Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTAAGCAAGTCAGAAGTGAAAGGCTGGGGCTCAACCCCGGGACTGCTTTTGAAACTGTTTGGCTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
feces0.433467
homo sapiens0.388893
adult0.332648
china0.167018
control0.133440
united states of america0.133066
gallus gallus0.129821
chicken0.129821
captive0.123922
research facility0.118636
zoological garden0.111601
canada0.111178
caecum0.105820
italy0.104693
male0.094628
monkey0.087464
germany0.087289
macaca mulatta0.081505
female0.072186
kingdom of spain0.072072
rural community0.071263
infant0.068454
sus scrofa0.068252
pig0.068252
wild0.065753
soil0.061409
rumen0.060060
child0.056657
sheep0.055728
ovis aries0.054711
united kingdom0.054711
farm0.052562
cobb broiler chicken0.051780
rhesus macaque0.051780
pot expreiment0.051780
kingdom of denmark0.051780
agricultural field0.051780
age 35 days0.050473
age 6 weeks0.045952
african lion safari0.045603
city0.042912
small village0.039867
taiwan0.039867
LOWER IN crohn's disease0.039474
goat0.039344
capra hircus0.039344
ruminal fluid0.039344
lettuce0.039344
skin0.038977
thailand0.038585
cameroon0.033278
msm0.033003
homosexual0.033003
organic fertilization0.033003
lund0.033003
clayey till0.033003
late weichselian glaciation0.033003
rectal swab0.032733
broiler chicken0.032468
obesity0.032468
manure fertilization0.032468
loam soil0.032468
LOWER IN ileum0.032336
hiv infection0.032293
pregnancy0.031949
triticum aestivum0.031447
manured soil0.030960
bulk soil0.030488
state of california0.030030
age 1 year0.029155
colon0.028944
republic of china0.026756
estonia0.026756
peromyscus maniculatus0.026578
deer mice0.026578
algonquin provincial park0.026578
toronto zoo0.026578
hefei city prefecture0.026578
baijiu0.026578
lake hulun0.026578
LOWER IN ulcerative colitis0.026578
gay0.026578
indian rhesus macaque0.026578
cayo santiago0.026578
thyrow0.026578
bernburg0.026578
crop rotation0.026578
LOWER IN duodenum0.026403
age 3-5 weeks0.026230
province of ontario0.026230
fermentation pit mud0.026230
mud0.026230
formula fed0.026230
hispanic or latin american0.026230
haplic luvisol0.026230
cow0.026002
lamb0.025890
new zealand0.025890
puerto rico0.025890
mongolia0.025559
Fraction of dbbact annotations with this term covered by the query
TermScore
small village0.750000
taiwan0.750000
rural community0.700000
cameroon0.666667
republic of china0.666667
age 19-240.666667
estonia0.666667
village0.666667
equus asinus africanus0.666667
donkey0.666667
age 6 weeks0.600000
msw0.600000
heterosexual0.600000
LOWER IN jejunum0.600000
LOWER IN crohn's disease0.545455
alpaca0.500000
vicugna pacos0.500000
mouflon0.500000
ovis aries musimon0.500000
macropus rufus0.500000
red kangaroo0.500000
african lion safari0.500000
goat0.500000
capra hircus0.500000
peromyscus maniculatus0.500000
deer mice0.500000
algonquin provincial park0.500000
toronto zoo0.500000
LOWER IN anorexia nervosa0.500000
equus ferus0.500000
central chimpanzee0.500000
lama guanicoe0.500000
cobb broiler chicken0.500000
breast fed0.500000
europe0.500000
pan troglodytes verus0.500000
western chimpanzee0.500000
hefei city prefecture0.500000
baijiu0.500000
days 180-2700.500000
active disease0.500000
lake hulun0.500000
red fox0.500000
vulpes vulpes0.500000
feral0.500000
age 15-20 weeks0.500000
corsac fox0.500000
vulpes corsac0.500000
age<17 years0.500000
LOWER IN ulcerative colitis0.500000
type 1 diabetes mellitus0.500000
age 6-14 years0.500000
hangzhou city prefecture0.500000
type i diabetes mellitus0.500000
bihar state0.500000
short beaked common dolphin0.500000
autoimmune hepatitis0.500000
zhengzhou city prefecture0.500000
taoyuan city0.500000
salmonella gastroenteritis0.500000
vegetarian diet0.500000
gestational age 8-12 weeks0.500000
chengdu city prefecture0.500000
rhesus macaque0.500000
macaca mulatta0.500000
coronary heart disease0.500000
santa catarina state0.500000
omnivore diet0.500000
LOWER IN age 30 days0.500000
age 1-18 years0.500000
sri lanka0.500000
antananarivo0.500000
msm0.500000
gay0.500000
homosexual0.500000
antiretroviral therapy0.500000
human immunodeficiency virus infectious disease0.500000
municipality of logrono0.500000
age 17-290.500000
common bottlenose dolphin0.500000
