Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGTGACTGCATTGGAAACTGTTTTGCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.469044
adult0.399403
feces0.397539
china0.181653
child0.168367
city0.163488
united states of america0.138693
control0.123393
obsolete_juvenile stage0.119318
jiangsu province0.101695
LOWER IN crohn's disease0.097087
sus scrofa0.075472
pig0.075472
canada0.061856
age 50-60 years0.060000
nanning city prefecture0.060000
age 60-790.060000
age 30-500.060000
biopsy0.059113
india0.058252
rectum0.058252
female0.057971
rural community0.057416
kingdom of spain0.055046
infant0.049587
farm0.046693
male0.041667
metabolic syndrome0.041237
toronto0.040816
nanchang city prefecture0.040816
thailand0.040816
age >940.040816
glasgow0.040816
toronto zoo0.040816
small village0.040816
age 130.040816
LOWER IN age < 1 year0.040816
weaned0.040816
age 4-7 weeks0.040816
corn and soybean diet0.040816
wastewater treatment plant0.040816
chuquisaca department0.040816
LOWER IN infant0.040404
LOWER IN rural community0.040404
state of oklahoma0.040000
south america0.040000
jiangxi province0.040000
kingdom of denmark0.040000
age 5-13 years0.040000
state of michigan0.039604
LOWER IN ulcerative colitis0.039604
high bmi0.039216
biopsy site0.039216
juvenile organism0.039216
ileum0.039216
bolivia0.039216
united kingdom0.038835
LOWER IN female0.038462
hospital0.037736
czech republic0.037736
captive0.037736
diarrhea0.037037
belgium0.037037
zoological garden0.036364
age0.035398
colon0.035398
caecum0.034483
australia0.032258
skin0.027778
salmonella gastroenteritis0.020833
non c. diff diarrhea0.020833
LOWER IN clostridium difficile intestinal infectious disease0.020833
zambia0.020833
papio kindae0.020833
kinda baboon0.020833
low human contact0.020833
new york county0.020833
LOWER IN chronic fatigue syndrome0.020833
jordan0.020833
LOWER IN insomnia0.020833
age 17-290.020833
LOWER IN nephrolithiasis0.020833
age 200.020833
LOWER IN egypt0.020833
metabolic syndrome x0.020833
hmong0.020833
azerbaijan0.020833
age 8-120.020833
age 3-60.020833
lima0.020833
shantytown0.020833
mild0.020833
LOWER IN severe0.020833
gangcha region0.020833
LOWER IN gannan tibetan autonomous prefecture0.020833
irritable bowel syndrome0.020833
myanmar0.020833
karen0.020833
age 13-140.020833
jinhua city prefecture0.020833
Fraction of dbbact annotations with this term covered by the query
TermScore
male1.000000
canada1.000000
metabolic syndrome0.666667
LOWER IN crohn's disease0.555556
toronto0.500000
salmonella gastroenteritis0.500000
non c. diff diarrhea0.500000
LOWER IN clostridium difficile intestinal infectious disease0.500000
zambia0.500000
papio kindae0.500000
kinda baboon0.500000
low human contact0.500000
new york county0.500000
LOWER IN chronic fatigue syndrome0.500000
jordan0.500000
LOWER IN insomnia0.500000
age 17-290.500000
age 50-60 years0.500000
nanning city prefecture0.500000
LOWER IN nephrolithiasis0.500000
age 200.500000
LOWER IN egypt0.500000
metabolic syndrome x0.500000
nanchang city prefecture0.500000
thailand0.500000
hmong0.500000
azerbaijan0.500000
age 8-120.500000
age 3-60.500000
lima0.500000
shantytown0.500000
mild0.500000
LOWER IN severe0.500000
age 60-790.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
age 30-500.500000
irritable bowel syndrome0.500000
age >940.500000
glasgow0.500000
myanmar0.500000
karen0.500000
age 13-140.500000
jinhua city prefecture0.500000
jinhua pig0.500000
farm 20.500000
LOWER IN farm 10.500000
oslo0.500000
age 30-400.500000
toronto zoo0.500000
el salvador0.500000
small village0.500000
LOWER IN peru0.500000
LOWER IN tunapuco0.500000
estonia0.500000
LOWER IN russia0.500000
age 130.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
low income0.500000
LOWER IN sewer0.500000
LOWER IN wastewater treatment plant0.500000
spondyloarthritis0.500000
spondylitis0.500000
LOWER IN age >940.500000
atherosclerosis0.500000
nephrolithiasis0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
LOWER IN short bowel syndrome0.500000
sea urchin0.500000
artificial seawater0.500000
africa0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
wastewater treatment plant0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
sigmoid colon0.500000
children0.500000
mongolian sheep0.500000
age one year0.500000
LOWER IN age one month0.500000
estuary0.500000
estuary water0.500000
salinity <5 ppt0.500000
LOWER IN salinity >20 ppt0.500000
bilbao0.500000
chuquisaca department0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.872340
feces0.872340
adult0.457447
china0.265957
united states of america0.244681
control0.170213
child0.117021
city0.106383
obsolete_juvenile stage0.074468
jiangsu province0.063830
LOWER IN crohn's disease0.053191
female0.042553
sus scrofa0.042553
pig0.042553
age 50-60 years0.031915
nanning city prefecture0.031915
biopsy0.031915
age 60-790.031915
age 30-500.031915
kingdom of spain0.031915
farm0.031915
