Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGACGCAAGTCTGGAGTGAAAGCCCGGGGCCCAACCCCGGGACTGCTTTGGAAACTGTGCTGCTGGAGTGCAGGAGAGGTAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
china0.476190
infant0.278884
homo sapiens0.231738
feces0.226702
crohn's disease0.226619
age0.164706
adult0.154332
united states of america0.134138
1-year-old human stage0.120846
state of california0.103627
LOWER IN control0.098330
city0.088235
hispanic or latin american0.085714
12-month-old human stage0.084507
LOWER IN rural community0.080000
taconic farms0.078947
age 8 weeks0.078947
obsolete_juvenile stage0.075949
research facility0.074576
LOWER IN jackson laboratories0.073171
LOWER IN under-1-year-old human stage0.072289
child0.071429
atlanta0.060606
los angeles district0.060606
LOWER IN small village0.058824
pulsed antibiotic treatment, macrolide tylosin tartrate0.058824
mus musculoides0.058824
nyulmc0.058824
nod/shiltj (no. 001976, jackson labs)0.058824
oslo0.058824
age<17 years0.058824
formula fed0.058824
nanning city prefecture0.058824
sixth decade human stage0.058824
age < 1 year0.057143
hispanic0.057143
LOWER IN 1-month-old human stage0.057143
age < 3 years0.057143
LOWER IN fourth decade human stage0.056338
finland0.056338
lamb0.055556
ulcerative colitis0.055556
systemic lupus erythematosus0.055556
age 1 year0.055556
old age0.054795
LOWER IN young age0.054795
rumen liquid0.054054
guangzhou city prefecture0.054054
6-month-old human stage0.054054
qinghai province0.051282
commonwealth of virginia0.051282
c57bl/60.050847
kingdom of norway0.050000
adolescent stage0.050000
kingdom of denmark0.050000
sheep0.047619
LOWER IN russia0.047619
ovis aries0.045455
canada0.043165
mus musculus0.042105
antibiotic0.041667
male0.041237
farm0.040000
caecum0.040000
rumen0.038462
female0.031496
columbia0.030769
acute pancreatitis0.030769
pancreatitis0.030769
glasgow0.030769
schizophrenia0.030303
tucson0.030303
stress: chronic subordinate colony housing0.030303
LOWER IN no stress: single housed control0.030303
no immunization: vehicle as control0.030303
c57bc/6ncrl0.030303
hard stool0.030303
LOWER IN normal stool0.030303
little physical activity0.030303
LOWER IN cron diet0.030303
equine grass sickness0.030303
trachemys scripta elegans0.030303
red-eared slider turtle0.030303
turtle farm0.030303
weight loss0.030303
weight loss diet0.030303
gaz:000521000.030303
meleagris gallopavo0.030303
wild turkey0.030303
LOWER IN age 7 months0.030303
gangcha region0.030303
LOWER IN gannan tibetan autonomous prefecture0.030303
LOWER IN tunapuco0.030303
rhesus macaque0.030303
nephrolithiasis0.030303
perianal skin0.030303
santa catalina island0.030303
urocyon littoralis0.030303
urocyon littoralis catalinae0.030303
santa catalina island fox0.030303
Fraction of dbbact annotations with this term covered by the query
TermScore
china5.000000
atlanta1.000000
columbia1.000000
los angeles district1.000000
acute pancreatitis1.000000
pancreatitis1.000000
glasgow1.000000
crohn's disease0.583333
hispanic or latin american0.500000
schizophrenia0.500000
LOWER IN small village0.500000
pulsed antibiotic treatment, macrolide tylosin tartrate0.500000
mus musculoides0.500000
nyulmc0.500000
nod/shiltj (no. 001976, jackson labs)0.500000
oslo0.500000
tucson0.500000
stress: chronic subordinate colony housing0.500000
LOWER IN no stress: single housed control0.500000
no immunization: vehicle as control0.500000
c57bc/6ncrl0.500000
age<17 years0.500000
hard stool0.500000
LOWER IN normal stool0.500000
formula fed0.500000
little physical activity0.500000
LOWER IN cron diet0.500000
equine grass sickness0.500000
trachemys scripta elegans0.500000
red-eared slider turtle0.500000
turtle farm0.500000
weight loss0.500000
weight loss diet0.500000
gaz:000521000.500000
meleagris gallopavo0.500000
wild turkey0.500000
LOWER IN age 7 months0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
LOWER IN tunapuco0.500000
rhesus macaque0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
sixth decade human stage0.500000
perianal skin0.500000
santa catalina island0.500000
urocyon littoralis0.500000
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
age >940.500000
tenth decade human stage0.500000
12-month-old human stage0.428571
infant0.384615
age0.333333
younger age0.333333
LOWER IN older age0.333333
age < 1 year0.333333
clostridium difficile colitis0.333333
hispanic0.333333
nanchang city prefecture0.333333
LOWER IN physical activity0.333333
american diet0.333333
LOWER IN 1-month-old human stage0.333333
age 3-5 weeks0.333333
high protein diet0.333333
LOWER IN fiber diet0.333333
overweight body mass index status0.333333
colon0.333333
tibet autonomous region0.333333
age < 3 years0.333333
state of oklahoma0.333333
estonia0.333333
LOWER IN 2-month-old human stage0.333333
age 1 month0.333333
mouth neoplasm0.333333
ninth decade human stage0.333333
LOWER IN 65-79 year-old human stage0.333333
LOWER IN fourth decade human stage0.285714
finland0.285714
LOWER IN rural community0.272727
1-year-old human stage0.266667
lamb0.250000
inflammatory bowel disease0.250000
ulcerative colitis0.250000
systemic lupus erythematosus0.250000
age 1 year0.250000
clostridium difficile infection0.250000
LOWER IN age 2 months0.250000
fifth decade human stage0.250000
LOWER IN breast fed0.250000
hainan autonomous prefecture0.250000
state of ohio0.250000
