Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCCGTGCAAGTCTGATGTGAAAGGCTGGGGCTCAACCCCGGGACTGCATTGGAAACTGTATGGCTGGAGTGCCGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
feces0.263516
zoological garden0.232082
monkey0.223881
homo sapiens0.213948
pig0.212121
sus scrofa0.212121
macaca mulatta0.187500
rural community0.179837
adult0.160212
child0.113636
small village0.107143
rhesus macaque0.103448
united states of america0.092980
hunter gatherer0.090361
gorilla gorilla0.089686
indian rhesus macaque0.087719
cayo santiago0.087719
captive0.085627
puerto rico0.080645
united kingdom0.074627
nigeria0.073171
age 10-15 years0.071429
pan troglodytes0.071429
chimpanzee0.071429
ethiopia0.071429
state of tennessee0.064516
control0.062696
male0.058594
caecum0.058252
city0.056338
canada0.054795
hadza0.054545
peru0.054545
ascending colon0.054545
province of alberta0.054545
zambia0.054545
age 8 months0.054545
como zoo0.054545
chuquisaca department0.054545
china0.053492
LOWER IN infant0.053097
age 5-13 years0.053097
farm0.053097
LOWER IN united states of america0.052632
LOWER IN crohn's disease0.052174
tanzania0.051724
LOWER IN child0.051724
adult organism0.051724
bolivia0.051724
LOWER IN ileum0.051282
obsolete_juvenile stage0.050420
age 6 weeks0.050420
rectal swab0.050420
female organism0.049180
LOWER IN wild0.048583
state of minnesota0.048000
male organism0.046875
research facility0.044243
wild0.042857
amerindian0.037383
venezuela0.037383
nanchang city prefecture0.037383
cron diet0.037037
kebbi state0.037037
el salvador0.037037
jinhua city prefecture0.037037
jinhua pig0.037037
LOWER IN state of california0.037037
tunapuco0.037037
lincoln park zoo0.037037
saint louis zoo0.037037
saint louis0.037037
chlorocebus aethiops0.037037
age 60-790.037037
LOWER IN nouabale-ndoki national park0.037037
LOWER IN republic of congo0.037037
hispanic or latin american0.036364
papio anubis0.036364
LOWER IN age < 1 year0.036364
wet season0.036364
LOWER IN dry season0.036364
chicago0.036364
age 30-500.036364
LOWER IN city0.036036
body mass index0.036036
LOWER IN ulcerative colitis0.035714
age > 1 year0.035714
amsterdam0.035714
kingdom of norway0.035714
africa0.035714
left colon0.035714
low bmi0.035398
caloric restriction diet0.035088
LOWER IN high bmi0.035088
LOWER IN duodenum0.035088
right colon0.035088
thailand0.034483
kingdom of the netherlands0.034483
homosexual0.034483
msm0.034483
Fraction of dbbact annotations with this term covered by the query
TermScore
small village0.750000
hunter gatherer0.750000
nigeria0.750000
amerindian0.666667
venezuela0.666667
gorilla gorilla0.666667
nanchang city prefecture0.666667
rural community0.600000
hadza0.500000
camp hukamako0.500000
LOWER IN camp sengeli0.500000
ibadan0.500000
LOWER IN iga igg negative fraction0.500000
age 9-17 years0.500000
teenager0.500000
peru0.500000
LOWER IN city of boston0.500000
LOWER IN commonwealth of massachusetts0.500000
ascending colon0.500000
salmonellosis0.500000
salmonella enterica subsp. enterica serovar typhimurium0.500000
province of alberta0.500000
pig0.500000
sus scrofa0.500000
LOWER IN usa born0.500000
non usa born0.500000
glasgow0.500000
myanmar0.500000
karen0.500000
cron diet0.500000
LOWER IN cuba0.500000
LOWER IN penis0.500000
indian rhesus macaque0.500000
macaca mulatta0.500000
cayo santiago0.500000
physical activity0.500000
LOWER IN little physical activity0.500000
oslo0.500000
age 30-400.500000
kebbi state0.500000
age 10-15 years0.500000
urinary schistosomiasis0.500000
schistosomiasis0.500000
yaounde0.500000
el salvador0.500000
LOWER IN age 1-3 weeks0.500000
jinhua city prefecture0.500000
jinhua pig0.500000
farm 10.500000
LOWER IN farm 20.500000
nouabale-ndoki national park0.500000
republic of congo0.500000
zambia0.500000
monkey0.500000
papio kindae0.500000
kinda baboon0.500000
papio ursinus0.500000
grayfoot chacma baboon0.500000
LOWER IN state of california0.500000
age 8 months0.500000
rhesus macaque0.500000
gorilla0.500000
black-handed spider monkey0.500000
ateles geoffroyi0.500000
como zoo0.500000
bangladesh0.500000
tunapuco0.500000
age 140 days0.500000
duroc pig0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
LOWER IN lima0.500000
LOWER IN shantytown0.500000
lincoln park zoo0.500000
pan troglodytes0.500000
chimpanzee0.500000
macropus rufus0.500000
red kangaroo0.500000
african lion safari0.500000
baboon0.500000
papio0.500000
LOWER IN papio kindae0.500000
LOWER IN papio ursinus0.500000
LOWER IN multiple pregnancies0.500000
first pregnancy0.500000
saint louis zoo0.500000
saint louis0.500000
sewage0.500000
LOWER IN effluent0.500000
ethiopia0.500000
chlorocebus aethiops0.500000
grivet monkey0.500000
vervet monkey0.500000
LOWER IN state of oklahoma0.500000
age 60-790.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
chlorocebus djamdjamensis0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.875000
homo sapiens0.528846
united states of america0.336538
adult0.259615
zoological garden0.163462
