Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATGGCAAGCCAGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTTGGAACTGTCAGGCTAGAGTGTCGGAGAGGAAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
feces0.494024
homo sapiens0.438776
infant0.283688
canis lupus familiaris0.279274
adult0.269617
dog0.257097
united states of america0.239628
china0.148576
germany0.143541
child0.114754
research facility0.097618
formula fed0.086207
control0.085733
australia0.084971
italy0.080160
female0.075294
rectum0.074303
city0.066844
hospital0.064769
age < 3 years0.062893
crohn's disease0.062472
12-month-old human stage0.061287
clostridium difficile intestinal infectious disease0.056872
mus musculus0.055944
mouse0.051619
colon0.051392
ulcerative colitis0.050410
breast fed0.050157
obsolete_juvenile stage0.050157
kingdom of denmark0.049332
3-month-old human stage0.048338
state of california0.048000
diarrhea0.047761
guangzhou city prefecture0.044492
age 7 months0.044164
state of north carolina0.043682
2-5 year-old child stage0.043682
jiangsu province0.043597
fifth decade human stage0.038585
city of melbourne0.038462
india0.038095
fourth decade human stage0.038095
LOWER IN control0.038055
biopsy0.037855
1-month-old human stage0.037736
rectal swab0.037736
finland0.037037
french republic0.035714
foxhound0.031949
state of colorado0.031822
duodenum0.031120
age0.030864
south korea0.030801
LOWER IN adult0.030675
kingdom of spain0.029732
sweden0.027174
LOWER IN 1-month-old human stage0.025946
sigmoid colon0.025890
state of oklahoma0.025890
terminal ileum0.025723
clostridium difficile infection0.025723
nanning city prefecture0.025723
sixth decade human stage0.025723
indonesia0.025723
municipality of yogyakarta0.025723
puppy0.025723
age 3-60.025723
cat0.025614
caecum0.025608
nanchang city prefecture0.025397
commonwealth of pennsylvania0.025397
felis catus0.025397
small intestine0.025397
state of minnesota0.025237
1-year-old human stage0.025078
age 8 weeks0.025078
ovis aries0.024465
water0.021258
tucson0.019417
dairy0.019417
acute pancreatitis0.019417
pancreatitis0.019417
oslo0.019417
nephrolithiasis0.019417
state of louisiana0.019417
seattle0.019417
colonized germ free0.019417
systemic lupus erythematosus0.019417
state of arizona0.019417
LOWER IN rural community0.019417
heterosexual0.019324
msw0.019324
wastewater treatment plant0.019324
age 30 days0.019231
estonia0.019231
LOWER IN duodenum0.019169
under-1-year-old human stage0.019139
age 1 year0.019048
obesity0.019048
state of michigan0.018957
Fraction of dbbact annotations with this term covered by the query
TermScore
fifth decade human stage0.750000
LOWER IN 1-month-old human stage0.750000
canis lupus familiaris0.692308
dog0.681818
american diet0.666667
clostridium difficile intestinal infectious disease0.666667
sigmoid colon0.666667
state of oklahoma0.666667
age < 3 years0.666667
city of melbourne0.666667
LOWER IN canis lupus0.666667
LOWER IN wolf0.666667
nicotiana tabacum0.666667
rectum0.600000
guangzhou city prefecture0.600000
crohn's disease0.583333
ulcerative colitis0.555556
LOWER IN trichuriasis0.500000
daycare0.500000
1-5-years-old human0.500000
LOWER IN bangladesh diet0.500000
LOWER IN felis catus0.500000
LOWER IN cat0.500000
infant0.500000
breast fed0.500000
tucson0.500000
age 7 months0.500000
terminal ileum0.500000
children0.500000
dairy0.500000
obsolete_juvenile stage0.500000
before antibiotics0.500000
LOWER IN amoxicillin0.500000
LOWER IN doxycycline0.500000
acute severe colitis0.500000
clostridium difficile infection0.500000
valladolid0.500000
acute pancreatitis0.500000
pancreatitis0.500000
lymphoma0.500000
oslo0.500000
india0.500000
cheyenne0.500000
native american0.500000
arapaho0.500000
age one week0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
sixth decade human stage0.500000
salmonella gastroenteritis0.500000
state of louisiana0.500000
LOWER IN cystic fibrosis0.500000
LOWER IN cftr s489x0.500000
seattle0.500000
colonized germ free0.500000
before hsct0.500000
after hcst0.500000
hematopoietic stem cell transplant0.500000
systemic lupus erythematosus0.500000
fourth decade human stage0.500000
indonesia0.500000
municipality of yogyakarta0.500000
inflammatory bowel disease0.500000
puppy0.500000
age 0-6 months0.500000
enzyme supplement0.500000
LOWER IN no enzyme supplement0.500000
exocrine pancreatic insufficiency0.500000
state of arizona0.500000
flagstaff0.500000
LOWER IN age 2-7 years0.500000
age 3-60.500000
LOWER IN mammalian milk beverage0.500000
hangzhou city prefecture0.500000
age 6-14 years0.500000
type 1 diabetes mellitus0.500000
stroke0.500000
age 2-7 years0.500000
domestic0.500000
obese body mass index status0.500000
age 50-70 years0.500000
little physical activity0.500000
LOWER IN physical activity0.500000
LOWER IN cron diet0.500000
schizophrenia0.500000
sesame allergy0.500000
LOWER IN milk allergy0.500000
age 4-10 years0.500000
yaounde0.500000
LOWER IN rural community0.500000
LOWER IN ngoantet0.500000
equine grass sickness0.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
LOWER IN 6-12 year-old child stage0.500000
17-29-years-old human0.500000
common bottlenose dolphin0.500000
usa born0.500000
LOWER IN non usa born0.500000
denver0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.854785
homo sapiens0.666667
united states of america0.297030
adult0.264026
infant0.198020
china0.178218
