Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGCAGCAAGTCTGATGTGAAAGGCAGGGGCTTAACCCCTGGACTGCATTGGAAACTGTTGAGCTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
feces0.237923
homo sapiens0.228312
adult0.224433
captive0.139211
italy0.136054
monkey0.126888
kingdom of spain0.125984
zoological garden0.125984
new zealand0.103093
female0.095050
china0.092105
lake hulun0.084211
obesity0.077670
high bmi0.076677
mongolia0.074766
sus scrofa0.073846
pig0.073846
sweden0.065789
age 30-500.065574
estonia0.065574
vulpes corsac0.064516
corsac fox0.064516
rhesus macaque0.064516
taiwan0.064516
europe0.064516
russia0.063158
farm0.059850
msw0.058824
heterosexual0.058824
macaca mulatta0.057143
cat0.055556
research facility0.054781
felis catus0.052632
canada0.052083
winter0.051613
hiv infection0.051282
colon0.050633
germany0.049383
infant0.048780
control0.048667
sigmoid colon0.044444
papio anubis0.044444
terminal ileum0.043956
zhengzhou city prefecture0.043956
municipality of yogyakarta0.043956
indonesia0.043956
taipei city0.043956
pemba island0.043956
jinzhou city prefecture0.043956
age 8 months0.043956
weaned0.043956
age 4-7 weeks0.043956
corn and soybean diet0.043956
african lion safari0.043956
LOWER IN cameroon0.043956
toronto zoo0.043956
wild0.043716
formula fed0.043011
age < 3 years0.043011
biopsy0.042553
gay0.042105
tanzania0.042105
LOWER IN finland0.042105
jiangxi province0.042105
lamb0.042105
LOWER IN low bmi0.041667
guangzhou city prefecture0.041237
jejunum0.041237
age 6 weeks0.041237
pregnancy0.040404
msm0.040404
homosexual0.040404
LOWER IN child0.040404
small intestine0.040404
gorilla gorilla0.040404
LOWER IN wild0.040000
skin0.039683
united states of america0.039184
city0.037736
sheep0.037383
duodenum0.036697
ovis aries0.036036
south korea0.035398
male0.034843
chicken0.033613
gallus gallus0.033613
israel0.033058
child0.032520
LOWER IN vulpes vulpes0.022472
LOWER IN red fox0.022472
active disease0.022472
LOWER IN state of california0.022472
bihar state0.022472
autoimmune hepatitis0.022472
midwest region0.022472
vegetarian diet0.022472
gestational age 8-12 weeks0.022472
chengdu city prefecture0.022472
santa catarina state0.022472
age 1-18 years0.022472
Fraction of dbbact annotations with this term covered by the query
TermScore
sigmoid colon0.666667
age 30-500.666667
estonia0.666667
papio anubis0.666667
LOWER IN vulpes vulpes0.500000
LOWER IN red fox0.500000
vulpes corsac0.500000
corsac fox0.500000
lake hulun0.500000
active disease0.500000
new zealand0.500000
LOWER IN state of california0.500000
rhesus macaque0.500000
terminal ileum0.500000
bihar state0.500000
autoimmune hepatitis0.500000
zhengzhou city prefecture0.500000
midwest region0.500000
vegetarian diet0.500000
taiwan0.500000
gestational age 8-12 weeks0.500000
chengdu city prefecture0.500000
santa catarina state0.500000
municipality of yogyakarta0.500000
indonesia0.500000
age 1-18 years0.500000
sri lanka0.500000
taipei city0.500000
municipality of reus0.500000
pemba island0.500000
novosibirsk0.500000
LOWER IN age 2-4 years0.500000
LOWER IN age 4 months0.500000
LOWER IN age 7 months0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
jinzhou city prefecture0.500000
gallbladder0.500000
bile0.500000
cholelithiasis0.500000
red fox0.500000
vulpes vulpes0.500000
low anterior resection0.500000
age 8 months0.500000
sus scrofa domesticus0.500000
shantytown0.500000
lima0.500000
LOWER IN el salado0.500000
south american tapir0.500000
tapirus terrestris0.500000
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
african lion safari0.500000
LOWER IN cameroon0.500000
LOWER IN central chimpanzee0.500000
europe0.500000
pan troglodytes verus0.500000
macropus rufus0.500000
red kangaroo0.500000
zambia0.500000
baboon0.500000
papio0.500000
LOWER IN papio kindae0.500000
LOWER IN papio ursinus0.500000
toronto zoo0.500000
camel0.500000
camelus dromedarius0.500000
