Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGATGCAAGTCTGAAGTGAAATACCCGGGCTCAACCTGGGAACTGCTTTGGAAACTGTATGGCTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.475904
feces0.393120
adult0.361823
child0.174373
rural community0.167286
china0.151233
united states of america0.145885
obsolete_juvenile stage0.144144
sus scrofa0.141593
pig0.141593
control0.133205
united kingdom0.098361
infant0.085106
small village0.079734
africa0.077670
himalayas0.077670
india0.077670
nepal0.074766
age0.070175
caecum0.067797
city0.062016
madagascar0.059406
antananarivo0.059406
thailand0.059406
biopsy site0.059406
left colon0.059406
state of michigan0.058824
biopsy0.058537
right colon0.058537
LOWER IN crohn's disease0.057692
rectum0.055300
zoological garden0.054545
state of tennessee0.054545
farm0.046875
female0.041958
taipei city0.040404
taiwan0.040404
age 30 days0.040404
dairy0.040404
age 19-240.040404
LOWER IN central african republic0.040404
LOWER IN bangui0.040404
oslo0.040404
age 30-400.040404
cron diet0.040404
el salvador0.040404
age 130.040404
LOWER IN age < 1 year0.040404
age 30-500.040404
age 60-790.040404
LOWER IN age >940.040404
age 50-60 years0.040404
nanning city prefecture0.040404
corn and soybean diet0.040404
age 4-7 weeks0.040404
weaned0.040404
hunter gatherer0.040404
wastewater treatment plant0.040404
chuquisaca department0.040404
age 5-13 years0.040404
LOWER IN infant0.040000
LOWER IN child0.039604
caloric restriction diet0.039604
jiangxi province0.039604
kingdom of denmark0.039604
LOWER IN duodenum0.039216
duodenum0.038835
juvenile organism0.038835
LOWER IN united states of america0.038835
bolivia0.038835
ovis aries0.037383
belgium0.037383
kingdom of norway0.036036
italy0.035398
kingdom of spain0.034783
colon0.030534
LOWER IN schizophrenia0.020619
LOWER IN centenerians0.020619
jordan0.020619
LOWER IN type i diabetes mellitus0.020619
guangzhou city prefecture0.020619
LOWER IN stroke0.020619
salmonella gastroenteritis0.020619
tharu0.020619
agrarian0.020619
raute0.020619
age 17-290.020619
raji0.020619
hmong0.020619
chepang0.020619
intestinal contents0.020619
commonwealth of pennsylvania0.020619
LOWER IN inflammatory bowel disease0.020619
LOWER IN irritable bowel syndrome0.020619
myanmar0.020619
karen0.020619
toronto0.020619
physical activity0.020619
LOWER IN little physical activity0.020619
age<17 years0.020619
Fraction of dbbact annotations with this term covered by the query
TermScore
small village0.750000
rural community0.714286
LOWER IN schizophrenia0.500000
LOWER IN centenerians0.500000
jordan0.500000
obsolete_juvenile stage0.500000
LOWER IN type i diabetes mellitus0.500000
guangzhou city prefecture0.500000
LOWER IN stroke0.500000
salmonella gastroenteritis0.500000
africa0.500000
madagascar0.500000
antananarivo0.500000
himalayas0.500000
tharu0.500000
agrarian0.500000
raute0.500000
age 17-290.500000
taipei city0.500000
taiwan0.500000
raji0.500000
age 30 days0.500000
dairy0.500000
thailand0.500000
hmong0.500000
biopsy site0.500000
chepang0.500000
age 19-240.500000
intestinal contents0.500000
LOWER IN central african republic0.500000
LOWER IN bangui0.500000
commonwealth of pennsylvania0.500000
LOWER IN inflammatory bowel disease0.500000
left colon0.500000
LOWER IN irritable bowel syndrome0.500000
oslo0.500000
age 30-400.500000
myanmar0.500000
karen0.500000
cron diet0.500000
toronto0.500000
physical activity0.500000
LOWER IN little physical activity0.500000
el salvador0.500000
age<17 years0.500000
LOWER IN age 1-3 weeks0.500000
estonia0.500000
LOWER IN russia0.500000
age 130.500000
india0.500000
low anterior resection0.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
age 30-500.500000
age 60-790.500000
LOWER IN age >940.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
soldiers0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
age 1-20.500000
LOWER IN age 0-10.500000
nanchang city prefecture0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
corn and soybean diet0.500000
age 4-7 weeks0.500000
weaned0.500000
LOWER IN lima0.500000
LOWER IN shantytown0.500000
hadza0.500000
hunter gatherer0.500000
heavy metal0.500000
macaque0.500000
wastewater treatment plant0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
chlorocebus aethiops0.500000
grivet monkey0.500000
tunapuco0.500000
LOWER IN state of oklahoma0.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
age one year0.500000
LOWER IN age one month0.500000
LOWER IN age <1 year0.500000
LOWER IN forearm0.500000
LOWER IN arm0.500000
chuquisaca department0.500000
age 5-13 years0.500000
LOWER IN age 2-4 weeks0.500000
LOWER IN suckling0.500000
LOWER IN preweaned0.500000
LOWER IN mouth mucosa0.500000
sus scrofa0.444444
pig0.444444
state of michigan0.428571
Fraction of annotations for the query sequences containing the term
TermScore
feces0.842105
homo sapiens0.831579
adult0.389474
united states of america0.273684
china0.178947
control0.168421
child0.115789
rural community0.094737
obsolete_juvenile stage0.084211
sus scrofa0.084211
pig0.084211
united kingdom0.063158
caecum0.052632
infant0.052632
africa0.042105
nepal0.042105
himalayas0.042105
city0.042105
small village0.042105
india0.042105
age0.042105
female0.031579
madagascar0.031579
antananarivo0.031579
state of michigan0.031579
rectum0.031579
thailand0.031579
biopsy0.031579
biopsy site0.031579
right colon0.031579
LOWER IN crohn's disease0.031579
left colon0.031579
farm0.031579
zoological garden0.031579
state of tennessee0.031579
taipei city0.021053
taiwan0.021053
ovis aries0.021053
age 30 days0.021053
italy0.021053
dairy0.021053
colon0.021053
age 19-240.021053
duodenum0.021053
LOWER IN central african republic0.021053
LOWER IN bangui0.021053
LOWER IN child0.021053
belgium0.021053
kingdom of spain0.021053
kingdom of norway0.021053
oslo0.021053
age 30-400.021053
cron diet0.021053
caloric restriction diet0.021053
LOWER IN infant0.021053
el salvador0.021053
age 130.021053
juvenile organism0.021053
LOWER IN age < 1 year0.021053
age 30-500.021053
