Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAGTGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTGCAGCTAGAGTGTCGGAGAGGCAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
canis lupus familiaris0.486486
dog0.455531
china0.340824
feces0.252180
united states of america0.160860
homo sapiens0.146016
infant0.138593
research facility0.115556
italy0.109091
adult0.107107
zoological garden0.095726
city of melbourne0.095238
chicken0.094595
wolf0.093750
gallus gallus0.093489
formula fed0.090909
foxhound0.090909
caecum0.090090
rectum0.084507
colon0.078431
captive0.076923
state of north carolina0.074074
canis lupus0.069767
rectal swab0.068966
puppy0.062500
LOWER IN 1-month-old human stage0.062500
hispanic or latin american0.062500
crohn's disease0.060606
obsolete_juvenile stage0.060000
germany0.057971
city0.057143
LOWER IN control0.054857
french republic0.054054
state of minnesota0.052632
age 7 months0.047619
state of louisiana0.047619
hydrolized diet0.047619
age >940.047619
tenth decade human stage0.047619
cobb broiler chicken0.047619
commonwealth of pennsylvania0.046512
australia0.046512
ninth decade human stage0.046512
age 35 days0.046512
male0.043011
age0.039604
canada0.038095
skin0.035398
female0.032787
los angeles district0.032787
glasgow0.032787
age 2 days0.032258
flagstaff0.032258
LOWER IN breast fed0.032258
hmong0.032258
nephrolithiasis0.032258
nanning city prefecture0.032258
sixth decade human stage0.032258
wildlife sactuary0.032258
LOWER IN exocrine pancreatic insufficiency0.032258
dairy0.032258
toronto zoo0.032258
meat diet0.032258
hefei city prefecture0.032258
baijiu0.032258
LOWER IN 2-year-old human stage0.031746
juvenile organism0.031746
hispanic0.031746
LOWER IN estonia0.031746
age < 3 years0.031746
age 30 days0.031746
viet nam0.031746
LOWER IN thailand0.031746
high protein diet0.031746
mud0.031746
fermentation pit mud0.031746
12-month-old human stage0.031496
ulcerative colitis0.031250
age 8 weeks0.031250
state of arizona0.031250
adult organism0.031250
LOWER IN low bmi0.031008
6-month-old human stage0.030769
body mass index0.030534
LOWER IN rural community0.030534
LOWER IN high fiber0.030303
female organism0.030075
high bmi0.030075
rattus norvegicus0.029851
broiler chicken0.029851
LOWER IN ileum0.029412
kingdom of denmark0.029412
rat0.028986
control0.028470
LOWER IN dog0.027972
wild0.027778
ovis aries0.027778
LOWER IN canis lupus familiaris0.027397
child0.025641
LOWER IN child0.025641
Fraction of dbbact annotations with this term covered by the query
TermScore
china6.500000
city of melbourne1.000000
los angeles district1.000000
cuba1.000000
LOWER IN mexico1.000000
glasgow1.000000
wolf0.750000
canis lupus familiaris0.692308
colon0.666667
dog0.652174
age 2 days0.500000
puppy0.500000
LOWER IN no fructose diet0.500000
janvier labs0.500000
high sugar diet0.500000
age 18 weeks0.500000
formula fed0.500000
age 7 months0.500000
state of louisiana0.500000
enzyme supplement0.500000
LOWER IN no enzyme supplement0.500000
exocrine pancreatic insufficiency0.500000
flagstaff0.500000
foxhound0.500000
hydrolized diet0.500000
endospore enriched fraction0.500000
lysis0.500000
LOWER IN breast fed0.500000
LOWER IN 1-month-old human stage0.500000
hmong0.500000
hmong 2nd generation0.500000
hispanic or latin american0.500000
panthera tigris0.500000
tiger0.500000
high capacity running strain0.500000
LOWER IN low capacity running strain0.500000
age 38 weeks0.500000
gymnogyps californianus0.500000
california condor0.500000
przewalski horse0.500000
nephrolithiasis0.500000
nanning city prefecture0.500000
sixth decade human stage0.500000
age 2-7 years0.500000
lymphoma0.500000
LOWER IN dog breeding center0.500000
domestic0.500000
wildlife sactuary0.500000
adriatic sea coastal waters of italy0.500000
caretta caretta0.500000
loggerhead sea turtle0.500000
raw meat diet0.500000
LOWER IN dog food diet0.500000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
LOWER IN enzyme supplementation0.500000
LOWER IN exocrine pancreatic insufficiency0.500000
dairy0.500000
canis lupus arctos0.500000
toronto zoo0.500000
arctic wolf0.500000
dog breeding center0.500000
age >940.500000
tenth decade human stage0.500000
meat diet0.500000
LOWER IN myanmar0.500000
LOWER IN karen0.500000
cobb broiler chicken0.500000
LOWER IN tunapuco0.500000
apodemus sylvaticus0.500000
wood mouse0.500000
duck0.500000
gastric carcinoma0.500000
stomach neoplasm0.500000
jinzhou city prefecture0.500000
algonquin provincial park0.500000
peromyscus maniculatus0.500000