rattus rattus0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
children0.500000
LOWER IN alpine pasture0.500000
LOWER IN alpine0.500000
lowland farm0.500000
lowland pasture0.500000
cow milk (raw)0.500000
cow milk (fluid)0.500000
milk0.500000
age 60-790.500000
age >940.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
LOWER IN preweaned0.500000
LOWER IN suckling0.500000
LOWER IN age 2-4 weeks0.500000
african wild ass0.500000
equus ferus0.500000
LOWER IN age 6 months0.500000
russia0.375000
pancreatic cancer0.333333
age 2-4 years0.333333
shanghai district0.333333
republic of china0.333333
rheumatoid arthritis0.333333
athlete0.333333
age 19-240.333333
osteoarthritis0.333333
madrid0.333333
Fraction of annotations for the query sequences containing the term
TermScore
feces0.839080
homo sapiens0.586207
adult0.425287
china0.160920
research facility0.126437
captive0.114943
italy0.114943
united states of america0.091954
female0.091954
kingdom of spain0.091954
zoological garden0.091954
monkey0.080460
control0.080460
new zealand0.057471
male0.057471
sweden0.057471
skin0.057471
canada0.057471
lake hulun0.045977
wild0.045977
winter0.045977
mongolia0.045977
high bmi0.045977
obesity0.045977
sus scrofa0.045977
pig0.045977
farm0.045977
vulpes corsac0.034483
corsac fox0.034483
felis catus0.034483
cat0.034483
rhesus macaque0.034483
macaca mulatta0.034483
germany0.034483
msw0.034483
heterosexual0.034483
hiv infection0.034483
age 30-500.034483
taiwan0.034483
russia0.034483
estonia0.034483
infant0.034483
europe0.034483
colon0.034483
LOWER IN low bmi0.022989
biopsy0.022989
sigmoid colon0.022989
terminal ileum0.022989
israel0.022989
zhengzhou city prefecture0.022989
child0.022989
guangzhou city prefecture0.022989
pregnancy0.022989
south korea0.022989
municipality of yogyakarta0.022989
indonesia0.022989
msm0.022989
gay0.022989
homosexual0.022989
taipei city0.022989
LOWER IN child0.022989
tanzania0.022989
pemba island0.022989
formula fed0.022989
jejunum0.022989
duodenum0.022989
small intestine0.022989
jinzhou city prefecture0.022989
chicken0.022989
gallus gallus0.022989
age < 3 years0.022989
LOWER IN finland0.022989
age 8 months0.022989
city0.022989
jiangxi province0.022989
weaned0.022989
age 4-7 weeks0.022989
corn and soybean diet0.022989
african lion safari0.022989
LOWER IN cameroon0.022989
papio anubis0.022989
LOWER IN wild0.022989
toronto zoo0.022989
gorilla gorilla0.022989
lamb0.022989
age 6 weeks0.022989
ovis aries0.022989
sheep0.022989
LOWER IN vulpes vulpes0.011494
LOWER IN red fox0.011494
rural community0.011494
small village0.011494
LOWER IN city0.011494
active disease0.011494
crohn's disease0.011494
LOWER IN state of california0.011494
state of oregon0.011494
age 3 months0.011494
pancreatic cancer0.011494
india0.011494
Exp. ID User ID Description Date Region Flag Sequences
815amnon high in vulpes corsac corsac fox compared to vulpes vulpes red fox in lake hulun wild winter mongolia feces 2021-07-04v3No1 / 15
290amnon high in rural community small village compared to city in homo sapiens feces adult china 2018-02-01v4No1 / 21
713amnoncommon active disease, crohn's disease, feces, homo sapiens2028-05-21v3No1 / 24
815amnondominant corsac fox, vulpes corsac, lake hulun, wild, winter, mongolia, feces2021-07-04v3No1 / 27
293amnonlower in lean participants in human feces ( high in high bmi compared to low bmi in united states of america feces adult homo sapiens )2018-02-07v4No1 / 29
668amnondominant new zealand, research facility, feces, felis catus, cat2020-09-26v3No1 / 29
671amnon high in state of oregon compared to state of california in age 3 months united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 38
714amnoncommon germany, biopsy, sigmoid colon, terminal ileum, homo sapiens2028-05-21v3No1 / 40
831amnoncommon pancreatic cancer, homo sapiens, feces, adult, israel2021-09-11v3No1 / 43
570amnoncommon homo sapiens, feces, india, bihar state2019-12-16v3No1 / 46