canis lupus familiaris0.174917
dog0.158416
germany0.099010
research facility0.092409
control0.072607
child0.069307
female0.052805
australia0.052805
formula fed0.049505
italy0.049505
mus musculus0.039604
rectum0.039604
mouse0.036304
hospital0.036304
city0.036304
12-month-old human stage0.033003
crohn's disease0.033003
age < 3 years0.033003
clostridium difficile intestinal infectious disease0.029703
colon0.029703
state of california0.029703
LOWER IN control0.029703
breast fed0.026403
3-month-old human stage0.026403
diarrhea0.026403
kingdom of denmark0.026403
obsolete_juvenile stage0.026403
ulcerative colitis0.026403
jiangsu province0.026403
state of north carolina0.023102
age 7 months0.023102
guangzhou city prefecture0.023102
2-5 year-old child stage0.023102
1-month-old human stage0.019802
biopsy0.019802
india0.019802
finland0.019802
fourth decade human stage0.019802
fifth decade human stage0.019802
french republic0.019802
rectal swab0.019802
city of melbourne0.019802
sweden0.016502
age0.016502
caecum0.016502
kingdom of spain0.016502
LOWER IN adult0.016502
south korea0.016502
duodenum0.016502
state of colorado0.016502
foxhound0.016502
state of minnesota0.013201
sigmoid colon0.013201
terminal ileum0.013201
ovis aries0.013201
clostridium difficile infection0.013201
nanchang city prefecture0.013201
commonwealth of pennsylvania0.013201
state of oklahoma0.013201
1-year-old human stage0.013201
nanning city prefecture0.013201
sixth decade human stage0.013201
felis catus0.013201
cat0.013201
indonesia0.013201
municipality of yogyakarta0.013201
age 8 weeks0.013201
puppy0.013201
LOWER IN 1-month-old human stage0.013201
age 3-60.013201
small intestine0.013201
water0.013201
tucson0.009901
under-1-year-old human stage0.009901
state of michigan0.009901
dairy0.009901
age 30 days0.009901
acute pancreatitis0.009901
pancreatitis0.009901
age 1 year0.009901
kingdom of norway0.009901
oslo0.009901
nephrolithiasis0.009901
state of louisiana0.009901
seattle0.009901
colonized germ free0.009901
systemic lupus erythematosus0.009901
estonia0.009901
state of arizona0.009901
obesity0.009901
c57bl/60.009901
LOWER IN rural community0.009901
farm0.009901
LOWER IN duodenum0.009901
Exp. ID User ID Description Date Region Flag Sequences
482amnonlower in kids with parasitic worms compared to non-infected kids ( high in control compared to trichuriasis in feces homo sapiens child colombia medellin metropolitan area daycare 1-5-years-old human )2019-02-12v4No1 / 3
210amnonhigher in american diet compared to bangladeshi diet in mice with bangladeshi human FMT ( high in diet american diet compared to bangladesh diet in feces research facility mus musculus mouse humanized mouse )2017-10-21v4No1 / 4
702amnon high in canis lupus familiaris dog compared to felis catus cat in feces united states of america state of north carolina 2028-04-02v4No1 / 8
797amnoncommon feces, homo sapiens, infant, germany, breast fed, 1-month-old human stage2021-06-13v3No1 / 9
669amnoncommon feces, homo sapiens, infant, sweden, 2-month-old human stage2020-09-26v4No1 / 12
689amnoncommon feces, homo sapiens, united states of america, hospital, adult, non c. diff diarrhea, tucson2028-03-11v4No1 / 12
797amnoncommon feces, homo sapiens, infant, germany, breast fed, age 7 months2021-06-13v3No1 / 12
241amnonhigher in babies age <1 year compared to age 1-3 years ( high in age under-1-year-old human stage compared to age 1-3 years 2-year-old human stage 1-year-old human stage in feces homo sapiens infant )2017-11-13v4No1 / 13
669amnondominant feces, homo sapiens, infant, sweden, 2-month-old human stage2020-09-26v4No1 / 13
185amnoncommon in patients with c. diff infection before treatment (common feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 14
797amnondominant feces, homo sapiens, infant, germany, breast fed, age 7 months2021-06-13v3No1 / 14
702amnoncommon feces, united states of america, canis lupus familiaris, state of north carolina, dog2028-04-02v4No1 / 15
797amnoncommon feces, homo sapiens, infant, germany, breast fed, 3-month-old human stage2021-06-13v3No1 / 15
797amnondominant feces, homo sapiens, infant, germany, breast fed, 3-month-old human stage2021-06-13v3No1 / 15
797amnoncommon feces, homo sapiens, infant, germany, formula fed, 1-month-old human stage2021-06-13v3No1 / 15
19amnonhigh freq in biopsies of children (IBD study) (dominant homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children)2016-11-14v4No1 / 16
94amnoncommon feces, homo sapiens, state of michigan, clostridium difficile intestinal infectious disease, diarrhea2017-03-12v4No1 / 16
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, 1-month-old human stage2018-01-14v4No1 / 16
363amnondominant dairy, rectum, caecum, colon, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 16
659amnon high in before antibiotics compared to antibiotic vancomycin metronidazole amoxicillin doxycycline in feces homo sapiens ulcerative colitis child acute severe colitis 2020-09-19v4No1 / 16
683amnondominant during antibiotics treatment in feces (dominant feces, homo sapiens, united states of america, antibiotic, vancomycin, adult, state of california, metronidazole, neomycin)2028-03-04v4No1 / 16
728amnoncommon feces, homo sapiens, hospital, adult, kingdom of spain, clostridium difficile intestinal infectious disease, clostridium difficile infection, valladolid2021-01-05v3No1 / 16