taipei city0.500000
municipality of reus0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
LOWER IN nephrolithiasis0.500000
eidolon helvum0.500000
fruit bat0.500000
novosibirsk0.500000
age 200.500000
wild cat0.500000
felis silvestris0.500000
hmong0.500000
pemba island0.500000
5-6 hours0.500000
LOWER IN 1-2 hours0.500000
dairy goat0.500000
ruminal fluid0.500000
sciurus carolinensis0.500000
eastern gray squirrel0.500000
LOWER IN age 7 months0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.686007
homo sapiens0.474403
adult0.313993
united states of america0.163823
china0.160410
research facility0.136519
control0.116041
italy0.098976
canada0.078498
captive0.078498
gallus gallus0.078498
chicken0.078498
caecum0.068259
zoological garden0.064846
male0.064846
soil0.058020
skin0.054608
germany0.054608
monkey0.051195
female0.047782
macaca mulatta0.044369
wild0.040956
infant0.040956
kingdom of spain0.040956
rural community0.037543
sus scrofa0.037543
pig0.037543
farm0.034130
child0.034130
rumen0.034130
sheep0.030717
ovis aries0.030717
united kingdom0.030717
age 35 days0.027304
cobb broiler chicken0.027304
rhesus macaque0.027304
pot expreiment0.027304
kingdom of denmark0.027304
agricultural field0.027304
african lion safari0.023891
age 6 weeks0.023891
city0.023891
goat0.020478
capra hircus0.020478
small village0.020478
thailand0.020478
LOWER IN crohn&#39;s disease0.020478
taiwan0.020478
ruminal fluid0.020478
lettuce0.020478
colon0.017065
broiler chicken0.017065
cameroon0.017065
age 1 year0.017065
hiv infection0.017065
rectal swab0.017065
obesity0.017065
pregnancy0.017065
state of california0.017065
msm0.017065
homosexual0.017065
manure fertilization0.017065
manured soil0.017065
organic fertilization0.017065
bulk soil0.017065
LOWER IN ileum0.017065
lund0.017065
clayey till0.017065
late weichselian glaciation0.017065
loam soil0.017065
triticum aestivum0.017065
peromyscus maniculatus0.013652
deer mice0.013652
age 3-5 weeks0.013652
province of ontario0.013652
algonquin provincial park0.013652
toronto zoo0.013652
bos taurus0.013652
cow0.013652
lamb0.013652
new zealand0.013652
hefei city prefecture0.013652
baijiu0.013652
fermentation pit mud0.013652
mud0.013652
formula fed0.013652
lake hulun0.013652
winter0.013652
mongolia0.013652
LOWER IN ulcerative colitis0.013652
republic of china0.013652
sweden0.013652
hispanic or latin american0.013652
gay0.013652
estonia0.013652
indian rhesus macaque0.013652
cayo santiago0.013652
puerto rico0.013652
female organism0.013652
thyrow0.013652
Exp. ID User ID Description Date Region Flag Sequences
666amnondominant sheep, ovis aries, italy, feces2020-09-25v3No1 / 7
666amnondominant alpaca, vicugna pacos, italy, feces2020-09-25v3No1 / 7
666amnondominant mouflon, ovis aries musimon, italy, feces2020-09-25v3No1 / 8
565amnondominant skin, canada, macropus rufus, red kangaroo, zoological garden, captive, african lion safari2019-11-21v3No1 / 9
666amnondominant goat, capra hircus, italy, feces2020-09-25v3No1 / 9
537amnonhigh freq. in feces of wild caught deer mice feces (dominant feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, wild)2019-07-28v3No1 / 10
565amnondominant skin, canada, zoological garden, captive, tragelaphus oryx, eland, toronto zoo2019-11-21v3No1 / 10
2amnon high in control compared to anorexia nervosa in homo sapiens feces 2016-10-05v4No1 / 11
565amnondominant skin, canada, farm, bos taurus, cow2019-11-21v3No1 / 12
666amnondominant italy, feces, wild horse, equus ferus2020-09-25v3No1 / 12
649amnondominant colon, lamb, age 6 weeks, research facility, new zealand, ovis aries, sheep2020-09-07v3No1 / 13
568amnondominant gallus gallus, chicken, feces, broiler chicken, viet nam2019-12-08v3No1 / 15
729amnondominant cameroon, wild, monkey, feces, pan troglodytes troglodytes, central chimpanzee2021-01-05v3No1 / 17
565amnondominant skin, canada, zoological garden, captive, african lion safari, giraffa camelopardalis, giraffe2019-11-21v3No1 / 18
666amnondominant lama guanicoe, italy, feces2020-09-25v3No1 / 18
744amnondominant cloaca, research facility, age 35 days, cobb broiler chicken, male, gallus gallus, chicken2021-02-21v3No1 / 18