720amnoncommon autoimmune hepatitis, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 48
564amnoncommon homo sapiens, child, age 2-4 years, italy, feces, control2019-11-18v3No1 / 50
694amnoncommon china, shanghai district, obesity, adult, female, feces, homo sapiens2028-03-17v3No1 / 52
578amnoncommon homo sapiens, feces, adult, male, kingdom of spain, sweden, msw, heterosexual, hiv infection2020-01-14v3No1 / 53
707amnoncommon systemic lupus erythematosus, guangzhou city prefecture, age 30-50, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 55
745amnoncommon adult, midwest region, united states of america, feces, homo sapiens2021-02-25v3No1 / 55
720amnoncommon control, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 56
666amnoncommon homo sapiens, italy, feces2020-09-25v3No1 / 58
734amnoncommon vegetarian diet, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 60
831amnoncommon control, homo sapiens, feces, adult, israel2021-09-11v3No1 / 60
627amnoncommon feces, pregnancy, adult, female, china2020-05-16v3No1 / 61
637amnoncommon gestational age 8-12 weeks, chengdu city prefecture, china, adult, pregnancy, female, feces, homo sapiens2020-08-18v3No1 / 61
593amnoncommon homo sapiens, feces, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 62
575amnoncommon in professional martial arts athletes (common homo sapiens, feces, athlete, high physical activity, adult, china, age 19-24)2020-01-05v3No1 / 63
757amnoncommon feces, adult, santa catarina state, brazil, homo sapiens2021-03-28v3No1 / 67
574amnoncommon feces, homo sapiens, russia, adult2020-01-05v3No1 / 68
593amnoncommon homo sapiens, feces, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
723amnoncommon feces, municipality of yogyakarta, adult, female, indonesia, homo sapiens2021-01-02v3No1 / 69
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
656amnoncommon age 1-18 years, sri lanka, feces, homo sapiens2020-09-13v3No1 / 71
578amnoncommon homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, hiv infection2020-01-14v3No1 / 74
799amnoncommon in obese participant fecal samples before ketogenic diet (common obesity, high bmi, adult, estonia, feces, homo sapiens)2021-06-13v3No1 / 77
630amnoncommon madrid, kingdom of spain, feces, adult, homo sapiens2020-06-01v3No1 / 78
529amnoncommon homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v3No1 / 79
732amnoncommon municipality of reus, kingdom of spain, adult, feces, homo sapiens2021-01-11v3No1 / 79
736amnon high in adult female compared to age 1-3 years child in tanzania pemba island feces homo sapiens 2021-01-25v3No1 / 79
707amnoncommon guangzhou city prefecture, age 30-50, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 82
668amnoncommon new zealand, research facility, feces, felis catus, cat2020-09-26v3No1 / 85
680amnoncommon obesity, adult, novosibirsk, russia, feces, homo sapiens2028-03-04v3No1 / 85
723amnonlower in children age 2-4 years compared to mothers ( high in adult compared to age 2-4 years child in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 87
578amnoncommon homo sapiens, feces, adult, male, kingdom of spain, sweden, control, msw, heterosexual2020-01-14v3No1 / 92
668amnon high in age 5 years compared to age 4 months in new zealand research facility feces felis catus cat 2020-09-26v3No1 / 92
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common ketogenic diet, high bmi, estonia, adult, obesity, homo sapiens, feces)2021-06-13v3No1 / 93
736amnoncommon tanzania, pemba island, adult, female, feces, homo sapiens2021-01-25v3No1 / 95
797amnon high in age 1 year compared to age 7 months in formula fed germany infant homo sapiens feces 2021-06-13v3No1 / 106
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
578amnoncommon homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, control2020-01-14v3No1 / 132
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens united states of america feces )2017-04-11v4No1 / 139
