Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGATGCAAGTCTGAAGTGAAATACCCGGGCTCAACCTGGGAACTGCTTTGGAAACTGTATGGCTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.463480
feces0.388824
adult0.361949
child0.164589
rural community0.164234
china0.161874
united states of america0.142206
obsolete_juvenile stage0.141593
sus scrofa0.139130
pig0.139130
control0.137334
united kingdom0.096774
infant0.083682
small village0.078176
africa0.076190
himalayas0.076190
india0.076190
nepal0.073394
age0.068966
caecum0.065789
city0.061069
madagascar0.058252
antananarivo0.058252
thailand0.058252
biopsy site0.058252
left colon0.058252
state of michigan0.057692
biopsy0.057416
right colon0.057416
LOWER IN crohn's disease0.056604
rectum0.054299
state of tennessee0.053571
zoological garden0.049587
farm0.045627
female0.040956
taiwan0.039604
taipei city0.039604
age 30 days0.039604
dairy0.039604
age 19-240.039604
LOWER IN central african republic0.039604
LOWER IN bangui0.039604
oslo0.039604
age 30-400.039604
cron diet0.039604
el salvador0.039604
age 130.039604
LOWER IN age < 1 year0.039604
age 30-500.039604
age 60-790.039604
LOWER IN age >940.039604
age 50-60 years0.039604
nanning city prefecture0.039604
weaned0.039604
age 4-7 weeks0.039604
corn and soybean diet0.039604
hunter gatherer0.039604
wastewater treatment plant0.039604
chuquisaca department0.039604
LOWER IN infant0.039216
LOWER IN child0.038835
caloric restriction diet0.038835
jiangxi province0.038835
kingdom of denmark0.038835
age 5-13 years0.038835
juvenile organism0.038095
LOWER IN united states of america0.038095
LOWER IN duodenum0.038095
bolivia0.038095
duodenum0.037736
ovis aries0.036697
belgium0.036036
kingdom of norway0.035398
italy0.034188
kingdom of spain0.034188
colon0.029630
LOWER IN schizophrenia0.020202
LOWER IN centenerians0.020202
jordan0.020202
LOWER IN type i diabetes mellitus0.020202
guangzhou city prefecture0.020202
LOWER IN stroke0.020202
salmonella gastroenteritis0.020202
LOWER IN insomnia0.020202
tharu0.020202
agrarian0.020202
raute0.020202
age 17-290.020202
raji0.020202
hmong0.020202
chepang0.020202
intestinal contents0.020202
commonwealth of pennsylvania0.020202
LOWER IN inflammatory bowel disease0.020202
LOWER IN irritable bowel syndrome0.020202
myanmar0.020202
karen0.020202
toronto0.020202
physical activity0.020202
LOWER IN little physical activity0.020202
Fraction of dbbact annotations with this term covered by the query
TermScore
small village0.750000
rural community0.714286
LOWER IN schizophrenia0.500000
LOWER IN centenerians0.500000
jordan0.500000
obsolete_juvenile stage0.500000
LOWER IN type i diabetes mellitus0.500000
guangzhou city prefecture0.500000
LOWER IN stroke0.500000
salmonella gastroenteritis0.500000
LOWER IN insomnia0.500000
africa0.500000
madagascar0.500000
antananarivo0.500000
himalayas0.500000
tharu0.500000
agrarian0.500000
raute0.500000
age 17-290.500000
taiwan0.500000
taipei city0.500000
raji0.500000
age 30 days0.500000
dairy0.500000
thailand0.500000
hmong0.500000
biopsy site0.500000
chepang0.500000
age 19-240.500000
intestinal contents0.500000
LOWER IN central african republic0.500000
LOWER IN bangui0.500000
commonwealth of pennsylvania0.500000
LOWER IN inflammatory bowel disease0.500000
left colon0.500000
LOWER IN irritable bowel syndrome0.500000
oslo0.500000
age 30-400.500000
myanmar0.500000
karen0.500000
cron diet0.500000
toronto0.500000
physical activity0.500000
LOWER IN little physical activity0.500000
el salvador0.500000
age<17 years0.500000
LOWER IN age 1-3 weeks0.500000
estonia0.500000
LOWER IN russia0.500000
age 130.500000
india0.500000
low anterior resection0.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
age 30-500.500000
age 60-790.500000
LOWER IN age >940.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
soldiers0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
age 1-20.500000
LOWER IN age 0-10.500000
male0.500000
nanchang city prefecture0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
LOWER IN lima0.500000
LOWER IN shantytown0.500000
hadza0.500000
hunter gatherer0.500000
heavy metal0.500000
macaque0.500000
wastewater treatment plant0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
chlorocebus aethiops0.500000
grivet monkey0.500000
tunapuco0.500000
LOWER IN state of oklahoma0.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
age one year0.500000
LOWER IN age one month0.500000
LOWER IN age <1 year0.500000
chuquisaca department0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
LOWER IN preweaned0.500000
LOWER IN suckling0.500000
LOWER IN age 2-4 weeks0.500000
LOWER IN mouth mucosa0.500000
sus scrofa0.444444
pig0.444444
Fraction of annotations for the query sequences containing the term
TermScore
feces0.845361
homo sapiens0.835052
adult0.402062
united states of america0.268041
china0.195876
control0.175258
child0.113402
rural community0.092784
obsolete_juvenile stage0.082474
sus scrofa0.082474
pig0.082474
united kingdom0.061856
caecum0.051546
infant0.051546
africa0.041237
nepal0.041237
himalayas0.041237
city0.041237
small village0.041237
india0.041237
age0.041237
female0.030928
madagascar0.030928
antananarivo0.030928
state of michigan0.030928
rectum0.030928