797amnondominant breast fed, age 1 year, infant, germany, homo sapiens, feces2021-06-13v3No1 / 18
729amnondominant captive, monkey, feces, zoological garden, europe, pan troglodytes verus, western chimpanzee2021-01-05v3No1 / 19
290amnon high in rural community small village compared to city in homo sapiens feces adult china 2018-02-01v4No1 / 21
744amnondominant caecum, research facility, age 35 days, cobb broiler chicken, male, gallus gallus, chicken2021-02-21v3No1 / 21
568amnondominant gallus gallus, chicken, feces, broiler chicken, thailand2019-12-08v3No1 / 23
603amnondominant in baijiu fermentation pit mud in later batches (dominant hefei city prefecture, china, baijiu, fermentation pit mud, mud, days 180-270)2020-04-05v3No1 / 23
738amnondominant caecum, age 1 week, united kingdom, chicken, gallus gallus2021-01-30v3No1 / 23
797amnoncommon formula fed, age 1 year, infant, germany, homo sapiens, feces2021-06-13v3No1 / 23
713amnoncommon active disease, crohn's disease, feces, homo sapiens2028-05-21v3No1 / 24
815amnondominant lake hulun, wild, winter, mongolia, red fox, vulpes vulpes, feces2021-07-04v3No1 / 24
797amnondominant formula fed, age 1 year, infant, germany, homo sapiens, feces2021-06-13v3No1 / 25
776amnondominant caecum, wild, feral, age 15-20 weeks, gallus gallus, chicken, hawaii2021-04-25v3No1 / 26
815amnondominant corsac fox, vulpes corsac, lake hulun, wild, winter, mongolia, feces2021-07-04v3No1 / 27
681amnoncommon seoul, south korea, adult, homo sapiens, feces2028-03-04v3No1 / 37
297amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v4No1 / 38
744amnoncommon ileum, research facility, age 35 days, cobb broiler chicken, male, gallus gallus, chicken2021-02-21v3No1 / 38
51amnon high in hiv infection compared to control in homo sapiens feces united states of america 2017-01-19v4No1 / 39
835amnoncommon adult, japan, homo sapiens, feces2021-09-11v3No1 / 40
825amnoncommon type 1 diabetes mellitus, age 6-14 years, hangzhou city prefecture, china, child, type i diabetes mellitus, homo sapiens, feces2021-08-12v3No1 / 41
831amnoncommon pancreatic cancer, homo sapiens, feces, adult, israel2021-09-11v3No1 / 43
570amnoncommon homo sapiens, feces, india, bihar state2019-12-16v3No1 / 46
597amnoncommon homo sapiens, feces, adult, zhejiang province, china, control2020-03-23v3No1 / 46
597amnoncommon homo sapiens, feces, adult, zhejiang province, china, gout2020-03-23v3No1 / 47
666amnoncommon short beaked common dolphin, delphinus delphis, rectal swab, feces, italy2020-09-25v3No1 / 48
720amnoncommon autoimmune hepatitis, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 48
796amnoncommon control, taoyuan city, republic of china, taiwan, adult, feces, homo sapiens2021-06-10v3No1 / 51
694amnoncommon china, shanghai district, obesity, adult, female, feces, homo sapiens2028-03-17v3No1 / 52
797amnon high in infant age 1 year compared to child age 2 years in formula fed germany homo sapiens feces 2021-06-13v3No1 / 52
578amnoncommon homo sapiens, feces, adult, male, kingdom of spain, sweden, msw, heterosexual, hiv infection2020-01-14v3No1 / 53
390amnoncommon homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v4No1 / 55
720amnoncommon control, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 56
644amnon high in male compared to female in adult united states of america hispanic or latin american feces homo sapiens 2020-08-31v4No1 / 58
565amnoncommon skin, canada, equus caballus, horse, farm2019-11-21v3No1 / 58
666amnoncommon homo sapiens, italy, feces2020-09-25v3No1 / 58
734amnoncommon vegetarian diet, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 60
831amnoncommon control, homo sapiens, feces, adult, israel2021-09-11v3No1 / 60
627amnoncommon feces, pregnancy, adult, female, china2020-05-16v3No1 / 61
637amnoncommon gestational age 8-12 weeks, chengdu city prefecture, china, adult, pregnancy, female, feces, homo sapiens2020-08-18v3No1 / 61
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
575amnoncommon in professional martial arts athletes (common homo sapiens, feces, athlete, high physical activity, adult, china, age 19-24)2020-01-05v3No1 / 63
671amnon high in age 1 month compared to age 3 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 64