canada0.031915
infant0.031915
india0.031915
rural community0.031915
rectum0.031915
toronto0.021277
male0.021277
LOWER IN female0.021277
australia0.021277
hospital0.021277
diarrhea0.021277
high bmi0.021277
state of michigan0.021277
metabolic syndrome0.021277
nanchang city prefecture0.021277
thailand0.021277
biopsy site0.021277
czech republic0.021277
belgium0.021277
state of oklahoma0.021277
LOWER IN ulcerative colitis0.021277
age >940.021277
glasgow0.021277
LOWER IN infant0.021277
toronto zoo0.021277
zoological garden0.021277
captive0.021277
skin0.021277
small village0.021277
united kingdom0.021277
LOWER IN rural community0.021277
age 130.021277
juvenile organism0.021277
age0.021277
LOWER IN age < 1 year0.021277
south america0.021277
jiangxi province0.021277
weaned0.021277
age 4-7 weeks0.021277
corn and soybean diet0.021277
kingdom of denmark0.021277
ileum0.021277
wastewater treatment plant0.021277
caecum0.021277
colon0.021277
age 5-13 years0.021277
bolivia0.021277
chuquisaca department0.021277
salmonella gastroenteritis0.010638
non c. diff diarrhea0.010638
LOWER IN clostridium difficile intestinal infectious disease0.010638
LOWER IN low bmi0.010638
zambia0.010638
papio kindae0.010638
wild0.010638
monkey0.010638
kinda baboon0.010638
low human contact0.010638
LOWER IN human contact0.010638
new york county0.010638
LOWER IN chronic fatigue syndrome0.010638
jordan0.010638
LOWER IN hiv infection0.010638
LOWER IN insomnia0.010638
age 17-290.010638
LOWER IN nephrolithiasis0.010638
state of colorado0.010638
msw0.010638
heterosexual0.010638
italy0.010638
obesity0.010638
state of arizona0.010638
age 200.010638
LOWER IN egypt0.010638
metabolic syndrome x0.010638
hmong0.010638
azerbaijan0.010638
right colon0.010638
state of california0.010638
Exp. ID User ID Description Date Region Flag Sequences
10amnon high in male compared to female in homo sapiens feces toronto 2016-10-27v4No1 / 11
390amnonhighfreq homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v4No1 / 20
390amnonlower in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in non c. diff diarrhea compared to clostridium difficile intestinal infectious disease in homo sapiens feces australia hospital diarrhea )2018-11-04v4No1 / 23
293amnonlower in lean participants in human feces ( high in high bmi compared to low bmi in united states of america feces adult homo sapiens )2018-02-07v4No1 / 29
411amnonlower in wild baboons feeding on discarded human foods ( high in low human contact compared to human contact in zambia feces papio kindae wild monkey kinda baboon )2018-11-23v4No1 / 33
12amnon high in control compared to chronic fatigue syndrome in homo sapiens feces new york county 2016-11-02v4No1 / 35
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
22amnon high in control compared to hiv infection in united states of america feces homo sapiens 2016-11-28v4No1 / 70
566amnon high in control compared to insomnia in adult china feces homo sapiens 2019-11-24v4No1 / 71
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in homo sapiens feces adult age 50-60 years nanning city prefecture china )2018-01-27v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 85
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
532amnoncommon homo sapiens, feces, czech republic, adult, control2019-07-21v1No1 / 98
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
438amnoncommon feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 111
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 125
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 2 compared to farm 1 in sus scrofa pig jinhua city prefecture jinhua pig feces farm china )2018-12-06v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
565amnoncommon toronto zoo, zoological garden, lion, panthera leo, captive, canada, skin2019-11-21v3No1 / 150
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens adult feces china 2018-02-05v4No1 / 161
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 188
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon adult, homo sapiens, china, feces2019-11-24v4No1 / 221
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
532amnon high in control compared to short bowel syndrome in homo sapiens feces czech republic adult 2019-07-21v1No1 / 334
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
565amnoncommon toronto zoo, captive, zoological garden, olive baboon, papio anubis, canada, skin2019-11-21v3No1 / 368
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
111amnon high in rectum caecum ileum colon compared to rumen ruminant reticulum omasum in mongolian sheep ovis aries china 2017-04-09v4No1 / 464
160amnoncommon in wastewater treatment plant effluent in autumn in china (common autumn, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 469
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752

Problems / suggestions? Please email info AT dbbact DOT org