428amnondominant feces, homo sapiens, adult, nanchang city prefecture, acute pancreatitis, pancreatitis, china2018-12-09v4No1 / 17
797amnoncommon feces, homo sapiens, infant, germany, formula fed, 3-month-old human stage2021-06-13v3No1 / 17
273amnondominant feces, homo sapiens, infant, kingdom of denmark, 1-month-old human stage2018-01-14v4No1 / 18
284amnondominant feces, homo sapiens, female, infant, state of california, 6-month-old human stage2018-01-27v4No1 / 18
488amnondominant feces, canis lupus familiaris, italy, dog, lymphoma2019-02-25v4No1 / 18
797amnondominant feces, homo sapiens, infant, germany, breast fed, 12-month-old human stage2021-06-13v3No1 / 18
301amnondominant united states of america, colon, canis lupus familiaris, dog2018-03-05v4No1 / 19
330amnon high in infant age 1 year compared to adult fourth decade human stage in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 19
339amnoncommon feces, homo sapiens, infant, india, under-1-year-old human stage2018-05-24v4No1 / 19
516amnondominant feces, homo sapiens, united states of america, adult, state of ohio2019-05-29v4No1 / 19
573amnondominant feces, united states of america, juvenile stage, canis lupus familiaris, commonwealth of pennsylvania, dog2019-12-22v4No1 / 19
689amnoncommon feces, homo sapiens, united states of america, hospital, clostridium difficile colitis, adult, clostridium difficile infection, tucson2028-03-11v4No1 / 19
706amnondominant feces, united states of america, canis lupus familiaris, state of north carolina, dog2028-04-10v4No1 / 19
797amnondominant feces, homo sapiens, infant, germany, formula fed, 1-month-old human stage2021-06-13v3No1 / 19
242amnonhigh freq. in native-americans (dominant feces, homo sapiens, united states of america, state of oklahoma, cheyenne, native american, arapaho)2017-11-14v4No1 / 20
273amnondominant feces, homo sapiens, infant, kingdom of denmark, age one week, 1-month-old human stage2018-01-14v4No1 / 20
273amnondominant feces, homo sapiens, infant, kingdom of denmark, 1-year-old human stage2018-01-14v4No1 / 20
284amnoncommon feces, homo sapiens, female, infant, state of california, age 2 months2018-01-27v4No1 / 20
284amnondominant feces, homo sapiens, female, infant, state of california, age 2 months2018-01-27v4No1 / 20
286amnonhigh freq. in feces of individuals with kidney stones (dominant feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v4No1 / 20
292amnondominant feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 20
292amnondominant feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 20
390amnondominant feces, homo sapiens, hospital, salmonella gastroenteritis, australia, diarrhea2018-11-04v4No1 / 20
399amnondominant feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 20
666amnondominant feces, canis lupus familiaris, italy, dog2020-09-25v3No1 / 20
797amnoncommon feces, homo sapiens, infant, germany, breast fed, 12-month-old human stage2021-06-13v3No1 / 20
797amnondominant feces, homo sapiens, infant, germany, formula fed, age 7 months2021-06-13v3No1 / 20
797amnondominant feces, homo sapiens, infant, germany, formula fed, 3-month-old human stage2021-06-13v3No1 / 20
72amnondominant feces, united states of america, canis lupus familiaris, iowa2017-02-25v4No1 / 21
240amnonhigh freq. in infants age <3 years (dominant feces, homo sapiens, infant, finland, age < 3 years)2017-11-12v4No1 / 21
241amnonhigh freq. in babies age < 3 years in finland (dominant feces, homo sapiens, infant, finland, age < 3 years)2017-11-13v4No1 / 21
320amnondominant feces, homo sapiens, adult, crohn's disease2018-04-19v4No1 / 21
390amnondominant feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 21
728amnondominant feces, homo sapiens, hospital, adult, kingdom of spain, clostridium difficile intestinal infectious disease, clostridium difficile infection, valladolid2021-01-05v3No1 / 21
94amnondominant feces, homo sapiens, state of michigan, clostridium difficile intestinal infectious disease, diarrhea2017-03-12v4No1 / 22
185amnonhigh freq. in patients with c. diff infection before treatment (dominant feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 22
648amnondominant feces, canis lupus familiaris, dog, state of louisiana2020-09-06v4No1 / 22
689amnondominant feces, homo sapiens, united states of america, hospital, clostridium difficile colitis, adult, clostridium difficile infection, tucson2028-03-11v4No1 / 22
779amnoncommon feces, homo sapiens, adult, guangzhou city prefecture, crohn's disease, china2021-04-28v4No1 / 22
619amnon high in control compared to cystic fibrosis cftr s489x in feces united states of america research facility mus musculus mouse seattle colonized germ free 2020-05-04v3No1 / 22
619amnondominant feces, control, united states of america, research facility, mus musculus, mouse, seattle, colonized germ free2020-05-04v3No1 / 22
655amnondominant in patients before hematopoietic stem cell transplant (dominant feces, homo sapiens, italy, before hsct)2020-09-13v3No1 / 22
655amnondominant in patients after hematopoietic stem cell transplant (dominant feces, homo sapiens, italy, after hcst, hematopoietic stem cell transplant)2020-09-13v3No1 / 22
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 22
241amnonhigh freq. in babies age < 3 years in russia (dominant feces, homo sapiens, infant, russia, age < 3 years)2017-11-13v4No1 / 23
