Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGACGCAAGTCTGAAGTGAAATACCCGGGCTCAACCTGGGAACTGCTTTGGAAACTGTGTTGCTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.576375
adult0.473062
feces0.467780
united states of america0.202976
child0.174419
rural community0.167832
china0.151361
control0.139211
city0.117955
biopsy0.090909
obsolete_juvenile stage0.087591
infant0.080537
small village0.077720
africa0.075758
himalayas0.075758
rectum0.072993
nepal0.072993
biopsy site0.061538
chuquisaca department0.061538
LOWER IN crohn's disease0.061069
age 5-13 years0.059701
bolivia0.057971
age0.056738
female0.056497
guangzhou city prefecture0.046875
madagascar0.046875
antananarivo0.046875
LOWER IN child0.046875
age 60-790.046875
LOWER IN ulcerative colitis0.046512
LOWER IN united states of america0.046154
india0.045802
state of colorado0.045283
zoological garden0.044776
sus scrofa0.044280
pig0.044280
colon0.039867
state of california0.039867
heterosexual0.032000
msw0.032000
sigmoid colon0.031746
children0.031746
hmong0.031746
commonwealth of pennsylvania0.031746
taiwan0.031746
taipei city0.031746
nanchang city prefecture0.031746
thailand0.031746
age 19-240.031746
LOWER IN central african republic0.031746
LOWER IN bangui0.031746
cron diet0.031746
toronto0.031746
LOWER IN russia0.031746
el salvador0.031746
age 130.031746
age 30-500.031746
LOWER IN age >940.031746
age 50-60 years0.031746
nanning city prefecture0.031746
tunapuco0.031746
weaned0.031746
age 4-7 weeks0.031746
corn and soybean diet0.031746
hunter gatherer0.031746
LOWER IN mouth mucosa0.031746
terminal ileum0.031250
tibet autonomous region0.031250
caloric restriction diet0.031250
age < 3 years0.031250
south america0.031250
peru0.031250
jiangxi province0.031250
papio anubis0.031250
kingdom of denmark0.031250
ulcerative colitis0.031008
state of michigan0.031008
finland0.031008
kingdom of norway0.030769
juvenile organism0.030769
united kingdom0.030534
hospital0.029851
tibetan plateau0.029851
diarrhea0.029412
belgium0.029412
LOWER IN mouth0.029412
LOWER IN feces0.029197
monkey0.028986
kingdom of spain0.028169
diet0.027397
australia0.026316
caecum0.024096
farm0.023810
LOWER IN control0.016327
LOWER IN centenerians0.016129
non c. diff diarrhea0.016129
LOWER IN clostridium difficile intestinal infectious disease0.016129
mild0.016129
LOWER IN severe0.016129
LOWER IN stroke0.016129
Fraction of dbbact annotations with this term covered by the query
TermScore
small village0.750000
heterosexual0.666667
msw0.666667
biopsy0.600000
rural community0.571429
LOWER IN centenerians0.500000
non c. diff diarrhea0.500000
LOWER IN clostridium difficile intestinal infectious disease0.500000
biopsy site0.500000
mild0.500000
LOWER IN severe0.500000
guangzhou city prefecture0.500000
LOWER IN stroke0.500000
sigmoid colon0.500000
children0.500000
hmong 2nd generation0.500000
hmong0.500000
LOWER IN endospore enriched fraction0.500000
LOWER IN lysis0.500000
stroke0.500000
salmonella gastroenteritis0.500000
LOWER IN insomnia0.500000
africa0.500000
madagascar0.500000
antananarivo0.500000
himalayas0.500000
tharu0.500000
agrarian0.500000
commonwealth of pennsylvania0.500000
raute0.500000
age 17-290.500000
central african republic0.500000
bangui0.500000
taiwan0.500000
taipei city0.500000
denver0.500000
age 200.500000
raji0.500000
nanchang city prefecture0.500000
thailand0.500000
azerbaijan0.500000
chepang0.500000
age 19-240.500000
LOWER IN central african republic0.500000
LOWER IN bangui0.500000
LOWER IN child0.500000
LOWER IN inflammatory bowel disease0.500000
LOWER IN sucram0.500000
standard feed0.500000
age 60-790.500000
chuquisaca department0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
irritable bowel syndrome0.500000
oslo0.500000
age 30-400.500000
myanmar0.500000
karen0.500000
cron diet0.500000
toronto0.500000
LOWER IN russia0.500000
el salvador0.500000
age<17 years0.500000
estonia0.500000
age 130.500000
low anterior resection0.500000
age 1-3 years0.500000
low income0.500000
LOWER IN sewer0.500000
LOWER IN wastewater treatment plant0.500000
spondyloarthritis0.500000
spondylitis0.500000
age 30-500.500000
LOWER IN age >940.500000
gastric carcinoma0.500000
stomach neoplasm0.500000
canada0.500000
atherosclerosis0.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
soldiers0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
age 1-20.500000
LOWER IN age 0-10.500000
male0.500000
bangladesh0.500000
tunapuco0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
LOWER IN lima0.500000
LOWER IN shantytown0.500000
hadza0.500000
hunter gatherer0.500000
zambia0.500000
baboon0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.942623
feces0.893443
adult0.491803
united states of america0.311475
china0.188525
control0.163934
child0.122951
rural community0.098361
city0.073770
biopsy0.049180
obsolete_juvenile stage0.049180
infant0.049180
rectum0.040984
africa0.040984
nepal0.040984
himalayas0.040984
female0.040984
small village0.040984
biopsy site0.032787
LOWER IN crohn's disease0.032787
age 5-13 years0.032787
bolivia0.032787
chuquisaca department0.032787
age0.032787
LOWER IN ulcerative colitis0.024590
guangzhou city prefecture0.024590
colon0.024590
LOWER IN united states of america0.024590
state of california0.024590
madagascar0.024590
antananarivo0.024590
state of colorado0.024590
LOWER IN child0.024590
sus scrofa0.024590
pig0.024590
age 60-790.024590
india0.024590
zoological garden0.024590
australia0.016393
hospital0.016393
diarrhea0.016393
terminal ileum0.016393