738amnoncommon caecum, age 1 week, united kingdom, chicken, gallus gallus2021-01-30v3No1 / 64
734amnoncommon coronary heart disease, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 66
757amnoncommon feces, adult, santa catarina state, brazil, homo sapiens2021-03-28v3No1 / 67
574amnoncommon feces, homo sapiens, russia, adult2020-01-05v3No1 / 68
593amnoncommon homo sapiens, feces, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
734amnoncommon omnivore diet, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 68
738amnon high in age 1 week compared to age 30 days in caecum united kingdom chicken gallus gallus 2021-01-30v3No1 / 68
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
394amnon high in control compared to ulcerative colitis in homo sapiens feces adult united states of america state of california 2018-11-06v4No1 / 71
644amnoncommon adult, united states of america, hispanic or latin american, feces, homo sapiens2020-08-31v4No1 / 71
656amnoncommon age 1-18 years, sri lanka, feces, homo sapiens2020-09-13v3No1 / 71
425amnoncommon homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 73
578amnoncommon homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, hiv infection2020-01-14v3No1 / 74
794amnoncommon antiretroviral therapy, human immunodeficiency virus infectious disease, hiv infection, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v4No1 / 75
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
666amnoncommon common bottlenose dolphin, rectal swab, tursiops truncatus, italy, feces2020-09-25v3No1 / 76
799amnoncommon in obese participant fecal samples before ketogenic diet (common obesity, high bmi, adult, estonia, feces, homo sapiens)2021-06-13v3No1 / 77
630amnoncommon madrid, kingdom of spain, feces, adult, homo sapiens2020-06-01v3No1 / 78
529amnoncommon homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v3No1 / 79
732amnoncommon municipality of reus, kingdom of spain, adult, feces, homo sapiens2021-01-11v3No1 / 79
671amnoncommon age 1 month, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 81
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
650amnon high in male compared to female in feces adult homo sapiens united states of america state of new york 2020-09-10v4No1 / 82
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in homo sapiens feces adult age 50-60 years nanning city prefecture china )2018-01-27v4No1 / 83
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
565amnoncommon skin, canada, eidolon helvum, fruit bat, zoological garden, toronto zoo, captive2019-11-21v3No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
680amnoncommon obesity, adult, novosibirsk, russia, feces, homo sapiens2028-03-04v3No1 / 85
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
629amnoncommon female, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 89
666amnoncommon wild cat, felis silvestris, italy, feces2020-09-25v3No1 / 91
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common ketogenic diet, high bmi, estonia, adult, obesity, homo sapiens, feces)2021-06-13v3No1 / 93
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
736amnoncommon tanzania, pemba island, adult, female, feces, homo sapiens2021-01-25v3No1 / 95
629amnoncommon msw, heterosexual, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 97
787amnonlower in first 2 hours compared to 5-6 hours following eating ( high in 5-6 hours compared to 1-2 hours in dairy goat shanxi province rumen ruminal fluid research facility china goat capra hircus )2021-05-23v3No1 / 101
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in sus scrofa pig caecum united kingdom )2017-11-26v4No1 / 103
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
565amnoncommon skin, canada, sciurus carolinensis, eastern gray squirrel2019-11-21v3No1 / 104
683amnoncommon state of california, united states of america, adult, feces, homo sapiens2028-03-04v4No1 / 105
797amnon high in age 1 year compared to age 7 months in formula fed germany infant homo sapiens feces 2021-06-13v3No1 / 106
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
644amnonhigher in individuals born in latin america compared to indivuals born in usa ( high in non usa born compared to usa born in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