241amnoncommon in babies age < 3 years in finland (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-13v4No1 / 23
241amnonhigh freq. in babies age < 3 years in estonia (dominant feces, homo sapiens, infant, estonia, age < 3 years)2017-11-13v4No1 / 23
284amnondominant feces, homo sapiens, female, infant, state of california, 12-month-old human stage2018-01-27v4No1 / 23
601amnondominant feces, homo sapiens, adult, type 2 diabetes mellitus, china2020-03-30v4No1 / 23
669amnondominant feces, homo sapiens, infant, sweden, 12-month-old human stage2020-09-26v4No1 / 23
702amnondominant feces, united states of america, canis lupus familiaris, state of north carolina, dog2028-04-02v4No1 / 23
797amnoncommon feces, homo sapiens, infant, germany, formula fed, 12-month-old human stage2021-06-13v3No1 / 23
797amnoncommon feces, homo sapiens, infant, germany, formula fed, age 7 months2021-06-13v3No1 / 23
150amnondominant feces, united states of america, canis lupus familiaris, dog2017-04-26v4No1 / 24
241amnoncommon in babies age < 3 years in estonia (common feces, homo sapiens, infant, estonia, age < 3 years)2017-11-13v4No1 / 24
330amnondominant feces, homo sapiens, infant, kingdom of norway, oslo, age 1 year2018-05-13v4No1 / 24
390amnonhigher in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in clostridium difficile intestinal infectious disease compared to non c. diff diarrhea in feces homo sapiens hospital australia diarrhea )2018-11-04v4No1 / 24
643amnondominant feces, homo sapiens, adult, south korea2020-08-30v4No1 / 24
702amnondominant feces, united states of america, felis catus, state of north carolina, cat2028-04-02v4No1 / 24
723amnondominant feces, homo sapiens, child, indonesia, municipality of yogyakarta, 2-5 year-old child stage2021-01-02v3No1 / 24
284amnoncommon feces, homo sapiens, female, infant, state of california, 6-month-old human stage2018-01-27v4No1 / 25
395amnoncommon feces, homo sapiens, united states of america, child, commonwealth of pennsylvania, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 25
428amnoncommon feces, homo sapiens, adult, nanchang city prefecture, acute pancreatitis, pancreatitis, china2018-12-09v4No1 / 25
779amnoncommon feces, homo sapiens, ulcerative colitis, adult, guangzhou city prefecture, china2021-04-28v4No1 / 25
714amnondominant homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 25
797amnondominant feces, homo sapiens, infant, germany, formula fed, 12-month-old human stage2021-06-13v3No1 / 25
301amnondominant united states of america, rectum, canis lupus familiaris, dog2018-03-05v4No1 / 26
438amnondominant feces, homo sapiens, adult, jiangsu province, china, fourth decade human stage, fifth decade human stage2018-12-30v4No1 / 26
766amnondominant feces, canis lupus familiaris, french republic, dog, age 8 weeks, rectal swab, puppy2021-04-12v4No1 / 26
723amnondominant feces, homo sapiens, infant, child, indonesia, municipality of yogyakarta, age 0-6 months2021-01-02v3No1 / 26
150amnonhigh in EPI dogs with enzyme supplement compared to no supplement ( high in enzyme supplement compared to no enzyme supplement in feces united states of america canis lupus familiaris dog exocrine pancreatic insufficiency )2017-04-26v4No1 / 27
399amnon high in crohn's disease compared to control in feces homo sapiens united states of america 2018-11-16v4No1 / 27
488amnondominant feces, control, canis lupus familiaris, italy, dog2019-02-25v4No1 / 27
540amnondominant feces, united states of america, canis lupus familiaris, state of arizona, flagstaff, dog2019-07-31v4No1 / 27
659amnoncommon feces, homo sapiens, ulcerative colitis, child, acute severe colitis2020-09-19v4No1 / 27
766amnon high in age 8 weeks puppy compared to female organism adult organism age 2-7 years in feces canis lupus familiaris french republic dog rectal swab 2021-04-12v4No1 / 27
797amnon high in 3-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 27
540amnoncommon feces, united states of america, canis lupus familiaris, state of arizona, flagstaff, dog2019-07-31v4No1 / 28
766amnoncommon feces, canis lupus familiaris, french republic, dog, age 8 weeks, rectal swab, puppy2021-04-12v4No1 / 28
231amnonhigh freq. in dog rectum (dominant feces, united states of america, rectum, canis lupus familiaris, dog)2017-11-02v4No1 / 29
284amnoncommon feces, homo sapiens, female, infant, state of california, 12-month-old human stage2018-01-27v4No1 / 30
320amnoncommon feces, homo sapiens, adult, crohn's disease2018-04-19v4No1 / 30
438amnondominant feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v4No1 / 30
573amnoncommon feces, united states of america, juvenile stage, canis lupus familiaris, commonwealth of pennsylvania, dog2019-12-22v4No1 / 30
723amnoncommon feces, homo sapiens, child, indonesia, municipality of yogyakarta, 2-5 year-old child stage2021-01-02v3No1 / 30
45amnoncommon in feces babies age 0-2 in india (common feces, homo sapiens, infant, india)2016-12-19v4No1 / 31
390amnoncommon feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 31
655amnoncommon in patients before hematopoietic stem cell transplant (common feces, homo sapiens, italy, before hsct)2020-09-13v3No1 / 31
681amnondominant feces, homo sapiens, adult, seoul, south korea2028-03-04v3No1 / 31
