Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAGCGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGAATGGCTTTGGAAACTGTGCAGCTAGAGTACCGGAGGGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.372547
feces0.352346
adult0.299907
control0.147059
rural community0.130435
china0.116683
child0.111111
united states of america0.100549
italy0.095238
infant0.091146
kingdom of denmark0.088235
kingdom of spain0.080000
india0.076923
city0.075949
obsolete_juvenile stage0.068966
cameroon0.063492
small village0.062500
LOWER IN ulcerative colitis0.062500
lund0.062500
clayey till0.062500
late weichselian glaciation0.062500
LOWER IN crohn's disease0.061069
loam soil0.060606
monkey0.057143
age0.056738
thailand0.055556
agricultural field0.055556
age 50-60 years0.047619
nanning city prefecture0.047619
africa0.047619
cow milk (raw)0.047619
cow milk (fluid)0.047619
milk0.047619
guangzhou city prefecture0.047059
low bmi0.046512
LOWER IN infant0.046512
obesity0.045455
zoological garden0.044444
captive0.043796
LOWER IN feces0.042553
farm0.042105
colon0.039604
canada0.039604
wild0.038462
madagascar0.032520
lama guanicoe0.032258
LOWER IN diarrhea0.032258
zhengzhou city prefecture0.032258
LOWER IN iga positive fraction0.032258
iga negative fraction0.032258
yaounde0.032258
himalayas0.032258
municipality of logrono0.032258
hmong0.032258
cron diet0.032258
el salvador0.032258
LOWER IN finland0.032258
age 130.032258
age 60-790.032258
LOWER IN age >940.032258
lowland pasture0.032258
lowland farm0.032258
central chimpanzee0.032258
chuquisaca department0.032258
LOWER IN msw0.032000
LOWER IN heterosexual0.032000
nepal0.031746
nanchang city prefecture0.031746
age 19-240.031746
hispanic or latin american0.031746
msm0.031746
homosexual0.031746
age < 3 years0.031746
estonia0.031746
LOWER IN age &lt; 1 year0.031746
age 30-500.031746
macaca mulatta0.031746
pan troglodytes troglodytes0.031746
age 5-13 years0.031746
body mass index0.031496
LOWER IN captive0.031496
kingdom of norway0.031250
bolivia0.031250
lamb0.031250
new zealand0.031250
hiv infection0.030769
caloric restriction diet0.030769
LOWER IN high bmi0.030769
LOWER IN united states of america0.030769
LOWER IN duodenum0.030769
age 6 weeks0.030769
cow0.030534
egypt0.030303
juvenile organism0.030303
united kingdom0.030303
LOWER IN wild0.030075
bos taurus0.029197
sheep0.028571
female0.028369
state of california0.027778
Fraction of dbbact annotations with this term covered by the query
TermScore
cameroon0.666667
madagascar0.666667
lama guanicoe0.500000
rural community0.500000
small village0.500000
LOWER IN ulcerative colitis0.500000
LOWER IN stroke0.500000
LOWER IN diarrhea0.500000
autoimmune hepatitis0.500000
zhengzhou city prefecture0.500000
LOWER IN iga positive fraction0.500000
iga igg negative fraction0.500000
iga negative fraction0.500000
teenager0.500000
age 9-17 years0.500000
yaounde0.500000
LOWER IN ngoantet0.500000
himalayas0.500000
tharu0.500000
agrarian0.500000
antiretroviral therapy0.500000
human immunodeficiency virus infectious disease0.500000
municipality of logrono0.500000
municipality of reus0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
LOWER IN nephrolithiasis0.500000
age 2-5 years0.500000
africa0.500000
novosibirsk0.500000
raji0.500000
caribbean latino0.500000
hmong0.500000
LOWER IN usa born0.500000
non usa born0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
irritable bowel syndrome0.500000
gaz:000521000.500000
myanmar0.500000
karen0.500000
LOWER IN cross-cutucu0.500000
upano valley0.500000
shuar population0.500000
cron diet0.500000
LOWER IN karen0.500000
LOWER IN myanmar0.500000
LOWER IN cuba0.500000
alpine pasture0.500000
cow milk (raw)0.500000
cow milk (fluid)0.500000
milk0.500000
physical activity0.500000
LOWER IN little physical activity0.500000
oslo0.500000
age 30-400.500000
el salvador0.500000
LOWER IN finland0.500000
LOWER IN russia0.500000
age 130.500000
india0.500000
taipei city0.500000
low anterior resection0.500000
age 60-790.500000
LOWER IN age &gt;940.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
soldiers0.500000
nephrolithiasis0.500000
south american tapir0.500000
tapirus terrestris0.500000
antananarivo0.500000
LOWER IN bangui0.500000
LOWER IN central african republic0.500000
age 1-20.500000
