0.028571
italy0.028369
colon0.025157
LOWER IN colorectal adenocarcinoma0.016260
LOWER IN colorectal cancer0.016260
LOWER IN carcinoma0.016260
resistant starch type 4 diet0.016260
LOWER IN type i diabetes mellitus0.016260
columbia0.016260
normal stool0.016260
LOWER IN hard stool0.016260
mild0.016260
LOWER IN severe0.016260
daycare0.016260
age 1-5 years0.016260
native american0.016260
arapaho0.016260
cheyenne0.016260
LOWER IN nephrolithiasis0.016260
age 200.016260
LOWER IN egypt0.016260
azerbaijan0.016260
age 19-240.016260
LOWER IN central african republic0.016260
LOWER IN bangui0.016260
Fraction of dbbact annotations with this term covered by the query
TermScore
small village0.750000
metabolic syndrome0.666667
medellin metropolitan area0.666667
state of oklahoma0.666667
heterosexual0.666667
msw0.666667
colombia0.600000
LOWER IN ulcerative colitis0.571429
rural community0.571429
LOWER IN crohn's disease0.555556
LOWER IN colorectal adenocarcinoma0.500000
LOWER IN colorectal cancer0.500000
LOWER IN carcinoma0.500000
metabolic syndrome x0.500000
resistant starch type 4 diet0.500000
age 2-4 years0.500000
child0.500000
jordan0.500000
LOWER IN type i diabetes mellitus0.500000
columbia0.500000
normal stool0.500000
LOWER IN hard stool0.500000
mild0.500000
LOWER IN severe0.500000
sigmoid colon0.500000
children0.500000
LOWER IN diarrhea0.500000
daycare0.500000
age 1-5 years0.500000
native american0.500000
arapaho0.500000
cheyenne0.500000
africa0.500000
madagascar0.500000
antananarivo0.500000
commonwealth of pennsylvania0.500000
central african republic0.500000
bangui0.500000
india0.500000
denver0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
LOWER IN nephrolithiasis0.500000
age 200.500000
LOWER IN egypt0.500000
nanchang city prefecture0.500000
thailand0.500000
hmong0.500000
azerbaijan0.500000
age 19-240.500000
LOWER IN central african republic0.500000
LOWER IN bangui0.500000
age 8-120.500000
LOWER IN inflammatory bowel disease0.500000
age 3-60.500000
age 60-790.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
age 30-500.500000
irritable bowel syndrome0.500000
toronto0.500000
oslo0.500000
age 30-400.500000
myanmar0.500000
karen0.500000
cron diet0.500000
age 13-140.500000
LOWER IN karen0.500000
LOWER IN myanmar0.500000
age 130.500000
glasgow0.500000
el salvador0.500000
gallbladder0.500000
bile0.500000
cholelithiasis0.500000
age<17 years0.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
spondyloarthritis0.500000
spondylitis0.500000
LOWER IN age >940.500000
canada0.500000
atherosclerosis0.500000
bogota0.500000
LOWER IN municipality of santiago de cali0.500000
LOWER IN bucaramanga0.500000
LOWER IN barranquilla0.500000
nephrolithiasis0.500000
age 1-20.500000
LOWER IN age 0-10.500000
male0.500000
bangladesh0.500000
tunapuco0.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
LOWER IN lima0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.975207
feces0.917355
adult0.446281
united states of america0.330579
child0.198347
control0.190083
china0.181818
obsolete_juvenile stage0.082645
city0.082645
africa0.041322
jiangsu province0.041322
LOWER IN crohn's disease0.041322
rural community0.041322
metabolic syndrome0.033058
biopsy0.033058
rectum0.033058
LOWER IN ulcerative colitis0.033058
colombia0.033058
india0.033058
female0.033058
small village0.033058
infant0.033058
age0.033058
metabolic syndrome x0.024793
caecum0.024793
state of colorado0.024793
age 50-60 years0.024793
nanning city prefecture0.024793
thailand0.024793
kingdom of spain0.024793
autistic disorder0.016529
italy0.016529
age 2-4 years0.016529
jordan0.016529
biopsy site0.016529
terminal ileum0.016529
sigmoid colon0.016529
colon0.016529
children0.016529
LOWER IN diarrhea0.016529
medellin metropolitan area0.016529
tibet autonomous region0.016529
tibetan plateau0.016529
state of oklahoma0.016529
madagascar0.016529
antananarivo0.016529
commonwealth of pennsylvania0.016529
central african republic0.016529
bangui0.016529
denver0.016529
heterosexual0.016529
msw0.016529
state of california0.016529
nanchang city prefecture0.016529
hmong0.016529
czech republic0.016529
age 8-120.016529
belgium0.016529
age 3-60.016529
age 60-790.016529
age 30-500.016529
toronto0.016529
LOWER IN adult0.016529
kingdom of norway0.016529
oslo0.016529
age 30-400.016529
age 130.016529
juvenile organism0.016529
finland0.016529
LOWER IN infant0.016529
el salvador0.016529