taconic farms0.250000
terminal ileum0.250000
age 8 weeks0.250000
small village0.250000
LOWER IN vancomycin0.250000
LOWER IN neomycin0.250000
LOWER IN external acoustic meatus0.250000
LOWER IN ear canal0.250000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.859375
homo sapiens0.765625
united states of america0.390625
adult0.359375
china0.250000
infant0.218750
LOWER IN control0.203125
research facility0.171875
crohn's disease0.140625
age0.109375
state of california0.078125
1-year-old human stage0.078125
city0.062500
child0.062500
mus musculus0.062500
hispanic or latin american0.046875
LOWER IN rural community0.046875
obsolete_juvenile stage0.046875
12-month-old human stage0.046875
LOWER IN under-1-year-old human stage0.046875
control0.046875
taconic farms0.046875
LOWER IN jackson laboratories0.046875
c57bl/60.046875
canada0.046875
mouse0.046875
age 8 weeks0.046875
old age0.031250
LOWER IN young age0.031250
LOWER IN small village0.031250
rumen0.031250
ovis aries0.031250
qinghai province0.031250
rumen liquid0.031250
age < 1 year0.031250
sheep0.031250
lamb0.031250
guangzhou city prefecture0.031250
antibiotic0.031250
pulsed antibiotic treatment, macrolide tylosin tartrate0.031250
female0.031250
mus musculoides0.031250
nyulmc0.031250
nod/shiltj (no. 001976, jackson labs)0.031250
ulcerative colitis0.031250
systemic lupus erythematosus0.031250
commonwealth of virginia0.031250
age 1 year0.031250
LOWER IN adult0.031250
LOWER IN fourth decade human stage0.031250
kingdom of norway0.031250
oslo0.031250
male0.031250
atlanta0.031250
age<17 years0.031250
immature stage0.031250
adolescent stage0.031250
formula fed0.031250
los angeles district0.031250
hispanic0.031250
6-month-old human stage0.031250
kingdom of denmark0.031250
farm0.031250
LOWER IN 1-month-old human stage0.031250
caecum0.031250
finland0.031250
LOWER IN russia0.031250
age < 3 years0.031250
nanning city prefecture0.031250
sixth decade human stage0.031250
LOWER IN ulcerative colitis0.015625
schizophrenia0.015625
younger age0.015625
LOWER IN age0.015625
LOWER IN older age0.015625
inflammatory bowel disease0.015625
commonwealth of pennsylvania0.015625
hospital0.015625
clostridium difficile colitis0.015625
clostridium difficile infection0.015625
tucson0.015625
stress: chronic subordinate colony housing0.015625
LOWER IN no stress: single housed control0.015625
no immunization: vehicle as control0.015625
c57bc/6ncrl0.015625
hard stool0.015625
LOWER IN normal stool0.015625
columbia0.015625
LOWER IN age 2 months0.015625
fourth decade human stage0.015625
fifth decade human stage0.015625
LOWER IN human late adulthood stage0.015625
south korea0.015625
LOWER IN breast fed0.015625
acute pancreatitis0.015625
pancreatitis0.015625
nanchang city prefecture0.015625
little physical activity0.015625
LOWER IN physical activity0.015625
diet0.015625
Exp. ID User ID Description Date Region Flag Sequences
399amnon high in crohn's disease compared to ulcerative colitis in feces homo sapiens united states of america 2018-11-16v4No1 / 3
644amnonhigher in older adults (total age range 20-80) ( high in age old age compared to young age in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 11
502amnon high in schizophrenia compared to control in feces homo sapiens united states of america adult 2019-03-12v4No1 / 13
290amnon high in city compared to small village rural community in feces homo sapiens adult china 2018-02-01v4No1 / 14
657amnonnegatively correlated with age ( high in younger age compared to age older age in research facility rumen ovis aries qinghai province rumen liquid age < 1 year sheep lamb china )2020-09-13v4No1 / 14
779amnon high in crohn's disease compared to control in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 15
46amnonsmj: higher in female mice feces treated with antibiotics ( high in antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate compared to control in feces united states of america female research facility mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 16
395amnonhigher in kids with ibd compared to healthy donors ( high in child inflammatory bowel disease crohn's disease ulcerative colitis compared to control in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 16
368amnon high in systemic lupus erythematosus compared to control in feces homo sapiens united states of america adult commonwealth of virginia 2018-09-03v4No1 / 17
330amnon high in infant age 1 year compared to adult fourth decade human stage in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 19
689amnoncommon feces, homo sapiens, united states of america, hospital, clostridium difficile colitis, adult, clostridium difficile infection, tucson2028-03-11v4No1 / 19
47amnonsmj: higher in bullied, non-immunized mouse ( high in stress: chronic subordinate colony housing compared to no stress: single housed control in feces united states of america research facility mus musculus male no immunization: vehicle as control c57bc/6ncrl )2017-01-13v4No1 / 21
297amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens united states of america child atlanta obsolete_juvenile stage age<17 years immature stage adolescent stage 2018-02-12v4No1 / 22
779amnoncommon feces, homo sapiens, adult, guangzhou city prefecture, crohn's disease, china2021-04-28v4No1 / 22