LOWER IN age 0-10.500000
lowland pasture0.500000
lowland farm0.500000
bangladesh0.500000
indian rhesus macaque0.500000
cayo santiago0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN eastern chimpanzee0.500000
central chimpanzee0.500000
LOWER IN pan troglodytes verus0.500000
LOWER IN europe0.500000
LOWER IN lima0.500000
LOWER IN shantytown0.500000
LOWER IN age 0-6 months0.500000
indonesia0.500000
municipality of yogyakarta0.500000
depth 550-600cm0.500000
lund0.500000
clayey till0.500000
late weichselian glaciation0.500000
peromyscus maniculatus0.500000
deer mice0.500000
algonquin provincial park0.500000
rattus rattus0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.866667
homo sapiens0.775000
adult0.425000
control0.200000
china0.191667
united states of america0.175000
italy0.083333
child0.083333
rural community0.075000
infant0.058333
city0.050000
kingdom of spain0.050000
kingdom of denmark0.050000
obsolete_juvenile stage0.041667
india0.041667
small village0.033333
LOWER IN ulcerative colitis0.033333
cameroon0.033333
thailand0.033333
LOWER IN crohn&#39;s disease0.033333
farm0.033333
age0.033333
monkey0.033333
lund0.033333
agricultural field0.033333
clayey till0.033333
late weichselian glaciation0.033333
loam soil0.033333
guangzhou city prefecture0.025000
obesity0.025000
female0.025000
LOWER IN feces0.025000
colon0.025000
age 50-60 years0.025000
nanning city prefecture0.025000
africa0.025000
low bmi0.025000
cow milk (raw)0.025000
cow milk (fluid)0.025000
milk0.025000
LOWER IN infant0.025000
wild0.025000
canada0.025000
captive0.025000
zoological garden0.025000
research facility0.025000
lama guanicoe0.016667
LOWER IN diarrhea0.016667
zhengzhou city prefecture0.016667
LOWER IN iga positive fraction0.016667
iga negative fraction0.016667
kingdom of norway0.016667
yaounde0.016667
state of california0.016667
nepal0.016667
himalayas0.016667
hiv infection0.016667
municipality of logrono0.016667
madagascar0.016667
nanchang city prefecture0.016667
hmong0.016667
age 19-240.016667
hispanic or latin american0.016667
cron diet0.016667
caloric restriction diet0.016667
body mass index0.016667
LOWER IN high bmi0.016667
egypt0.016667
LOWER IN united states of america0.016667
LOWER IN msw0.016667
LOWER IN heterosexual0.016667
msm0.016667
homosexual0.016667
male0.016667
el salvador0.016667
age < 3 years0.016667
estonia0.016667
LOWER IN finland0.016667
age 130.016667
juvenile organism0.016667
LOWER IN age &lt; 1 year0.016667
age 30-500.016667
age 60-790.016667
LOWER IN age &gt;940.016667
lowland pasture0.016667
lowland farm0.016667
macaca mulatta0.016667
central chimpanzee0.016667
LOWER IN captive0.016667
pan troglodytes troglodytes0.016667
skin0.016667
bos taurus0.016667
cow0.016667
united kingdom0.016667
LOWER IN duodenum0.016667
age 5-13 years0.016667
bolivia0.016667
chuquisaca department0.016667
LOWER IN wild0.016667
lamb0.016667
Exp. ID User ID Description Date Region Flag Sequences
666amnondominant lama guanicoe, italy, feces2020-09-25v3No1 / 18
290amnon high in rural community small village compared to city in homo sapiens feces adult china 2018-02-01v4No1 / 21
779amnon high in control compared to ulcerative colitis in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v4No1 / 28
333amnonlower in stroke patients compared to healthy controls ( high in control compared to stroke in homo sapiens feces guangzhou city prefecture adult china )2018-05-15v4No1 / 30
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 39
597amnoncommon homo sapiens, feces, adult, zhejiang province, china, control2020-03-23v3No1 / 46
207amnonlower in people hospitalized with diarrhea compared to healthy controls ( high in control compared to diarrhea in feces homo sapiens israel )2017-10-05v4No1 / 47
720amnoncommon autoimmune hepatitis, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 48
830amnon high in iga igg negative fraction iga negative fraction compared to iga positive fraction in peru teenager age 9-17 years feces homo sapiens 2021-09-10v4No1 / 52
694amnoncommon china, shanghai district, obesity, adult, female, feces, homo sapiens2028-03-17v3No1 / 52
720amnoncommon control, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 56
194amnon high in colon ileum compared to feces in homo sapiens kingdom of norway 2017-09-07v4No1 / 67