797amnon high in child age 2 years compared to infant age 1 year in formula fed germany homo sapiens feces 2021-06-13v3No1 / 139
815amnoncommon corsac fox, vulpes corsac, lake hulun, wild, winter, mongolia, feces2021-07-04v3No1 / 146
780amnon high in jejunum duodenum small intestine compared to caecum in jinzhou city prefecture china research facility chicken gallus gallus 2021-04-28v3No1 / 153
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
815amnoncommon lake hulun, wild, winter, mongolia, red fox, vulpes vulpes, feces2021-07-04v3No1 / 160
700amnoncommon belgium, age 1 month, research facility, sus scrofa, pig, feces2028-04-01v3No1 / 164
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
671amnon high in age 8 months compared to female adult in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 182
578amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in msw heterosexual compared to homosexual gay msm in homo sapiens feces hiv infection kingdom of spain sweden adult male )2020-01-14v3No1 / 220
666amnoncommon pig, sus scrofa domesticus, italy, feces2020-09-25v3No1 / 223
780amnoncommon jinzhou city prefecture, china, research facility, chicken, gallus gallus, jejunum, duodenum, small intestine2021-04-28v3No1 / 232
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 236
666amnoncommon south american tapir, tapirus terrestris, italy, feces2020-09-25v3No1 / 242
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
666amnoncommon wild boar, sus scrofa, italy, feces2020-09-25v3No1 / 305
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
565amnoncommon skin, canada, zoological garden, captive, african lion safari, giraffa camelopardalis, giraffe2019-11-21v3No1 / 310
565amnoncommon skin, canada, farm, bos taurus, cow2019-11-21v3No1 / 318
729amnon high in europe captive zoological garden eastern chimpanzee pan troglodytes verus compared to cameroon pan troglodytes troglodytes central chimpanzee in feces monkey 2021-01-05v3No1 / 337
666amnoncommon horse, equus caballus, italy, feces2020-09-25v3No1 / 341
565amnoncommon skin, canada, macropus rufus, red kangaroo, zoological garden, captive, african lion safari2019-11-21v3No1 / 360
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
565amnoncommon skin, canada, papio anubis, olive baboon, zoological garden, captive, toronto zoo2019-11-21v3No1 / 368
551amnoncommon egypt, camel, camelus dromedarius, rumen, adult2019-08-27v3No1 / 370
666amnoncommon rattus rattus, rat, italy, feces2020-09-25v3No1 / 406
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
617amnonlower in cow milk of cows in alpine pasture compared to lowland farm ( high in lowland farm lowland pasture compared to alpine pasture alpine in farm italy cow milk (raw) cow milk (fluid) milk )2020-05-03v3No1 / 484
729amnoncommon captive, gorilla gorilla, monkey, feces, zoological garden, europe2021-01-05v3No1 / 542
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
729amnon high in captive zoological garden europe compared to wild cameroon in gorilla gorilla monkey feces 2021-01-05v3No1 / 656
565amnoncommon skin, canada, zoological garden, captive, tragelaphus oryx, eland, toronto zoo2019-11-21v3No1 / 674
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
666amnoncommon equus asinus africanus, african wild ass, feces, italy2020-09-25v3No1 / 683
666amnoncommon italy, feces, wild horse, equus ferus2020-09-25v3No1 / 715
649amnon high in colon compared to ileum in lamb age 6 weeks research facility new zealand ovis aries sheep 2020-09-07v3No1 / 897
671amnon high in age 8 months compared to age 6 months age 3 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 955
649amnon high in colon compared to jejunum duodenum in lamb age 6 weeks research facility new zealand ovis aries sheep 2020-09-07v3No1 / 1261

Problems / suggestions? Please email info AT dbbact DOT org