age 60-790.021053
LOWER IN age >940.021053
age 50-60 years0.021053
nanning city prefecture0.021053
corn and soybean diet0.021053
age 4-7 weeks0.021053
weaned0.021053
jiangxi province0.021053
hunter gatherer0.021053
kingdom of denmark0.021053
LOWER IN united states of america0.021053
LOWER IN duodenum0.021053
wastewater treatment plant0.021053
chuquisaca department0.021053
bolivia0.021053
age 5-13 years0.021053
LOWER IN schizophrenia0.010526
sichuan province0.010526
LOWER IN centenerians0.010526
jordan0.010526
LOWER IN type i diabetes mellitus0.010526
LOWER IN diabetes mellitus0.010526
guangzhou city prefecture0.010526
LOWER IN stroke0.010526
commonwealth of virginia0.010526
LOWER IN systemic lupus erythematosus0.010526
south korea0.010526
LOWER IN male0.010526
diarrhea0.010526
australia0.010526
hospital0.010526
salmonella gastroenteritis0.010526
tibet autonomous region0.010526
tibetan plateau0.010526
tharu0.010526
agrarian0.010526
raute0.010526
age 17-290.010526
state of california0.010526
raji0.010526
Exp. ID User ID Description Date Region Flag Sequences
502amnon high in control compared to schizophrenia in homo sapiens feces adult united states of america 2019-03-12v4No1 / 14
36amnonhigher in adults compared to centenarians ( high in adult compared to centenerians in homo sapiens feces sichuan province )2016-12-06v4No1 / 16
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces jordan child obsolete_juvenile stage 2018-08-30v4No1 / 21
333amnonlower in stroke patients compared to healthy controls ( high in control compared to stroke in homo sapiens feces china guangzhou city prefecture adult )2018-05-15v4No1 / 30
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 39
131amnon high in female compared to male in homo sapiens feces south korea 2017-04-16v4No1 / 55
390amnoncommon homo sapiens, feces, diarrhea, australia, hospital, salmonella gastroenteritis2018-11-04v4No1 / 55
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
425amnoncommon homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 73
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
74amnoncommon united states of america, feces, homo sapiens2017-02-27v4No1 / 76
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v4No1 / 76
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
529amnoncommon control, adult, taipei city, taiwan, feces, homo sapiens2019-07-18v3No1 / 79
292amnoncommon homo sapiens, china, adult, feces, control2018-02-05v4No1 / 81
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 94
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 97
363amnon high in caecum colon rectum compared to rumen ruminant reticulum omasum in ovis aries age 30 days obsolete_juvenile stage italy dairy 2018-08-29v4No1 / 101
438amnoncommon homo sapiens, feces, china, age 19-242018-12-30v4No1 / 101
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in sus scrofa pig united kingdom caecum )2017-11-26v4No1 / 103
425amnon high in antananarivo madagascar compared to central african republic bangui in homo sapiens africa child duodenum 2018-12-08v4No1 / 103
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
294amnon high in control compared to irritable bowel syndrome in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 121
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in homo sapiens feces united states of america )2017-12-04v4No1 / 140
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
290amnoncommon homo sapiens, feces, china, adult, city2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common low anterior resection, adult, taipei city, taiwan, feces, homo sapiens)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
290amnoncommon homo sapiens, feces, china, adult, small village, rural community2018-02-01v4No1 / 218
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in age 19-24 soldiers compared to adult age 30-50 age 60-79 age >94 in homo sapiens feces china )2018-12-30v4No1 / 238
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, nephrolithiasis)2018-01-27v4No1 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces india infant )2016-12-19v4No1 / 253
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, control)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces china nanchang city prefecture 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common corn and soybean diet, age 4-7 weeks, weaned, jiangxi province, farm, china, feces, sus scrofa, pig)2019-07-02v3No1 / 288
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
190amnon high in dry season compared to wet season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 311
299amnon high in cancer mouth neoplasm compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
175amnonhigher in winter compared to summer in heavy metal contaminated soils in china ( high in winter compared to summer in china soil heavy metal )2017-07-29v4No1 / 337
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 345
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
256amnoncommon sus scrofa, pig, united kingdom, duodenum, jejunum, ileum2017-11-26v4No1 / 380
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
160amnoncommon in wastewater treatment plant effluent in autumn in china (common china, autumn, wastewater treatment plant, effluent)2017-07-12v4No1 / 469
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
256amnoncommon sus scrofa, pig, united kingdom, caecum, right colon, left colon2017-11-26v4No1 / 490
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
517amnon high in feces compared to forearm arm skin in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 606
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in corn and soybean diet age 4-7 weeks weaned compared to age 2-4 weeks suckling preweaned in jiangxi province farm china feces sus scrofa pig )2019-07-02v3No1 / 681
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 752

Problems / suggestions? Please email info AT dbbact DOT org