802amnoncommon feces, cornell university, state of new york, united states of america, adult, homo sapiens2021-06-16v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
565amnoncommon skin, canada, pteropus giganteus, indian flying fox, zoological garden, captive, african lion safari2019-11-21v3No1 / 109
770amnon high in age < 1 year infant compared to age 10-15 years adult organism in rectal swab feces indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v4No1 / 111
735amnon high in control compared to restricted feed in research facility nanjing city prefecture china pregnancy digesta rumen female organism female sheep ovis aries 2021-01-22v3No1 / 112
744amnoncommon cloaca, research facility, age 35 days, cobb broiler chicken, male, gallus gallus, chicken2021-02-21v3No1 / 114
671amnoncommon age 6 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
294amnon high in control compared to irritable bowel syndrome in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 121
537amnoncommon in feces of captive grown deer mice feces (common feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, research facility, captive)2019-07-28v3No1 / 121
565amnoncommon skin, canada, zoological garden, captive, african lion safari, ceratotherium simum, white rhinoceros2019-11-21v3No1 / 122
660amnoncommon shuar population, village, rural community, ecuador, feces, homo sapiens2020-09-20v4No1 / 123
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
607amnoncommon germany, homo sapiens, feces, parkinson's disease2020-04-19v4No1 / 125
779amnon high in control compared to crohn's disease in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v4No1 / 127
607amnoncommon germany, homo sapiens, feces, control2020-04-19v4No1 / 128
649amnoncommon colon, lamb, age 6 weeks, research facility, new zealand, ovis aries, sheep2020-09-07v3No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
721amnoncommon obesity, overweight body mass index status, adult, scotland, gaz:00052100, feces, homo sapiens2028-05-23v4No1 / 131
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
625amnoncommon emperor tamarin, saguinus imperator, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 132
578amnoncommon homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, control2020-01-14v3No1 / 132
794amnoncommon control, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v4No1 / 133
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
607amnoncommon germany, homo sapiens, feces, rem sleep behavior disorder2020-04-19v4No1 / 134
594amnoncommon adult, cameroon, feces, homo sapiens, ngoantet, rural community2020-03-12v4No1 / 136
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
617amnoncommon alpine pasture, alpine, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
770amnon high in vagina female organism compared to male organism penis in age > 1 year indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v4No1 / 138
629amnoncommon amsterdam, kingdom of the netherlands, adult, homosexual, msm, feces, homo sapiens2020-05-31v4No1 / 141
744amnoncommon caecum, research facility, age 35 days, cobb broiler chicken, male, gallus gallus, chicken2021-02-21v3No1 / 141
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
666amnoncommon zoological garden, hippopotamus amphibius, italy, feces2020-09-25v3No1 / 146
815amnoncommon corsac fox, vulpes corsac, lake hulun, wild, winter, mongolia, feces2021-07-04v3No1 / 146
594amnoncommon adult, cameroon, feces, homo sapiens, city, yaounde2020-03-12v4No1 / 154
673amnoncommon caecum, control, ascending colon, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 154
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
815amnoncommon lake hulun, wild, winter, mongolia, red fox, vulpes vulpes, feces2021-07-04v3No1 / 160
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens adult feces china 2018-02-05v4No1 / 161
537amnoncommon in feces of wild caught deer mice feces (common feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, wild)2019-07-28v3No1 / 163
700amnoncommon belgium, age 1 month, research facility, sus scrofa, pig, feces2028-04-01v3No1 / 164