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 7 months 2021-06-13v3No1 / 31
292amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens adult china 2018-02-05v4No1 / 32
131amnon high in male compared to female in feces homo sapiens south korea 2017-04-16v4No1 / 34
24amnondisappears on transition to cow milk ( high in breast milk compared to mammalian milk beverage in feces homo sapiens infant )2016-12-01v4No1 / 35
669amnoncommon feces, homo sapiens, infant, sweden, 12-month-old human stage2020-09-26v4No1 / 35
240amnoncommon in infants age <3 years (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-12v4No1 / 36
706amnoncommon feces, united states of america, canis lupus familiaris, state of north carolina, dog2028-04-10v4No1 / 37
390amnoncommon feces, homo sapiens, hospital, australia, diarrhea2018-11-04v4No1 / 38
131amnonnegatively correlated with age (30-80 years) ( high in age fourth decade human stage fifth decade human stage compared to human late adulthood stage in feces homo sapiens south korea )2017-04-16v4No1 / 39
330amnoncommon feces, homo sapiens, infant, kingdom of norway, oslo, age 1 year2018-05-13v4No1 / 39
797amnon high in 3-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 39
19amnoncommon in biopsies of children (IBD study) (common homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children)2016-11-14v4No1 / 40
714amnoncommon homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 40
825amnoncommon feces, homo sapiens, control, child, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 40
825amnoncommon feces, homo sapiens, type i diabetes mellitus, child, type 1 diabetes mellitus, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 41
36amnoncommon feces, homo sapiens, sichuan province2016-12-06v4No1 / 44
241amnoncommon in babies age < 3 years in russia (common feces, homo sapiens, infant, russia, age < 3 years)2017-11-13v4No1 / 44
797amnon high in age 7 months compared to 3-month-old human stage in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 44
797amnon high in age 7 months compared to 12-month-old human stage in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 44
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, 1-year-old human stage2018-01-14v4No1 / 46
428amnon high in acute pancreatitis pancreatitis compared to control in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 46
666amnoncommon feces, canis lupus familiaris, italy, dog2020-09-25v3No1 / 46
797amnoncommon feces, homo sapiens, child, germany, formula fed, 2-year-old human stage2021-06-13v3No1 / 46
301amnoncommon united states of america, duodenum, canis lupus familiaris, dog2018-03-05v4No1 / 47
779amnoncommon feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v4No1 / 47
597amnoncommon feces, homo sapiens, adult, zhejiang province, gout, china2020-03-23v3No1 / 47
651amnoncommon feces, homo sapiens, united states of america, adult, state of alabama, parkinson's disease2020-09-13v4No1 / 49
339amnon high in infant under-1-year-old human stage compared to adult in feces homo sapiens india 2018-05-24v4No1 / 50
702amnoncommon feces, united states of america, felis catus, state of north carolina, cat2028-04-02v4No1 / 51
797amnon high in infant 12-month-old human stage compared to child 2-year-old human stage in feces homo sapiens germany formula fed 2021-06-13v3No1 / 52
292amnoncommon feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in feces homo sapiens adult nanning city prefecture china sixth decade human stage )2018-01-27v4No1 / 54
292amnoncommon feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 55
390amnoncommon feces, homo sapiens, hospital, salmonella gastroenteritis, australia, diarrhea2018-11-04v4No1 / 55
766amnoncommon in feces of dog females within 24h after parturition (common feces, canis lupus familiaris, french republic, dog, female organism, adult organism, rectal swab, age 2-7 years)2021-04-12v4No1 / 55
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 55
368amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of virginia, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 56
488amnoncommon feces, canis lupus familiaris, italy, dog, lymphoma2019-02-25v4No1 / 56
648amnon high in control compared to antibiotic metronidazole in feces united states of america canis lupus familiaris dog state of louisiana 2020-09-06v4No1 / 56
650amnoncommon feces, homo sapiens, united states of america, adult, caucasian, state of new york, european2020-09-09v4No1 / 56
650amnon high in female compared to male in feces homo sapiens united states of america adult state of new york 2020-09-10v4No1 / 57
759amnoncommon feces, united states of america, canis lupus familiaris, state of minnesota, dog, domestic2021-04-04v4No1 / 57
651amnoncommon feces, homo sapiens, control, united states of america, adult, state of alabama2020-09-13v4No1 / 58
814amnonhigher after 2 months of caloric restriction diet ( high in caloric restriction diet compared to control diet in feces homo sapiens female obesity adult obese body mass index status germany high bmi overweight body mass index status age 50-70 years )2021-06-30v4No1 / 58
63amnonhigher in individuals with low physical activity ( high in little physical activity compared to physical activity in feces homo sapiens united states of america )2017-12-04v4No1 / 59