deer mice0.500000
sewage0.500000
hefei city prefecture0.500000
baijiu0.500000
days 0-900.500000
days 180-2700.500000
LOWER IN soldiers0.500000
multiple pregnancies0.500000
LOWER IN first pregnancy0.500000
state of north carolina0.333333
LOWER IN 2-year-old human stage0.333333
crohn's disease0.333333
commonwealth of pennsylvania0.333333
juvenile organism0.333333
green turtle0.333333
chelonia mydas0.333333
juvenile0.333333
juvenile stage0.333333
hispanic0.333333
LOWER IN estonia0.333333
age < 3 years0.333333
ovariectomy0.333333
Fraction of annotations for the query sequences containing the term
TermScore
feces0.800000
united states of america0.391667
canis lupus familiaris0.375000
dog0.350000
homo sapiens0.350000
china0.175000
research facility0.166667
adult0.158333
infant0.108333
LOWER IN control0.075000
italy0.075000
caecum0.066667
zoological garden0.058333
gallus gallus0.058333
chicken0.058333
germany0.050000
captive0.050000
canis lupus0.050000
wolf0.050000
formula fed0.050000
rectum0.050000
australia0.050000
city of melbourne0.050000
foxhound0.050000
state of north carolina0.041667
french republic0.041667
rectal swab0.041667
colon0.041667
control0.041667
puppy0.033333
crohn's disease0.033333
LOWER IN 1-month-old human stage0.033333
hispanic or latin american0.033333
state of minnesota0.033333
obsolete_juvenile stage0.033333
city0.033333
male0.033333
age0.025000
female0.025000
commonwealth of pennsylvania0.025000
age 7 months0.025000
state of louisiana0.025000
hydrolized diet0.025000
skin0.025000
canada0.025000
age >940.025000
ninth decade human stage0.025000
tenth decade human stage0.025000
cobb broiler chicken0.025000
age 35 days0.025000
age 2 days0.016667
LOWER IN 2-year-old human stage0.016667
child0.016667
ulcerative colitis0.016667
juvenile organism0.016667
age 8 weeks0.016667
state of arizona0.016667
flagstaff0.016667
LOWER IN breast fed0.016667
wild0.016667
hmong0.016667
state of california0.016667
los angeles district0.016667
hispanic0.016667
6-month-old human stage0.016667
LOWER IN estonia0.016667
age < 3 years0.016667
rattus norvegicus0.016667
rat0.016667
12-month-old human stage0.016667
LOWER IN child0.016667
nephrolithiasis0.016667
nanning city prefecture0.016667
sixth decade human stage0.016667
female organism0.016667
adult organism0.016667
LOWER IN canis lupus familiaris0.016667
LOWER IN dog0.016667
wildlife sactuary0.016667
body mass index0.016667
high bmi0.016667
LOWER IN low bmi0.016667
LOWER IN ileum0.016667
LOWER IN exocrine pancreatic insufficiency0.016667
LOWER IN high fiber0.016667
dairy0.016667
ovis aries0.016667
age 30 days0.016667
toronto zoo0.016667
viet nam0.016667
LOWER IN thailand0.016667
broiler chicken0.016667
high protein diet0.016667
meat diet0.016667
kingdom of denmark0.016667
glasgow0.016667
LOWER IN rural community0.016667
mud0.016667
fermentation pit mud0.016667
hefei city prefecture0.016667
Exp. ID User ID Description Date Region Flag Sequences
702amnon high in canis lupus familiaris dog compared to felis catus cat in feces united states of america state of north carolina 2028-04-02v4No1 / 8
766amnoncommon feces, canis lupus familiaris, french republic, dog, rectal swab, age 2 days, puppy2021-04-12v4No1 / 12
241amnonhigher in babies age <1 year compared to age 1-3 years ( high in age under-1-year-old human stage compared to age 1-3 years 2-year-old human stage 1-year-old human stage in feces homo sapiens infant )2017-11-13v4No1 / 13
522amnonhigher in fructose supplemented diets ( high in fructose diet fructose compared to no fructose diet in feces female research facility mus musculus c57bl/6j germany mouse janvier labs high sugar diet age 18 weeks )2019-07-03v3No1 / 13
702amnoncommon feces, united states of america, canis lupus familiaris, state of north carolina, dog2028-04-02v4No1 / 15
395amnonhigher in kids with ibd compared to healthy donors ( high in child inflammatory bowel disease crohn's disease ulcerative colitis compared to control in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 16
753amnondominant feces, zoological garden, adult, captive, canis lupus, china, wolf2021-03-12v4No1 / 16
301amnondominant united states of america, colon, canis lupus familiaris, dog2018-03-05v4No1 / 19
706amnondominant feces, united states of america, canis lupus familiaris, state of north carolina, dog2028-04-10v4No1 / 19
766amnondominant feces, canis lupus familiaris, french republic, dog, rectal swab, age 2 days, puppy2021-04-12v4No1 / 20
