Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGTGACTGCATTGGAAACTGTTTTGCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.484848
adult0.405198
feces0.404160
child0.181568
china0.173169
city0.169014
united states of america0.143178
obsolete_juvenile stage0.123529
control0.119565
jiangsu province0.105263
LOWER IN crohn's disease0.101010
sus scrofa0.078431
pig0.078431
age 50-60 years0.062500
nanning city prefecture0.062500
age 60-790.062500
age 30-500.062500
biopsy0.061538
india0.060606
rectum0.060606
female0.060302
rural community0.059701
kingdom of spain0.057143
infant0.051282
farm0.048780
metabolic syndrome0.043011
toronto0.042553
nanchang city prefecture0.042553
thailand0.042553
age >940.042553
glasgow0.042553
small village0.042553
age 130.042553
LOWER IN age < 1 year0.042553
corn and soybean diet0.042553
age 4-7 weeks0.042553
weaned0.042553
wastewater treatment plant0.042553
chuquisaca department0.042553
age 5-13 years0.042553
LOWER IN infant0.042105
LOWER IN rural community0.042105
state of oklahoma0.041667
south america0.041667
jiangxi province0.041667
kingdom of denmark0.041667
state of michigan0.041237
LOWER IN ulcerative colitis0.041237
high bmi0.040816
biopsy site0.040816
juvenile organism0.040816
ileum0.040816
bolivia0.040816
united kingdom0.040404
LOWER IN female0.040000
czech republic0.040000
hospital0.039216
belgium0.039216
diarrhea0.038462
colon0.037037
male0.036697
age0.036697
caecum0.036036
australia0.033333
salmonella gastroenteritis0.021739
non c. diff diarrhea0.021739
LOWER IN clostridium difficile intestinal infectious disease0.021739
zambia0.021739
papio kindae0.021739
kinda baboon0.021739
low human contact0.021739
new york county0.021739
LOWER IN chronic fatigue syndrome0.021739
jordan0.021739
age 17-290.021739
LOWER IN nephrolithiasis0.021739
age 200.021739
LOWER IN egypt0.021739
metabolic syndrome x0.021739
hmong0.021739
azerbaijan0.021739
age 8-120.021739
age 3-60.021739
lima0.021739
shantytown0.021739
mild0.021739
LOWER IN severe0.021739
gangcha region0.021739
LOWER IN gannan tibetan autonomous prefecture0.021739
irritable bowel syndrome0.021739
myanmar0.021739
karen0.021739
age 13-140.021739
jinhua city prefecture0.021739
jinhua pig0.021739
farm 20.021739
LOWER IN farm 10.021739
oslo0.021739
age 30-400.021739
el salvador0.021739
Fraction of dbbact annotations with this term covered by the query
TermScore
metabolic syndrome0.666667
LOWER IN crohn's disease0.555556
toronto0.500000
salmonella gastroenteritis0.500000
non c. diff diarrhea0.500000
LOWER IN clostridium difficile intestinal infectious disease0.500000
zambia0.500000
papio kindae0.500000
kinda baboon0.500000
low human contact0.500000
new york county0.500000
LOWER IN chronic fatigue syndrome0.500000
jordan0.500000
age 17-290.500000
age 50-60 years0.500000
nanning city prefecture0.500000
LOWER IN nephrolithiasis0.500000
age 200.500000
LOWER IN egypt0.500000
metabolic syndrome x0.500000
nanchang city prefecture0.500000
thailand0.500000
hmong0.500000
azerbaijan0.500000
age 8-120.500000
age 3-60.500000
lima0.500000
shantytown0.500000
mild0.500000
LOWER IN severe0.500000
age 60-790.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
age 30-500.500000
irritable bowel syndrome0.500000
age >940.500000
glasgow0.500000
myanmar0.500000
karen0.500000
age 13-140.500000
jinhua city prefecture0.500000
jinhua pig0.500000
farm 20.500000
LOWER IN farm 10.500000
oslo0.500000
age 30-400.500000
el salvador0.500000
small village0.500000
LOWER IN peru0.500000
LOWER IN tunapuco0.500000
estonia0.500000
LOWER IN russia0.500000
age 130.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
low income0.500000
LOWER IN sewer0.500000
LOWER IN wastewater treatment plant0.500000
spondylitis0.500000
spondyloarthritis0.500000
LOWER IN age >940.500000
atherosclerosis0.500000
nephrolithiasis0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
corn and soybean diet0.500000
age 4-7 weeks0.500000
weaned0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
LOWER IN short bowel syndrome0.500000
sea urchin0.500000
artificial seawater0.500000
africa0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
wastewater treatment plant0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
sigmoid colon0.500000
children0.500000
mongolian sheep0.500000
age one year0.500000
LOWER IN age one month0.500000
bilbao0.500000
estuary0.500000
estuary water0.500000
salinity <5 ppt0.500000
LOWER IN salinity >20 ppt0.500000
LOWER IN forearm0.500000
LOWER IN arm0.500000
chuquisaca department0.500000
age 5-13 years0.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
LOWER IN age 2-4 weeks0.500000
LOWER IN suckling0.500000
LOWER IN preweaned0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.888889
feces0.888889
adult0.455556
united states of america0.255556
china0.255556
control0.166667
child0.122222
city0.111111
obsolete_juvenile stage0.077778
jiangsu province0.066667
LOWER IN crohn's disease0.055556
female0.044444
sus scrofa0.044444
pig0.044444
age 50-60 years0.033333
nanning city prefecture0.033333
biopsy0.033333
age 60-790.033333
age 30-500.033333
kingdom of spain0.033333
farm0.033333
infant0.033333
india0.033333
rural community0.033333
rectum0.033333
toronto0.022222
male0.022222
LOWER IN female0.022222
diarrhea0.022222
australia0.022222
hospital0.022222
high bmi0.022222
state of michigan0.022222
metabolic syndrome0.022222
nanchang city prefecture0.022222
thailand0.022222
biopsy site0.022222
czech republic0.022222
belgium0.022222
state of oklahoma0.022222
LOWER IN ulcerative colitis0.022222
age >940.022222
glasgow0.022222
LOWER IN infant0.022222
small village0.022222
united kingdom0.022222
LOWER IN rural community0.022222
age 130.022222
juvenile organism0.022222
age0.022222
LOWER IN age < 1 year0.022222
south america0.022222
corn and soybean diet0.022222
age 4-7 weeks0.022222
weaned0.022222
jiangxi province0.022222
kingdom of denmark0.022222