844amnoncommon feces, research facility, mus musculus, c57bl/6, australia, mouse, iron deficient diet2021-11-17v3No1 / 60
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in diet american diet compared to cron diet caloric restriction diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 61
333amnoncommon in healthy controls feces (common feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 61
619amnoncommon feces, control, united states of america, research facility, mus musculus, mouse, seattle, colonized germ free2020-05-04v3No1 / 61
502amnoncommon feces, homo sapiens, united states of america, adult, schizophrenia2019-03-12v4No1 / 63
695amnon high in sesame allergy compared to milk allergy in feces homo sapiens child israel food allergy age 4-10 years 2028-03-27v4No1 / 64
242amnoncommon in native-americans (common feces, homo sapiens, united states of america, state of oklahoma, cheyenne, native american, arapaho)2017-11-14v4No1 / 65
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
72amnoncommon feces, united states of america, canis lupus familiaris, iowa2017-02-25v4No1 / 69
301amnoncommon united states of america, ileum, canis lupus familiaris, dog2018-03-05v4No1 / 69
644amnon high in female compared to male in feces homo sapiens united states of america adult hispanic or latin american 2020-08-31v4No1 / 69
594amnon high in city yaounde compared to rural community ngoantet in feces homo sapiens adult cameroon 2020-03-12v4No1 / 70
448amnon high in equine grass sickness disease compared to control in feces farm equus caballus horse united kingdom 2019-01-08v4No1 / 72
844amnon high in iron supplemented diet compared to iron deficient diet in feces research facility mus musculus c57bl/6 australia mouse 2021-11-17v3No1 / 72
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany 3-month-old human stage 2021-06-13v3No1 / 75
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 2-5 year-old child stage compared to age 8-12 age 13-14 6-12 year-old child stage 13-year-old human stage 14-year-old human stage in feces homo sapiens china )2018-12-30v4No1 / 76
484amnoncommon feces, homo sapiens, united states of america, adult, state of michigan, 17-29-years-old human2019-02-13v4No1 / 76
666amnoncommon feces, tursiops truncatus, italy, rectal swab, common bottlenose dolphin2020-09-25v3No1 / 76
69amnoncommon united states of america, research facility, mucus, nasal cavity, canis lupus familiaris, beagle dog2017-02-21v4No1 / 77
122amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united kingdom )2017-04-13v4No1 / 77
516amnoncommon feces, homo sapiens, united states of america, adult, state of ohio2019-05-29v4No1 / 77
644amnonlower in individuals born in latin america compared to indivuals born in usa ( high in usa born compared to non usa born in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 77
301amnon high in rectum colon compared to duodenum ileum in united states of america canis lupus familiaris dog 2018-03-05v4No1 / 79
401amnoncommon feces, homo sapiens, united states of america, adult2018-11-18v4No1 / 79
292amnoncommon feces, homo sapiens, control, adult, china2018-02-05v4No1 / 81
643amnoncommon feces, homo sapiens, adult, south korea2020-08-30v4No1 / 81
344amnoncommon in feces of heterosexuals (common feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
648amnoncommon feces, united states of america, canis lupus familiaris, dog, state of louisiana2020-09-06v4No1 / 83
231amnoncommon in dog rectum (common feces, united states of america, rectum, canis lupus familiaris, dog)2017-11-02v4No1 / 84
150amnonhigh in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in control compared to enzyme supplementation exocrine pancreatic insufficiency in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 85
601amnoncommon feces, homo sapiens, adult, type 2 diabetes mellitus, china2020-03-30v4No1 / 85
844amnoncommon feces, research facility, mus musculus, c57bl/6, australia, mouse, iron supplemented diet2021-11-17v3No1 / 85
340amnoncommon feces, felis catus, australia, city of melbourne, cat2018-05-27v4No1 / 87
430amnoncommon feces, homo sapiens, united states of america, city, adult, state of arizona, 20-year-old human stage2018-12-15v4No1 / 87
830amnon high in iga positive fraction compared to iga negative fraction iga igg negative fraction in feces homo sapiens peru age 9-17 years teenager 2021-09-10v4No1 / 88
666amnoncommon feces, italy, felis silvestris, wild cat2020-09-25v3No1 / 91
303amnoncommon feces, homo sapiens, adult, germany2018-03-12v4No1 / 93
428amnoncommon feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v4No1 / 93
601amnoncommon feces, homo sapiens, control, adult, china2020-03-30v4No1 / 93
363amnoncommon dairy, rectum, caecum, colon, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 94
488amnoncommon feces, control, canis lupus familiaris, italy, dog2019-02-25v4No1 / 94
400amnoncommon in feces of european american females (common feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 95
723amnonhigher in children age 2-4 years compared to mothers ( high in child 2-5 year-old child stage compared to adult in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 95
409amnoncommon homo sapiens, united states of america, right colon, biopsy site, adult, biopsy2018-11-22v4No1 / 97