594amnon high in yaounde city compared to rural community ngoantet in adult cameroon feces homo sapiens 2020-03-12v4No1 / 70
394amnon high in control compared to ulcerative colitis in homo sapiens feces adult united states of america state of california 2018-11-06v4No1 / 71
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
794amnoncommon antiretroviral therapy, human immunodeficiency virus infectious disease, hiv infection, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v4No1 / 75
732amnoncommon municipality of reus, kingdom of spain, adult, feces, homo sapiens2021-01-11v3No1 / 79
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in homo sapiens feces adult age 50-60 years nanning city prefecture china )2018-01-27v4No1 / 83
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
804amnon high in iga negative fraction compared to iga positive fraction in central african republic madagascar age 2-5 years child africa homo sapiens feces 2021-06-18v4No1 / 85
680amnoncommon obesity, adult, novosibirsk, russia, feces, homo sapiens2028-03-04v3No1 / 85
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
803amnoncommon control, commonwealth of massachusetts, age 50-80 years, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v4No1 / 89
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
601amnoncommon homo sapiens, feces, china, adult, control2020-03-30v4No1 / 93
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
663amnoncommon poland, low bmi, adult, feces, homo sapiens2020-09-22v4No1 / 98
438amnoncommon homo sapiens, feces, age 19-24, china2018-12-30v4No1 / 101
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
644amnonhigher in individuals born in latin america compared to indivuals born in usa ( high in non usa born compared to usa born in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 107
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
779amnon high in control compared to crohn's disease in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v4No1 / 127
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
607amnoncommon germany, homo sapiens, feces, control2020-04-19v4No1 / 128
721amnoncommon obesity, overweight body mass index status, adult, scotland, gaz:00052100, feces, homo sapiens2028-05-23v4No1 / 131
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
660amnonlower in the cross cutcu population (more modern) comparen to upano valley (less modern) ( high in upano valley compared to cross-cutucu in shuar population village rural community ecuador feces homo sapiens )2020-09-20v4No1 / 132
794amnoncommon control, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v4No1 / 133
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
617amnoncommon alpine pasture, alpine, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in homo sapiens feces united states of america )2017-12-04v4No1 / 140
63amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens united states of america feces )2017-04-12v4No1 / 141
62amnon high in egypt compared to united states of america in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 144
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
594amnoncommon adult, cameroon, feces, homo sapiens, city, yaounde2020-03-12v4No1 / 154
629amnon high in msm homosexual compared to msw heterosexual in male adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v4No1 / 154
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens adult feces china 2018-02-05v4No1 / 161
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, china, homo sapiens, adult2019-11-24v4No1 / 221
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in age 19-24 soldiers compared to adult age 30-50 age 60-79 age >94 in homo sapiens feces china )2018-12-30v4No1 / 238
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
666amnoncommon south american tapir, tapirus terrestris, italy, feces2020-09-25v3No1 / 242
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
617amnoncommon lowland pasture, lowland farm, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 257
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
770amnoncommon age < 1 year, infant, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 280