ileum0.022222
wastewater treatment plant0.022222
caecum0.022222
colon0.022222
chuquisaca department0.022222
bolivia0.022222
age 5-13 years0.022222
salmonella gastroenteritis0.011111
non c. diff diarrhea0.011111
LOWER IN clostridium difficile intestinal infectious disease0.011111
LOWER IN low bmi0.011111
zambia0.011111
papio kindae0.011111
wild0.011111
monkey0.011111
kinda baboon0.011111
low human contact0.011111
LOWER IN human contact0.011111
new york county0.011111
LOWER IN chronic fatigue syndrome0.011111
jordan0.011111
LOWER IN hiv infection0.011111
age 17-290.011111
LOWER IN nephrolithiasis0.011111
state of colorado0.011111
msw0.011111
heterosexual0.011111
italy0.011111
obesity0.011111
state of arizona0.011111
age 200.011111
LOWER IN egypt0.011111
metabolic syndrome x0.011111
hmong0.011111
azerbaijan0.011111
right colon0.011111
state of california0.011111
age 8-120.011111
age 3-60.011111
lima0.011111
shantytown0.011111
mild0.011111
LOWER IN severe0.011111
Exp. ID User ID Description Date Region Flag Sequences
10amnon high in male compared to female in homo sapiens feces toronto 2016-10-27v4No1 / 11
390amnonhighfreq homo sapiens, feces, diarrhea, australia, hospital, salmonella gastroenteritis2018-11-04v4No1 / 20
390amnonlower in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in non c. diff diarrhea compared to clostridium difficile intestinal infectious disease in homo sapiens feces australia hospital diarrhea )2018-11-04v4No1 / 23
293amnonlower in lean participants in human feces ( high in high bmi compared to low bmi in united states of america feces adult homo sapiens )2018-02-07v4No1 / 29
411amnonlower in wild baboons feeding on discarded human foods ( high in low human contact compared to human contact in zambia feces papio kindae wild monkey kinda baboon )2018-11-23v4No1 / 33
12amnon high in control compared to chronic fatigue syndrome in homo sapiens feces new york county 2016-11-02v4No1 / 35
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
22amnon high in control compared to hiv infection in united states of america feces homo sapiens 2016-11-28v4No1 / 70
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in homo sapiens feces adult age 50-60 years china nanning city prefecture )2018-01-27v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
247amnoncommon homo sapiens, italy, feces, obesity, high bmi2017-11-21v4No1 / 85
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
428amnoncommon homo sapiens, adult, feces, china, nanchang city prefecture, control2018-12-09v4No1 / 93
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
532amnoncommon control, adult, czech republic, feces, homo sapiens2019-07-21v1No1 / 98
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 8-122018-12-30v4No1 / 106
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 3-62018-12-30v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to ulcerative colitis severe in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
438amnoncommon feces, homo sapiens, china, age 60-79, adult, jiangsu province2018-12-30v4No1 / 111
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, china, jiangsu province, age 30-50, adult2018-12-30v4No1 / 115
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
438amnoncommon feces, homo sapiens, china, age >94, jiangsu province, adult2018-12-30v4No1 / 121
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to crohn's disease obsolete_juvenile stage child in glasgow feces homo sapiens )2017-02-26v4No1 / 125
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
438amnoncommon homo sapiens, feces, china, jiangsu province, age 13-142018-12-30v4No1 / 134
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 2 compared to farm 1 in sus scrofa pig jinhua city prefecture china jinhua pig feces farm )2018-12-06v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens china adult feces 2018-02-05v4No1 / 161
290amnoncommon homo sapiens, feces, china, adult, city2018-02-01v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 188
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
312amnoncommon feces, homo sapiens, french republic, adult, spondylitis, spondyloarthritis2018-04-09v4No1 / 197
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, china, adult, small village, rural community2018-02-01v4No1 / 218
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, nephrolithiasis)2018-01-27v4No1 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, control)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces china nanchang city prefecture 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common corn and soybean diet, age 4-7 weeks, weaned, jiangxi province, farm, china, feces, sus scrofa, pig)2019-07-02v3No1 / 288
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
299amnon high in cancer mouth neoplasm compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
532amnon high in control compared to short bowel syndrome in adult czech republic feces homo sapiens 2019-07-21v1No1 / 334
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
111amnon high in rectum caecum ileum colon compared to rumen ruminant reticulum omasum in mongolian sheep china ovis aries 2017-04-09v4No1 / 464
160amnoncommon in wastewater treatment plant effluent in autumn in china (common china, autumn, wastewater treatment plant, effluent)2017-07-12v4No1 / 469
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water bilbao estuary estuary water 2019-03-20v4No1 / 592
517amnon high in feces compared to forearm arm skin in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in corn and soybean diet age 4-7 weeks weaned compared to age 2-4 weeks suckling preweaned in jiangxi province farm china feces sus scrofa pig )2019-07-02v3No1 / 681
517amnon high in feces compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 752

Problems / suggestions? Please email info AT dbbact DOT org