sigmoid colon0.016393
caecum0.016393
children0.016393
hmong0.016393
ulcerative colitis0.016393
tibet autonomous region0.016393
tibetan plateau0.016393
kingdom of norway0.016393
LOWER IN feces0.016393
commonwealth of pennsylvania0.016393
state of michigan0.016393
taiwan0.016393
taipei city0.016393
heterosexual0.016393
msw0.016393
nanchang city prefecture0.016393
thailand0.016393
age 19-240.016393
LOWER IN central african republic0.016393
LOWER IN bangui0.016393
belgium0.016393
diet0.016393
united kingdom0.016393
kingdom of spain0.016393
cron diet0.016393
caloric restriction diet0.016393
toronto0.016393
age < 3 years0.016393
finland0.016393
LOWER IN russia0.016393
el salvador0.016393
age 130.016393
juvenile organism0.016393
south america0.016393
age 30-500.016393
LOWER IN age >940.016393
LOWER IN control0.016393
age 50-60 years0.016393
nanning city prefecture0.016393
peru0.016393
tunapuco0.016393
farm0.016393
jiangxi province0.016393
weaned0.016393
age 4-7 weeks0.016393
corn and soybean diet0.016393
monkey0.016393
papio anubis0.016393
hunter gatherer0.016393
kingdom of denmark0.016393
LOWER IN mouth mucosa0.016393
LOWER IN mouth0.016393
sichuan province0.008197
LOWER IN centenerians0.008197
non c. diff diarrhea0.008197
LOWER IN clostridium difficile intestinal infectious disease0.008197
mild0.008197
LOWER IN severe0.008197
Exp. ID User ID Description Date Region Flag Sequences
36amnonhigher in adults compared to centenarians ( high in adult compared to centenerians in homo sapiens feces sichuan province )2016-12-06v4No1 / 16
390amnonlower in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in non c. diff diarrhea compared to clostridium difficile intestinal infectious disease in homo sapiens feces australia hospital diarrhea )2018-11-04v4No1 / 23
410amnonlower in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america biopsy biopsy site rectum )2018-11-22v4No1 / 26
333amnonlower in stroke patients compared to healthy controls ( high in control compared to stroke in homo sapiens feces guangzhou city prefecture adult china )2018-05-15v4No1 / 30
19amnoncommon in biopsies of children (IBD study) (common rectum, terminal ileum, sigmoid colon, caecum, colon, biopsy, children, homo sapiens, united states of america)2016-11-14v4No1 / 40
400amnonhigher in children of hmong migrands born in the usa compared to non-migrant usa people ( high in hmong 2nd generation hmong compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 41
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in homo sapiens feces united states of america adult )2018-11-18v4No1 / 41
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
390amnoncommon homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v4No1 / 55
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
333amnoncommon in healthy controls feces (common homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 61
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
194amnon high in colon ileum compared to feces in homo sapiens kingdom of norway 2017-09-07v4No1 / 67
566amnon high in control compared to insomnia in adult china feces homo sapiens 2019-11-24v4No1 / 71
425amnoncommon homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 73
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
74amnoncommon united states of america, feces, homo sapiens2017-02-27v4No1 / 76
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v4No1 / 76
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 77
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 79
529amnoncommon homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v3No1 / 79
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v4No1 / 81
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 97
438amnoncommon homo sapiens, feces, age 19-24, china2018-12-30v4No1 / 101
425amnon high in antananarivo madagascar compared to central african republic bangui in homo sapiens africa child duodenum 2018-12-08v4No1 / 103
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
256amnonhigher in control diet compared to diet enriched with sucram in pig gut ( high in diet standard feed compared to sucram in gastrointestinal system sus scrofa pig united kingdom )2017-11-26v4No1 / 109
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 111
477amnon high in nepal rural community himalayas compared to united states of america in homo sapiens feces adult 2019-01-28v4No1 / 111
517amnoncommon feces, homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department2019-05-29v4No1 / 113
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 148
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens adult feces china 2018-02-05v4No1 / 161
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 188
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 214
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon adult, homo sapiens, china, feces2019-11-24v4No1 / 221
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
10amnonpositively correlated with age (6-35) ( high in adult compared to child in homo sapiens feces toronto )2016-10-27v4No1 / 228
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in age 19-24 soldiers compared to adult age 30-50 age 60-79 age >94 in homo sapiens feces china )2018-12-30v4No1 / 238
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
190amnon high in dry season compared to wet season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 311
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org