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
729amnon high in central chimpanzee pan troglodytes troglodytes cameroon wild compared to eastern chimpanzee pan troglodytes verus europe captive zoological garden in feces monkey 2021-01-05v3No1 / 288
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to metronidazole neomycin vancomycin antibiotic in state of california united states of america adult feces homo sapiens )2028-03-04v4No1 / 301
666amnoncommon wild boar, sus scrofa, italy, feces2020-09-25v3No1 / 305
723amnon high in age 2-4 years compared to age 0-6 months infant in homo sapiens indonesia municipality of yogyakarta feces child 2021-01-02v3No1 / 305
650amnon high in asian compared to caucasian european in feces adult homo sapiens united states of america state of new york 2020-09-12v4No1 / 317
565amnoncommon skin, canada, farm, bos taurus, cow2019-11-21v3No1 / 318
827sheryoCommon in soil at 575cm depth in clayey till loam soil, Lund Denmark (common depth 550-600cm, lund, kingdom of denmark, agricultural field, clayey till, late weichselian glaciation, loam soil)2021-09-13v3No1 / 318
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
729amnoncommon wild, cameroon, monkey, feces, pan troglodytes troglodytes, central chimpanzee2021-01-05v3No1 / 336
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 345
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to captive research facility in feces canada peromyscus maniculatus deer mice age 3-5 weeks province of ontario algonquin provincial park )2019-07-28v3No1 / 358
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
666amnoncommon rattus rattus, rat, italy, feces2020-09-25v3No1 / 406
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
666amnoncommon lama guanicoe, italy, feces2020-09-25v3No1 / 437
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
738amnon high in age 30 days compared to age 1 week in caecum united kingdom chicken gallus gallus 2021-01-30v3No1 / 474
666amnoncommon cow, bos taurus, italy, feces2020-09-25v3No1 / 482
617amnonlower in cow milk of cows in alpine pasture compared to lowland farm ( high in lowland farm lowland pasture compared to alpine pasture alpine in farm italy cow milk (raw) cow milk (fluid) milk )2020-05-03v3No1 / 484
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
578amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to msw heterosexual in homo sapiens feces hiv infection kingdom of spain sweden adult male )2020-01-14v3No1 / 519
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
729amnon high in captive zoological garden europe compared to wild cameroon in gorilla gorilla monkey feces 2021-01-05v3No1 / 656
565amnoncommon skin, canada, zoological garden, captive, tragelaphus oryx, eland, toronto zoo2019-11-21v3No1 / 674
666amnoncommon goat, capra hircus, italy, feces2020-09-25v3No1 / 674
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
827sheryoCommon in soil at 465cm depth in clayey till loam soil, Lund Denmark (common depth 450-480cm, lund, kingdom of denmark, agricultural field, clayey till, late weichselian glaciation, loam soil)2021-09-13v3No1 / 786
827sheryoCommon in soil at 325cm depth in clayey till loam soil, Lund Denmark (common lund, kingdom of denmark, agricultural field, clayey till, late weichselian glaciation, loam soil, depth 300-350cm)2021-08-24v3No1 / 866
649amnon high in colon compared to ileum in lamb age 6 weeks research facility new zealand ovis aries sheep 2020-09-07v3No1 / 897
671amnon high in age 8 months compared to age 6 months age 3 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 955
620amnon high in united states of america zoological garden pan troglodytes compared to nouabale-ndoki national park republic of congo wild pan troglodytes troglodytes in chimpanzee feces 2020-05-06v4No1 / 964
827sheryoCommon in soil at 95cm depth in clayey till loam soil, Lund Denmark (common sandy till , depth 70-120cm, loam soil, late weichselian glaciation, clayey till, agricultural field, kingdom of denmark, lund)2021-08-24v3No1 / 1142
649amnon high in colon compared to jejunum duodenum in lamb age 6 weeks research facility new zealand ovis aries sheep 2020-09-07v3No1 / 1261

Problems / suggestions? Please email info AT dbbact DOT org