797amnondominant feces, homo sapiens, infant, germany, formula fed, age 7 months2021-06-13v3No1 / 20
648amnondominant feces, canis lupus familiaris, dog, state of louisiana2020-09-06v4No1 / 22
702amnondominant feces, united states of america, canis lupus familiaris, state of north carolina, dog2028-04-02v4No1 / 23
150amnondominant feces, united states of america, canis lupus familiaris, dog2017-04-26v4No1 / 24
641amnoncommon feces, united states of america, research facility, juvenile organism, state of georgia, green turtle, chelonia mydas, juvenile2020-08-23v3No1 / 24
301amnondominant united states of america, rectum, canis lupus familiaris, dog2018-03-05v4No1 / 26
766amnondominant feces, canis lupus familiaris, french republic, dog, age 8 weeks, rectal swab, puppy2021-04-12v4No1 / 26
150amnonhigh in EPI dogs with enzyme supplement compared to no supplement ( high in enzyme supplement compared to no enzyme supplement in feces united states of america canis lupus familiaris dog exocrine pancreatic insufficiency )2017-04-26v4No1 / 27
399amnon high in crohn's disease compared to control in feces homo sapiens united states of america 2018-11-16v4No1 / 27
540amnondominant feces, united states of america, canis lupus familiaris, state of arizona, flagstaff, dog2019-07-31v4No1 / 27
540amnoncommon feces, united states of america, canis lupus familiaris, state of arizona, flagstaff, dog2019-07-31v4No1 / 28
766amnoncommon feces, canis lupus familiaris, french republic, dog, age 8 weeks, rectal swab, puppy2021-04-12v4No1 / 28
822amnondominant feces, research facility, canis lupus familiaris, australia, city of melbourne, dog, foxhound, hydrolized diet2021-08-29v4No1 / 29
573amnoncommon feces, united states of america, juvenile stage, canis lupus familiaris, commonwealth of pennsylvania, dog2019-12-22v4No1 / 30
401amnonhigher in endospore enriched (lysis resistant) replicates ( high in endospore enriched fraction lysis compared to control in feces homo sapiens united states of america adult )2018-11-18v4No1 / 31
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 7 months 2021-06-13v3No1 / 31
666amnoncommon feces, italy, wild, canis lupus, wolf2020-09-25v3No1 / 32
399amnon high in ulcerative colitis compared to control in feces homo sapiens united states of america 2018-11-16v4No1 / 36
706amnoncommon feces, united states of america, canis lupus familiaris, state of north carolina, dog2028-04-10v4No1 / 37
797amnon high in 3-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 39
400amnonhigher in children of hmong migrands born in the usa compared to non-migrant usa people ( high in hmong hmong 2nd generation compared to united states of america in feces homo sapiens )2018-11-18v4No1 / 41
859amnon high in formula fed compared to breast fed in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 6-month-old human stage 2022-01-12v4No1 / 41
666amnoncommon feces, italy, panthera tigris, tiger2020-09-25v3No1 / 43
797amnon high in age 7 months compared to 3-month-old human stage in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 44
241amnonhigher in babies from finland compared to estonia ( high in finland compared to estonia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 45
300amnon high in high capacity running strain compared to low capacity running strain in united states of america female research facility caecum rattus norvegicus rat ovariectomy age 38 weeks 2018-02-27v4No1 / 45
666amnoncommon feces, canis lupus familiaris, italy, dog2020-09-25v3No1 / 46
301amnoncommon united states of america, duodenum, canis lupus familiaris, dog2018-03-05v4No1 / 47
645amnoncommon feces, state of idaho, bird, captive, gymnogyps californianus, california condor2020-09-03v4No1 / 49
406amnoncommon feces, united states of america, zoological garden, equus przewalskii, przewalski horse2018-11-21v4No1 / 50
797amnon high in infant 12-month-old human stage compared to child 2-year-old human stage in feces homo sapiens germany formula fed 2021-06-13v3No1 / 52
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in feces homo sapiens adult nanning city prefecture china sixth decade human stage )2018-01-27v4No1 / 54
766amnoncommon in feces of dog females within 24h after parturition (common feces, canis lupus familiaris, french republic, dog, female organism, adult organism, rectal swab, age 2-7 years)2021-04-12v4No1 / 55
488amnoncommon feces, canis lupus familiaris, italy, dog, lymphoma2019-02-25v4No1 / 56