united kingdom0.016529
LOWER IN age < 1 year0.016529
kingdom of denmark0.016529
LOWER IN duodenum0.016529
age 5-13 years0.016529
bolivia0.016529
chuquisaca department0.016529
LOWER IN colorectal adenocarcinoma0.008264
LOWER IN colorectal cancer0.008264
LOWER IN carcinoma0.008264
resistant starch type 4 diet0.008264
starch diet0.008264
diet0.008264
LOWER IN control diet0.008264
LOWER IN type i diabetes mellitus0.008264
LOWER IN diabetes mellitus0.008264
columbia0.008264
normal stool0.008264
LOWER IN hard stool0.008264
mild0.008264
LOWER IN severe0.008264
sichuan province0.008264
israel0.008264
daycare0.008264
age 1-5 years0.008264
native american0.008264
arapaho0.008264
cheyenne0.008264
nigeria0.008264
Exp. ID User ID Description Date Region Flag Sequences
239amnon high in control compared to colorectal adenocarcinoma colorectal cancer carcinoma in homo sapiens feces united states of america 2017-11-08v4No1 / 2
487amnonhigher in metabolic syndrome patients following resistant starch diet compared to control flour diet ( high in resistant starch type 4 diet starch diet diet compared to control diet in homo sapiens feces united states of america metabolic syndrome metabolic syndrome x )2019-02-24v4No1 / 6
564amnonhighfreq autistic disorder, feces, italy, age 2-4 years, child, homo sapiens2019-11-18v3No1 / 20
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces jordan child obsolete_juvenile stage 2018-08-30v4No1 / 21
404amnon high in normal stool compared to hard stool in homo sapiens feces columbia city adult 2018-11-20v4No1 / 21
487amnonhighfreq homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 23
410amnonlower in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america biopsy biopsy site rectum )2018-11-22v4No1 / 26
19amnoncommon in biopsies of children (IBD study) (common rectum, terminal ileum, sigmoid colon, caecum, colon, biopsy, children, homo sapiens, united states of america)2016-11-14v4No1 / 40
564amnoncommon autistic disorder, feces, italy, age 2-4 years, child, homo sapiens2019-11-18v3No1 / 42
36amnoncommon homo sapiens, feces, sichuan province2016-12-06v4No1 / 44
207amnonlower in people hospitalized with diarrhea compared to healthy controls ( high in control compared to diarrhea in feces homo sapiens israel )2017-10-05v4No1 / 47
482amnoncommon homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, age 1-5 years2019-02-12v4No1 / 47
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 66
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
425amnoncommon homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 73
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 77
556amnoncommon homo sapiens, feces, united states of america, adult2019-09-14v1No1 / 77
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 79
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v4No1 / 81
339amnoncommon homo sapiens, feces, adult, india2018-05-24v4No1 / 81
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in homo sapiens feces adult age 50-60 years nanning city prefecture china )2018-01-27v4No1 / 83
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
532amnoncommon homo sapiens, feces, czech republic, adult, control2019-07-21v1No1 / 98
438amnoncommon homo sapiens, feces, age 19-24, china2018-12-30v4No1 / 101
425amnon high in antananarivo madagascar compared to central african republic bangui in homo sapiens africa child duodenum 2018-12-08v4No1 / 103
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
438amnoncommon feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 111
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 125
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens adult feces china 2018-02-05v4No1 / 161
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon adult, homo sapiens, china, feces2019-11-24v4No1 / 221
404amnon high in medellin metropolitan area bogota compared to municipality of santiago de cali bucaramanga barranquilla in homo sapiens feces adult colombia city 2018-11-20v4No1 / 237
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 279
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
532amnon high in control compared to short bowel syndrome in homo sapiens feces czech republic adult 2019-07-21v1No1 / 334
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752

Problems / suggestions? Please email info AT dbbact DOT org