363amnon high in rectum caecum colon compared to ruminant reticulum omasum rumen in dairy ovis aries italy obsolete_juvenile stage age 30 days 2018-08-29v4No1 / 101
438amnoncommon feces, homo sapiens, china, young adult stage2018-12-30v4No1 / 101
284amnoncommon feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 105
301amnoncommon united states of america, colon, canis lupus familiaris, dog2018-03-05v4No1 / 105
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america state of colorado denver )2018-05-31v4No1 / 106
438amnoncommon feces, homo sapiens, child, jiangsu province, age 8-12, china, 6-12 year-old child stage2018-12-30v4No1 / 106
215amnoncommon feces, homo sapiens, united states of america2017-10-23v4No1 / 107
393amnon high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america city adult state of colorado 2018-11-06v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common feces, homo sapiens, control, adult, belgium)2018-11-15v4No1 / 107
399amnoncommon feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 108
436amnoncommon feces, united states of america, felis catus, state of colorado, cat2018-12-25v4No1 / 108
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
822amnon high in hydrolized diet compared to high protein diet meat diet in feces research facility canis lupus familiaris australia city of melbourne dog foxhound 2021-08-29v4No1 / 110
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, 65-79 year-old human stage2018-12-30v4No1 / 111
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, fourth decade human stage, fifth decade human stage2018-12-30v4No1 / 115
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age 3-month-old human stage compared to age 1 week 1-month-old human stage in homo sapiens hypopharynx infant kingdom of denmark )2017-01-19v4No1 / 116
195amnoncommon in boston subway surfaces (common city, urban biome, boston, train)2017-09-07v4No1 / 116
301amnoncommon united states of america, rectum, canis lupus familiaris, dog2018-03-05v4No1 / 116
239amnoncommon feces, homo sapiens, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v4No1 / 118
822amnon high in high fiber compared to high protein diet meat diet in feces research facility canis lupus familiaris australia city of melbourne dog foxhound 2021-08-29v4No1 / 118
212amnoncommon feces, control, united states of america, research facility, mus musculus, lean body mass, mouse2017-10-22v4No1 / 120
753amnoncommon feces, farm, adult, canis lupus familiaris, dog, china, dog breeding center2021-03-12v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, small intestine, duodenum, new delhi, india)2018-07-30v4No1 / 121
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china, ninth decade human stage, tenth decade human stage2018-12-30v4No1 / 121
69amnoncommon feces, united states of america, research facility, canis lupus familiaris, beagle dog2017-02-21v4No1 / 125
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 126
522amnoncommon feces, female, research facility, mus musculus, c57bl/6j, germany, mouse, janvier labs, high sugar diet, age 18 weeks2019-07-03v3No1 / 126
753amnon high in farm canis lupus familiaris dog dog breeding center compared to zoological garden captive canis lupus wolf in feces adult china 2021-03-12v4No1 / 127
522amnoncommon feces, female, research facility, mus musculus, c57bl/6j, germany, mouse, mouse chow, age 6 weeks, janvier labs2019-07-03v3No1 / 130
526amnon high in cholelithiasis compared to control in homo sapiens bile gallbladder adult kingdom of spain 2019-07-14v3No1 / 131
39amnoncommon in obese lepr-db mice (common feces, research facility, mus musculus, obesity)2016-12-09v4No1 / 132
766amnon high in age 8 weeks compared to age 2 days in feces canis lupus familiaris french republic dog rectal swab puppy 2021-04-12v4No1 / 133
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china, 13-year-old human stage, 14-year-old human stage2018-12-30v4No1 / 134
607amnoncommon feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to myanmar karen in feces homo sapiens thailand rural community )2018-11-18v4No1 / 135
212amnoncommon feces, united states of america, research facility, mus musculus, obese body mass index status, mouse, db/db mouse, obesity2017-10-22v4No1 / 137
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
822amnoncommon feces, research facility, canis lupus familiaris, australia, city of melbourne, dog, foxhound, hydrolized diet2021-08-29v4No1 / 145
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in wastewater treatment plant sewer compared to feces in city south america low income )2017-01-21v4No1 / 148
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 148
759amnon high in canis lupus familiaris dog compared to canis lupus wolf wildlife sactuary in feces united states of america state of minnesota 2021-04-06v4No1 / 148
822amnoncommon feces, research facility, canis lupus familiaris, australia, city of melbourne, dog, high protein diet, foxhound, meat diet2021-08-29v4No1 / 151
822amnoncommon feces, research facility, canis lupus familiaris, australia, city of melbourne, high fiber, dog, foxhound2021-08-29v4No1 / 153
780amnon high in small intestine duodenum jejunum compared to caecum in research facility gallus gallus chicken china jinzhou city prefecture 2021-04-28v3No1 / 153
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, bile, gallbladder, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v4No1 / 162
