Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAGACAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGCCTTGCTAGAGTGCTGGAGAGGTAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.550361
feces0.457851
adult0.454062
united states of america0.183699
child0.172555
rural community0.162382
control0.137886
china0.133886
city0.121212
obsolete_juvenile stage0.105960
LOWER IN crohn's disease0.085714
india0.085714
monkey0.081633
infant0.075949
small village0.072639
himalayas0.070922
nepal0.068493
canada0.059850
hunter gatherer0.058680
biopsy0.058111
africa0.057554
ethiopia0.057554
united kingdom0.053691
age0.053333
toronto0.043796
thailand0.043796
biopsy site0.043796
LOWER IN child0.043796
age 60-790.043796
age 30-500.043796
left colon0.043796
chuquisaca department0.043796
LOWER IN ulcerative colitis0.043478
right colon0.043321
LOWER IN united states of america0.043165
LOWER IN duodenum0.043165
zoological garden0.043165
age 5-13 years0.042857
kingdom of norway0.041958
jiangsu province0.041958
bolivia0.041958
female0.040609
state of california0.037618
caecum0.036585
skin0.035608
male0.030075
amerindian0.029851
venezuela0.029851
guangzhou city prefecture0.029630
hadza0.029630
age<17 years0.029630
central african republic0.029630
bangui0.029630
nanchang city prefecture0.029630
age 19-240.029630
oslo0.029630
age 30-400.029630
cron diet0.029630
el salvador0.029630
estonia0.029630
LOWER IN finland0.029630
age 130.029630
LOWER IN age < 1 year0.029630
LOWER IN age >940.029630
age 50-60 years0.029630
nanning city prefecture0.029630
tunapuco0.029630
chlorocebus aethiops0.029630
LOWER IN mouth mucosa0.029630
LOWER IN infant0.029412
tanzania0.029197
atlanta0.029197
caloric restriction diet0.029197
age < 3 years0.029197
south america0.029197
peru0.029197
kingdom of denmark0.029197
ulcerative colitis0.028986
state of michigan0.028986
juvenile organism0.028777
rectum0.028571
LOWER IN female0.028369
commonwealth of virginia0.028369
sichuan province0.027972
wild0.027972
state of colorado0.027586
belgium0.027586
LOWER IN mouth0.027586
LOWER IN feces0.027397
sus scrofa0.026846
pig0.026846
colon0.026667
kingdom of spain0.026490
diet0.025806
LOWER IN control0.015748
plant based diet0.015038
LOWER IN schizophrenia0.015038
LOWER IN centenerians0.015038
LOWER IN stroke0.015038
camp hukamako0.015038
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.500000
male1.000000
hunter gatherer0.750000
small village0.750000
rural community0.714286
LOWER IN crohn's disease0.666667
india0.666667
amerindian0.666667
venezuela0.666667
biopsy0.600000
plant based diet0.500000
toronto0.500000
LOWER IN schizophrenia0.500000
LOWER IN centenerians0.500000
guangzhou city prefecture0.500000
LOWER IN stroke0.500000
hadza0.500000
camp hukamako0.500000
LOWER IN camp sengeli0.500000
age<17 years0.500000
LOWER IN endospore enriched fraction0.500000
LOWER IN lysis0.500000
daycare0.500000
age 1-5 years0.500000
africa0.500000
madagascar0.500000
antananarivo0.500000
himalayas0.500000
tharu0.500000
agrarian0.500000
raute0.500000
age 17-290.500000
central african republic0.500000
bangui0.500000
age 200.500000
raji0.500000
nanchang city prefecture0.500000
thailand0.500000
hmong0.500000
azerbaijan0.500000
biopsy site0.500000
chepang0.500000
age 19-240.500000
commonwealth of pennsylvania0.500000
LOWER IN child0.500000
LOWER IN inflammatory bowel disease0.500000
lima0.500000
shantytown0.500000
age 60-790.500000
age 30-500.500000
left colon0.500000
irritable bowel syndrome0.500000
age >940.500000
oslo0.500000
age 30-400.500000
myanmar0.500000
karen0.500000
cron diet0.500000
physical activity0.500000
LOWER IN little physical activity0.500000
el salvador0.500000
estonia0.500000
LOWER IN finland0.500000
LOWER IN russia0.500000
age 130.500000
taiwan0.500000
taipei city0.500000
low anterior resection0.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
low income0.500000
LOWER IN sewer0.500000
LOWER IN wastewater treatment plant0.500000
new delhi0.500000
zambia0.500000
papio kindae0.500000
kinda baboon0.500000
LOWER IN age >940.500000
gastric carcinoma0.500000
stomach neoplasm0.500000
atherosclerosis0.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
soldiers0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
age 1-20.500000
LOWER IN age 0-10.500000
bangladesh0.500000
tunapuco0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN lima0.500000
LOWER IN shantytown0.500000
peromyscus maniculatus0.500000
deer mice0.500000
age 3-5 weeks0.500000
province of ontario0.500000
algonquin provincial park0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.900763
feces0.900763
adult0.465649
united states of america0.290076
control0.160305
china0.160305
child0.114504
rural community0.091603
city0.076336
obsolete_juvenile stage0.061069
LOWER IN crohn's disease0.045802
india0.045802
infant0.045802
monkey0.045802
nepal0.038168
himalayas0.038168
small village0.038168
hunter gatherer0.030534
africa0.030534
female0.030534
biopsy0.030534
united kingdom0.030534
age0.030534
canada0.030534
ethiopia0.030534
toronto0.022901
LOWER IN ulcerative colitis0.022901
state of california0.022901
kingdom of norway0.022901
thailand0.022901
biopsy site0.022901
right colon0.022901
LOWER IN child0.022901
age 60-790.022901
jiangsu province0.022901
LOWER IN united states of america0.022901
age 30-500.022901
left colon0.022901
LOWER IN duodenum0.022901
zoological garden0.022901
skin0.022901
caecum0.022901
age 5-13 years0.022901