648amnon high in control compared to antibiotic metronidazole in feces united states of america canis lupus familiaris dog state of louisiana 2020-09-06v4No1 / 56
753amnon high in zoological garden captive canis lupus wolf compared to farm canis lupus familiaris dog dog breeding center in feces adult china 2021-03-12v4No1 / 57
759amnoncommon feces, united states of america, canis lupus familiaris, state of minnesota, dog, domestic2021-04-04v4No1 / 57
759amnoncommon feces, united states of america, state of minnesota, canis lupus, wolf, wildlife sactuary2021-04-04v4No1 / 58
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
72amnoncommon feces, united states of america, canis lupus familiaris, iowa2017-02-25v4No1 / 69
301amnoncommon united states of america, ileum, canis lupus familiaris, dog2018-03-05v4No1 / 69
644amnon high in female compared to male in feces homo sapiens united states of america adult hispanic or latin american 2020-08-31v4No1 / 69
859amnon high in 6-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 2022-01-12v4No1 / 72
810amnoncommon in sea turtle feces from sea turtle rescue center (common feces, research facility, mediterranean sea, italy, adriatic sea coastal waters of italy, caretta caretta, loggerhead sea turtle)2021-06-22v3No1 / 72
759amnon high in raw meat diet compared to dog food diet in feces united states of america canis lupus familiaris state of minnesota dog 2021-04-06v4No1 / 74
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 2-5 year-old child stage compared to age 8-12 age 13-14 6-12 year-old child stage 13-year-old human stage 14-year-old human stage in feces homo sapiens china )2018-12-30v4No1 / 76
122amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united kingdom )2017-04-13v4No1 / 77
759amnon high in canis lupus wolf wildlife sactuary compared to canis lupus familiaris dog in feces united states of america state of minnesota 2021-04-06v4No1 / 78
301amnon high in rectum colon compared to duodenum ileum in united states of america canis lupus familiaris dog 2018-03-05v4No1 / 79
399amnoncommon feces, united states of america, state of tennessee, zoological garden, panthera leo, lion2018-11-16v4No1 / 79
648amnoncommon feces, united states of america, canis lupus familiaris, dog, state of louisiana2020-09-06v4No1 / 83
231amnoncommon in dog rectum (common feces, united states of america, rectum, canis lupus familiaris, dog)2017-11-02v4No1 / 84
150amnonhigh in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in control compared to enzyme supplementation exocrine pancreatic insufficiency in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 85
822amnon high in hydrolized diet compared to high fiber in feces research facility canis lupus familiaris australia city of melbourne dog foxhound 2021-08-29v4No1 / 88
363amnoncommon dairy, rectum, caecum, colon, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 94
488amnoncommon feces, control, canis lupus familiaris, italy, dog2019-02-25v4No1 / 94
753amnoncommon feces, zoological garden, adult, captive, canis lupus, china, wolf2021-03-12v4No1 / 98
363amnon high in rectum caecum colon compared to ruminant reticulum omasum rumen in dairy ovis aries italy obsolete_juvenile stage age 30 days 2018-08-29v4No1 / 101
301amnoncommon united states of america, colon, canis lupus familiaris, dog2018-03-05v4No1 / 105
393amnon high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america city adult state of colorado 2018-11-06v4No1 / 107
399amnoncommon feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 108
565amnoncommon zoological garden, skin, captive, canada, canis lupus arctos, toronto zoo, arctic wolf2019-11-21v3No1 / 114
301amnoncommon united states of america, rectum, canis lupus familiaris, dog2018-03-05v4No1 / 116
568amnon high in viet nam compared to thailand in feces gallus gallus chicken broiler chicken 2019-12-08v3No1 / 119
753amnoncommon feces, farm, adult, canis lupus familiaris, dog, china, dog breeding center2021-03-12v4No1 / 120
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china, ninth decade human stage, tenth decade human stage2018-12-30v4No1 / 121
822amnon high in high protein diet meat diet compared to high fiber in feces research facility canis lupus familiaris australia city of melbourne dog foxhound 2021-08-29v4No1 / 123
69amnoncommon feces, united states of america, research facility, canis lupus familiaris, beagle dog2017-02-21v4No1 / 125
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 126
273amnon high in age age 1 week 1-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 127