monkey0.144231
pig0.134615
sus scrofa0.134615
macaca mulatta0.115385
rural community0.105769
research facility0.105769
child0.096154
control0.096154
china0.086538
captive0.067308
small village0.057692
caecum0.057692
rhesus macaque0.057692
hunter gatherer0.048077
male0.048077
united kingdom0.048077
indian rhesus macaque0.048077
cayo santiago0.048077
puerto rico0.048077
gorilla gorilla0.048077
nigeria0.038462
canada0.038462
age 10-15 years0.038462
city0.038462
farm0.038462
state of tennessee0.038462
pan troglodytes0.038462
chimpanzee0.038462
ethiopia0.038462
tanzania0.028846
hadza0.028846
obsolete_juvenile stage0.028846
peru0.028846
wild0.028846
ascending colon0.028846
age 6 weeks0.028846
male organism0.028846
province of alberta0.028846
LOWER IN child0.028846
LOWER IN crohn's disease0.028846
female0.028846
female organism0.028846
LOWER IN united states of america0.028846
LOWER IN infant0.028846
LOWER IN ileum0.028846
zambia0.028846
age 8 months0.028846
state of minnesota0.028846
como zoo0.028846
rectal swab0.028846
adult organism0.028846
LOWER IN wild0.028846
age 5-13 years0.028846
bolivia0.028846
chuquisaca department0.028846
LOWER IN city0.019231
LOWER IN ulcerative colitis0.019231
india0.019231
hispanic or latin american0.019231
amerindian0.019231
venezuela0.019231
thailand0.019231
cron diet0.019231
caloric restriction diet0.019231
vagina0.019231
age > 1 year0.019231
body mass index0.019231
low bmi0.019231
LOWER IN high bmi0.019231
amsterdam0.019231
kingdom of the netherlands0.019231
homosexual0.019231
msm0.019231
egypt0.019231
kingdom of norway0.019231
kebbi state0.019231
el salvador0.019231
jinhua city prefecture0.019231
jinhua pig0.019231
LOWER IN state of california0.019231
state of oregon0.019231
tunapuco0.019231
nanchang city prefecture0.019231
papio anubis0.019231
LOWER IN age < 1 year0.019231
wet season0.019231
LOWER IN dry season0.019231
lincoln park zoo0.019231
chicago0.019231
skin0.019231
africa0.019231
LOWER IN duodenum0.019231
saint louis zoo0.019231
saint louis0.019231
chlorocebus aethiops0.019231
Exp. ID User ID Description Date Region Flag Sequences
290amnon high in rural community small village compared to city in homo sapiens feces adult china 2018-02-01v4No1 / 21
293amnonlower in lean participants in human feces ( high in high bmi compared to low bmi in united states of america feces adult homo sapiens )2018-02-07v4No1 / 29
190amnonhigher in Hadza camp Hukamako compared to hadza camp Sengeli ( high in camp hukamako compared to camp sengeli in homo sapiens tanzania hadza hunter gatherer feces )2017-09-04v4No1 / 35
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 66
394amnon high in control compared to ulcerative colitis in homo sapiens feces adult united states of america state of california 2018-11-06v4No1 / 71
832amnoncommon nigeria, ibadan, adult, feces, homo sapiens2021-09-11v4No1 / 74
663amnon high in switzerland compared to poland in adult feces homo sapiens 2020-09-22v4No1 / 76
339amnoncommon homo sapiens, feces, adult, india2018-05-24v4No1 / 81
830amnon high in iga positive fraction compared to iga igg negative fraction iga negative fraction in homo sapiens feces age 9-17 years teenager peru 2021-09-10v4No1 / 88
759amnon high in wild new york city state of new york compared to research facility city of boston commonwealth of massachusetts in feces united states of america rattus norvegicus rat 2021-04-06v4No1 / 96
673amnoncommon caecum, ascending colon, salmonellosis, salmonella enterica subsp. enterica serovar typhimurium, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 99
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in sus scrofa pig caecum united kingdom )2017-11-26v4No1 / 103
644amnonhigher in individuals born in latin america compared to indivuals born in usa ( high in non usa born compared to usa born in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 107
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 125
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 136
770amnon high in vagina female organism compared to male organism penis in age > 1 year indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v4No1 / 138
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in homo sapiens feces united states of america )2017-12-04v4No1 / 140
63amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens united states of america feces )2017-04-12v4No1 / 141
629amnoncommon amsterdam, kingdom of the netherlands, adult, homosexual, msm, feces, homo sapiens2020-05-31v4No1 / 141
62amnon high in egypt compared to united states of america in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 144
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 146
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
594amnoncommon adult, cameroon, feces, homo sapiens, city, yaounde2020-03-12v4No1 / 154
629amnon high in msm homosexual compared to msw heterosexual in male adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v4No1 / 154