bolivia0.022901
chuquisaca department0.022901
diet0.015267
male0.015267
LOWER IN female0.015267
sichuan province0.015267
guangzhou city prefecture0.015267
tanzania0.015267
hadza0.015267
age<17 years0.015267
atlanta0.015267
commonwealth of virginia0.015267
ulcerative colitis0.015267
LOWER IN feces0.015267
colon0.015267
state of michigan0.015267
central african republic0.015267
bangui0.015267
state of colorado0.015267
nanchang city prefecture0.015267
age 19-240.015267
belgium0.015267
rectum0.015267
kingdom of spain0.015267
amerindian0.015267
venezuela0.015267
oslo0.015267
age 30-400.015267
cron diet0.015267
caloric restriction diet0.015267
LOWER IN infant0.015267
el salvador0.015267
age < 3 years0.015267
estonia0.015267
LOWER IN finland0.015267
age 130.015267
juvenile organism0.015267
LOWER IN age < 1 year0.015267
south america0.015267
wild0.015267
LOWER IN age >940.015267
LOWER IN control0.015267
age 50-60 years0.015267
nanning city prefecture0.015267
peru0.015267
tunapuco0.015267
kingdom of denmark0.015267
chlorocebus aethiops0.015267
sus scrofa0.015267
pig0.015267
LOWER IN mouth mucosa0.015267
LOWER IN mouth0.015267
plant based diet0.007634
LOWER IN animal product diet0.007634
LOWER IN schizophrenia0.007634
LOWER IN centenerians0.007634
LOWER IN stroke0.007634
Exp. ID User ID Description Date Region Flag Sequences
63amnon high in diet plant based diet compared to animal product diet in homo sapiens united states of america feces 2017-04-12v4No1 / 6
10amnon high in male compared to female in homo sapiens feces toronto 2016-10-27v4No1 / 11
502amnon high in control compared to schizophrenia in homo sapiens feces adult united states of america 2019-03-12v4No1 / 14
36amnonhigher in adults compared to centenarians ( high in adult compared to centenerians in homo sapiens feces sichuan province )2016-12-06v4No1 / 16
333amnonlower in stroke patients compared to healthy controls ( high in control compared to stroke in homo sapiens feces guangzhou city prefecture adult china )2018-05-15v4No1 / 30
190amnonhigher in Hadza camp Hukamako compared to hadza camp Sengeli ( high in camp hukamako compared to camp sengeli in homo sapiens tanzania hadza hunter gatherer feces )2017-09-04v4No1 / 35
297amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v4No1 / 38
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 39
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in homo sapiens feces united states of america adult )2018-11-18v4No1 / 41
36amnoncommon homo sapiens, feces, sichuan province2016-12-06v4No1 / 44
482amnoncommon homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, age 1-5 years2019-02-12v4No1 / 47
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
333amnoncommon in healthy controls feces (common homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 61
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 66
194amnon high in colon ileum compared to feces in homo sapiens kingdom of norway 2017-09-07v4No1 / 67
425amnoncommon homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 73
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v4No1 / 76
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 77
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 79
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v4No1 / 81
339amnoncommon homo sapiens, feces, adult, india2018-05-24v4No1 / 81
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 97
438amnoncommon homo sapiens, feces, age 19-24, china2018-12-30v4No1 / 101
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
438amnoncommon feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 111
477amnon high in nepal rural community himalayas compared to united states of america in homo sapiens feces adult 2019-01-28v4No1 / 111
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in homo sapiens feces united states of america )2017-12-04v4No1 / 140
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens adult feces china 2018-02-05v4No1 / 161
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 188
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
411amnoncommon zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 200
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 214
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon adult, homo sapiens, china, feces2019-11-24v4No1 / 221
10amnonpositively correlated with age (6-35) ( high in adult compared to child in homo sapiens feces toronto )2016-10-27v4No1 / 228
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in age 19-24 soldiers compared to adult age 30-50 age 60-79 age >94 in homo sapiens feces china )2018-12-30v4No1 / 238
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
565amnoncommon cow, bos taurus, farm, canada, skin2019-11-21v3No1 / 318
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 345
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to captive research facility in feces canada peromyscus maniculatus deer mice age 3-5 weeks province of ontario algonquin provincial park )2019-07-28v3No1 / 358
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
565amnoncommon toronto zoo, eland, tragelaphus oryx, captive, zoological garden, canada, skin2019-11-21v3No1 / 674
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
331amnon high in wet season compared to dry season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 818
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org