thailand0.030928
biopsy0.030928
biopsy site0.030928
right colon0.030928
LOWER IN crohn's disease0.030928
left colon0.030928
farm0.030928
zoological garden0.030928
state of tennessee0.030928
taiwan0.020619
taipei city0.020619
ovis aries0.020619
age 30 days0.020619
italy0.020619
dairy0.020619
colon0.020619
age 19-240.020619
duodenum0.020619
LOWER IN central african republic0.020619
LOWER IN bangui0.020619
LOWER IN child0.020619
belgium0.020619
kingdom of spain0.020619
kingdom of norway0.020619
oslo0.020619
age 30-400.020619
cron diet0.020619
caloric restriction diet0.020619
LOWER IN infant0.020619
el salvador0.020619
age 130.020619
juvenile organism0.020619
LOWER IN age < 1 year0.020619
age 30-500.020619
age 60-790.020619
LOWER IN age >940.020619
age 50-60 years0.020619
nanning city prefecture0.020619
jiangxi province0.020619
weaned0.020619
age 4-7 weeks0.020619
corn and soybean diet0.020619
hunter gatherer0.020619
kingdom of denmark0.020619
LOWER IN united states of america0.020619
LOWER IN duodenum0.020619
wastewater treatment plant0.020619
age 5-13 years0.020619
bolivia0.020619
chuquisaca department0.020619
LOWER IN schizophrenia0.010309
sichuan province0.010309
LOWER IN centenerians0.010309
jordan0.010309
LOWER IN type i diabetes mellitus0.010309
LOWER IN diabetes mellitus0.010309
guangzhou city prefecture0.010309
LOWER IN stroke0.010309
commonwealth of virginia0.010309
LOWER IN systemic lupus erythematosus0.010309
LOWER IN male0.010309
south korea0.010309
australia0.010309
hospital0.010309
salmonella gastroenteritis0.010309
diarrhea0.010309
tibet autonomous region0.010309
tibetan plateau0.010309
LOWER IN insomnia0.010309
tharu0.010309
agrarian0.010309
raute0.010309
age 17-290.010309
state of california0.010309
Exp. ID User ID Description Date Region Flag Sequences
502amnon high in control compared to schizophrenia in homo sapiens feces adult united states of america 2019-03-12v4No1 / 14
36amnonhigher in adults compared to centenarians ( high in adult compared to centenerians in homo sapiens feces sichuan province )2016-12-06v4No1 / 16
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces jordan child obsolete_juvenile stage 2018-08-30v4No1 / 21
333amnonlower in stroke patients compared to healthy controls ( high in control compared to stroke in homo sapiens feces guangzhou city prefecture adult china )2018-05-15v4No1 / 30
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 39
131amnon high in female compared to male in homo sapiens feces south korea 2017-04-16v4No1 / 55
390amnoncommon homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v4No1 / 55
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
566amnon high in control compared to insomnia in adult china feces homo sapiens 2019-11-24v4No1 / 71
425amnoncommon homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 73
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
74amnoncommon united states of america, feces, homo sapiens2017-02-27v4No1 / 76
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v4No1 / 76
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
529amnoncommon homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v3No1 / 79
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v4No1 / 81
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 94
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 97
363amnon high in caecum colon rectum compared to rumen ruminant reticulum omasum in ovis aries age 30 days obsolete_juvenile stage italy dairy 2018-08-29v4No1 / 101
438amnoncommon homo sapiens, feces, age 19-24, china2018-12-30v4No1 / 101
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in sus scrofa pig caecum united kingdom )2017-11-26v4No1 / 103
425amnon high in antananarivo madagascar compared to central african republic bangui in homo sapiens africa child duodenum 2018-12-08v4No1 / 103
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
294amnon high in control compared to irritable bowel syndrome in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 121
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in homo sapiens feces united states of america )2017-12-04v4No1 / 140
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon adult, homo sapiens, china, feces2019-11-24v4No1 / 221
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in age 19-24 soldiers compared to adult age 30-50 age 60-79 age >94 in homo sapiens feces china )2018-12-30v4No1 / 238
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
190amnon high in dry season compared to wet season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 311
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
175amnonhigher in winter compared to summer in heavy metal contaminated soils in china ( high in winter compared to summer in soil heavy metal china )2017-07-29v4No1 / 337
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 345
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
160amnoncommon in wastewater treatment plant effluent in autumn in china (common autumn, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 469
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752

Problems / suggestions? Please email info AT dbbact DOT org