399amnon high in crohn's disease compared to control in feces homo sapiens united states of america 2018-11-16v4No1 / 27
404amnon high in hard stool compared to normal stool in feces homo sapiens city adult columbia 2018-11-20v4No1 / 27
46amnonsmj: higher in mice feces treated with antibiotics ( high in antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate compared to control in feces united states of america research facility male mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 28
284amnon high in 12-month-old human stage compared to age 2 months in feces homo sapiens female infant state of california 2018-01-27v4No1 / 35
233amnon high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens united states of america infant 2017-11-05v4No1 / 37
131amnonnegatively correlated with age (30-80 years) ( high in age fourth decade human stage fifth decade human stage compared to human late adulthood stage in feces homo sapiens south korea )2017-04-16v4No1 / 39
330amnoncommon feces, homo sapiens, infant, kingdom of norway, oslo, age 1 year2018-05-13v4No1 / 39
859amnon high in formula fed compared to breast fed in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 6-month-old human stage 2022-01-12v4No1 / 41
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, 1-year-old human stage2018-01-14v4No1 / 46
428amnon high in acute pancreatitis pancreatitis compared to control in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 46
292amnoncommon feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 55
368amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of virginia, systemic lupus erythematosus2018-09-03v4No1 / 56
63amnonhigher in individuals with low physical activity ( high in little physical activity compared to physical activity in feces homo sapiens united states of america )2017-12-04v4No1 / 59
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in diet american diet compared to cron diet caloric restriction diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 61
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
448amnon high in equine grass sickness disease compared to control in feces farm equus caballus horse united kingdom 2019-01-08v4No1 / 72
859amnon high in 6-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 2022-01-12v4No1 / 72
292amnoncommon feces, homo sapiens, control, adult, china2018-02-05v4No1 / 81
590amnoncommon farm, intestine, age 3-5 weeks, china, hainan autonomous prefecture, trachemys scripta elegans, red-eared slider turtle, turtle farm2020-02-10v4No1 / 83
721amnon high in weight loss weight loss diet high protein diet compared to high fiber fiber diet in feces homo sapiens obesity adult scotland overweight body mass index status gaz:00052100 2028-05-23v4No1 / 83
838amnoncommon united states of america, research facility, caecum, state of ohio, meleagris gallopavo, wild turkey2021-10-13v4No1 / 94
127amnonhigh in old (14-28 days) compared to young (0-3 day) chickens ( high in age old age compared to young age in united states of america caecum gallus gallus chicken )2017-04-14v4No1 / 98
538amnon high in taconic farms compared to jackson laboratories in research facility ileum mus musculus c57bl/6 terminal ileum canada mouse age 8 weeks 2019-07-29v4No1 / 104
797amnon high in 12-month-old human stage compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 106
215amnoncommon feces, homo sapiens, united states of america2017-10-23v4No1 / 107
538amnon high in taconic farms compared to jackson laboratories in research facility colon right colon mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 108
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
538amnon high in taconic farms compared to jackson laboratories in feces research facility mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 135
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 148
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 169
399amnoncommon feces, united states of america, research facility, rattus norvegicus, rat2018-11-16v4No1 / 184
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in child obsolete_juvenile stage crohn's disease compared to control adult in feces homo sapiens glasgow )2017-02-26v4No1 / 185
669amnon high in 12-month-old human stage compared to 2-month-old human stage in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 217
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v4No1 / 239
45amnonlower in young babies compared to 2 year olds in india ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant india )2016-12-19v4No1 / 253
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v4No1 / 281
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
582amnon high in rectum perianal skin compared to external acoustic meatus ear canal in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 400
438amnonhigher in centenarians compared to adults ( high in age >94 ninth decade human stage tenth decade human stage compared to 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 474
657amnoncommon research facility, rumen, ovis aries, qinghai province, rumen liquid, age < 1 year, sheep, lamb, china2020-09-13v4No1 / 517
273amnon high in age 1-year-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant finland )2017-11-12v4No1 / 567

Problems / suggestions? Please email info AT dbbact DOT org