673amnoncommon caecum, control, ascending colon, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 154
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
770amnoncommon vagina, female organism, age > 1 year, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 169
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 1 compared to farm 2 in sus scrofa pig jinhua city prefecture jinhua pig feces farm china )2018-12-06v4No1 / 171
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
620amnoncommon village, rural community, homo sapiens, nouabale-ndoki national park, republic of congo, feces2020-05-06v4No1 / 197
411amnoncommon zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 200
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
411amnoncommon zambia, feces, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 224
10amnonpositively correlated with age (6-35) ( high in adult compared to child in homo sapiens feces toronto )2016-10-27v4No1 / 228
673amnon high in caecum ascending colon compared to ileum in control research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 228
671amnon high in state of oregon compared to state of california in age 8 months united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 232
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
671amnoncommon age 8 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 252
625amnoncommon black-handed spider monkey, ateles geoffroyi, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 256
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
688amnoncommon nanchang city prefecture, feces, age 140 days, research facility, duroc pig, china, pig, sus scrofa2028-03-09v4No1 / 278
770amnoncommon age < 1 year, infant, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 280
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
625amnoncommon gorilla gorilla, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 293
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
770amnon high in age 10-15 years adult organism compared to age < 1 year infant in rectal swab feces indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v4No1 / 304
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 345
671amnoncommon female, adult, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 356
620amnoncommon lincoln park zoo, chicago, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 358
565amnoncommon skin, canada, macropus rufus, red kangaroo, zoological garden, captive, african lion safari2019-11-21v3No1 / 360
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
816amnonhigher in sows in first pregnancy compared to later pregnancies ( high in first pregnancy compared to multiple pregnancies in commonwealth of pennsylvania pregnancy feces adult organism research facility united states of america female organism sus scrofa pig )2021-07-04v4No1 / 374
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
620amnoncommon lincoln park zoo, united states of america, chicago, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 384
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
770amnoncommon age 10-15 years, adult organism, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 396
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
625amnoncommon pongo abelii, sumatran orangutan, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 414
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
620amnoncommon saint louis zoo, saint louis, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 433
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
424amnoncommon sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 452
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
620amnoncommon saint louis zoo, saint louis, united states of america, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 530
671amnon high in state of oregon compared to state of california in female adult united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 534
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
671amnon high in age 3 months compared to age 1 month in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 714
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
331amnon high in wet season compared to dry season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 818
671amnon high in age 8 months compared to age 6 months age 3 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 955
620amnon high in united states of america zoological garden pan troglodytes compared to nouabale-ndoki national park republic of congo wild pan troglodytes troglodytes in chimpanzee feces 2020-05-06v4No1 / 964
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
620amnon high in united states of america zoological garden compared to nouabale-ndoki national park wild republic of congo in gorilla gorilla gorilla feces 2020-05-06v4No1 / 1019

Problems / suggestions? Please email info AT dbbact DOT org