537amnoncommon in feces of wild caught deer mice feces (common feces, canada, province of ontario, algonquin provincial park, wild, peromyscus maniculatus, deer mice, age 3-5 weeks)2019-07-28v3No1 / 163
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 169
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, india, 13-year-old human stage2017-09-12v4No1 / 170
666amnoncommon feces, italy, apodemus sylvaticus, wood mouse2020-09-25v3No1 / 171
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in child obsolete_juvenile stage crohn's disease compared to control adult in feces homo sapiens glasgow )2017-02-26v4No1 / 185
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
150amnoncommon feces, united states of america, canis lupus familiaris, dog2017-04-26v4No1 / 208
669amnon high in 12-month-old human stage compared to 2-month-old human stage in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
584amnoncommon feces, control, research facility, rattus norvegicus, sprague dawley, rat, china, male2020-01-31v3No1 / 221
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
331amnon high in dry season compared to wet season in feces ethiopia monkey theropithecus gelada 2018-05-13v4No1 / 232
780amnoncommon research facility, small intestine, duodenum, jejunum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 232
53amnon high in lima shantytown compared to el salado small village in feces homo sapiens city 2017-01-21v4No1 / 236
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v4No1 / 239
483amnoncommon united states of america, research facility, hawaii, pearl harbor, hydroides elegans, tubeworm, shelled egg2019-02-13v4No1 / 243
161amnoncommon in barn swallows in colorado (common feces, united states of america, state of colorado, hirundo rustica, barn swallow)2017-07-12v4No1 / 245
351amnoncommon united states of america, research facility, coelomic fluid, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 249
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 263
438amnon high in child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage compared to adult 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china 2018-12-30v4No1 / 279
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v4No1 / 281
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
61amnoncommon united states of america, research facility, skin, inguinal region, canis lupus familiaris2017-02-05v4No1 / 327
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
351amnoncommon in artificial sea water where sea urchins were grown (common united states of america, research facility, sea water, state of florida, lytechinus variegatus, sea urchin, artificial seawater)2018-07-30v4No1 / 338
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
254amnonhigher in river when close to populated region compared to downstream ( high in populated place city upstream compared to downstream in river water fresh water fujian province depth (soil) 50cm jiulong river china )2017-11-23v4No1 / 356
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to research facility captive in feces canada province of ontario algonquin provincial park peromyscus maniculatus deer mice age 3-5 weeks )2019-07-28v3No1 / 358
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
582amnon high in rectum perianal skin compared to external acoustic meatus ear canal in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 400
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
823sheryoCommon at 70-100cm depth in ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, upland soil, auburn, alabama, depth 70-100cm)2021-08-07v3No1 / 459
160amnoncommon in wastewater treatment plant effluent in autumn in china (common wastewater treatment plant, effluent, autumn, china)2017-07-12v4No1 / 469
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age 1-year-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant finland )2017-11-12v4No1 / 567
254amnon high in summer wet season compared to winter autumn dry season in river water fresh water fujian province depth (soil) 50cm jiulong river china 2017-11-23v4No1 / 581
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in estuary water kingdom of spain estuary water bilbao 2019-03-20v4No1 / 592
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage compared to soldiers young adult stage in feces homo sapiens china )2018-12-30v4No1 / 617
758amnon high in swisher sweets original cigar swisher sweets sweet cherry cigar compared to cheyenne full flavor cigar cheyenne menthol box cigar in nicotiana tabacum cigar tobacco 2021-03-28v3No1 / 710
816amnonlower in sows in first pregnancy compared to later pregnancies ( high in multiple pregnancies compared to first pregnancy in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism )2021-07-04v4No1 / 780
823sheryoCommon at 90-100cm depth in foot slope ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, auburn, alabama, foot slope , depth 90-100cm)2021-08-08v3No1 / 782
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v4No1 / 836
649amnon high in colon compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 1261
40amnoncommon soil, field soil, rhizosphere, nicotiana tabacum, china2016-12-09v4No1 / 1420

Problems / suggestions? Please email info AT dbbact DOT org