644amnonlower in individuals born in mexico compared to cuba ( high in cuba compared to mexico in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to myanmar karen in feces homo sapiens thailand rural community )2018-11-18v4No1 / 135
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united states of america )2017-04-11v4No1 / 139
744amnoncommon research facility, caecum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 141
822amnoncommon feces, research facility, canis lupus familiaris, australia, city of melbourne, dog, foxhound, hydrolized diet2021-08-29v4No1 / 145
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 146
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
822amnoncommon feces, research facility, canis lupus familiaris, australia, city of melbourne, dog, high protein diet, foxhound, meat diet2021-08-29v4No1 / 151
822amnoncommon feces, research facility, canis lupus familiaris, australia, city of melbourne, high fiber, dog, foxhound2021-08-29v4No1 / 153
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
666amnoncommon feces, italy, apodemus sylvaticus, wood mouse2020-09-25v3No1 / 171
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in child obsolete_juvenile stage crohn's disease compared to control adult in feces homo sapiens glasgow )2017-02-26v4No1 / 185
604amnoncommon research facility, caecum, gallus gallus, chicken, cecal content, china2020-04-06v3No1 / 185
744amnon high in caecum compared to cloaca in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 187
197amnon high in india compared to finland in feces homo sapiens juvenile organism obsolete_juvenile stage 13-year-old human stage 2017-09-12v4No1 / 189
860amnoncommon research facility, intestine, anas platyrhynchos, intestinal contents, china, duck2022-01-12v3No1 / 190
150amnoncommon feces, united states of america, canis lupus familiaris, dog2017-04-26v4No1 / 208
669amnon high in 12-month-old human stage compared to 2-month-old human stage in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens stomach adult zhejiang province china )2019-06-26v3No1 / 214
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
584amnoncommon feces, control, research facility, rattus norvegicus, sprague dawley, rat, china, male2020-01-31v3No1 / 221
10amnonpositively correlated with age (6-35) ( high in adult compared to child in feces homo sapiens toronto )2016-10-27v4No1 / 228
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v4No1 / 239
568amnoncommon feces, gallus gallus, chicken, broiler chicken, viet nam2019-12-08v3No1 / 272
744amnon high in caecum compared to ileum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 286
780amnoncommon research facility, caecum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 294
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
61amnoncommon united states of america, research facility, skin, inguinal region, canis lupus familiaris2017-02-05v4No1 / 327
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to research facility captive in feces canada province of ontario algonquin provincial park peromyscus maniculatus deer mice age 3-5 weeks )2019-07-28v3No1 / 358
565amnoncommon zoological garden, skin, papio anubis, captive, olive baboon, canada, toronto zoo2019-11-21v3No1 / 368
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
438amnonhigher in centenarians compared to adults ( high in age >94 ninth decade human stage tenth decade human stage compared to 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 474
650amnon high in caucasian european compared to asian in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 475
603amnoncommon in baijiu fermentation pit mud in first 2 batches (common mud, fermentation pit mud, china, hefei city prefecture, baijiu, days 0-90)2020-04-05v3No1 / 542
273amnon high in age 1-year-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
603amnoncommon in baijiu fermentation pit mud in later batches (common mud, fermentation pit mud, china, hefei city prefecture, baijiu, days 180-270)2020-04-05v3No1 / 608
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage compared to soldiers young adult stage in feces homo sapiens china )2018-12-30v4No1 / 617
816amnonlower in sows in first pregnancy compared to later pregnancies ( high in multiple pregnancies compared to first pregnancy in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism )2021-07-04v4No1 / 780

Problems / suggestions? Please email info AT dbbact DOT org