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 168
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
521amnoncommon in pre-weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No1 / 169
671amnoncommon age 3 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 170
666amnoncommon italy, feces, wood mouse, apodemus sylvaticus2020-09-25v3No1 / 171
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
762sheryoHigher in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol compared to npk fertilized from Germany ( high in manure fertilization manured soil organic fertilization compared to mineral fertilization npk fertilization in germany soil bulk soil thyrow albic luvisol ph 6.4 lettuce pot expreiment )2021-04-07v3No1 / 176
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
671amnon high in age 8 months compared to female adult in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 182
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
604amnoncommon caecum, chicken, gallus gallus, cecal content, china, research facility2020-04-06v3No1 / 185
744amnon high in caecum compared to cloaca in research facility age 35 days cobb broiler chicken male gallus gallus chicken 2021-02-21v3No1 / 187
776amnoncommon caecum, wild, feral, age 15-20 weeks, gallus gallus, chicken, hawaii2021-04-25v3No1 / 191
620amnoncommon village, rural community, homo sapiens, nouabale-ndoki national park, republic of congo, feces2020-05-06v4No1 / 197
584amnoncommon male, rattus norvegicus, rat, sprague dawley, research facility, feces, china, type i diabetes mellitus, induced type 1 diabetes2020-01-31v3No1 / 202
738amnoncommon caecum, age 30 days, united kingdom, chicken, gallus gallus2021-01-30v3No1 / 202
565amnoncommon skin, canada, ammotragus lervia, barbary sheep, zoological garden, captive, african lion safari2019-11-21v3No1 / 205
603amnonlower in inital batches of baijiu fermentation pit mud ( high in days 180-270 compared to days 0-90 in mud hefei city prefecture china baijiu fermentation pit mud )2020-04-05v3No1 / 205
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
780amnon high in caecum compared to jejunum duodenum small intestine in jinzhou city prefecture china research facility chicken gallus gallus 2021-04-28v3No1 / 212
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, china, homo sapiens, adult2019-11-24v4No1 / 221
584amnoncommon male, rattus norvegicus, rat, sprague dawley, research facility, feces, control, china2020-01-31v3No1 / 221
666amnoncommon pig, sus scrofa domesticus, italy, feces2020-09-25v3No1 / 223
10amnonpositively correlated with age (6-35) ( high in adult compared to child in homo sapiens feces toronto )2016-10-27v4No1 / 228
673amnon high in caecum ascending colon compared to ileum in control research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 228
780amnoncommon jinzhou city prefecture, china, research facility, chicken, gallus gallus, jejunum, duodenum, small intestine2021-04-28v3No1 / 232
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in age 19-24 soldiers compared to adult age 30-50 age 60-79 age >94 in homo sapiens feces china )2018-12-30v4No1 / 238
666amnoncommon south american tapir, tapirus terrestris, italy, feces2020-09-25v3No1 / 242
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
671amnoncommon age 8 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 252
617amnoncommon lowland pasture, lowland farm, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 257
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
744amnon high in cloaca compared to ileum in research facility age 35 days cobb broiler chicken male gallus gallus chicken 2021-02-21v3No1 / 265
568amnoncommon gallus gallus, chicken, feces, broiler chicken, viet nam2019-12-08v3No1 / 272
770amnoncommon age < 1 year, infant, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 280
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
744amnon high in caecum compared to ileum in research facility age 35 days cobb broiler chicken male gallus gallus chicken 2021-02-21v3No1 / 286
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
762sheryoHigher in bulk soil of a pot experiment with lettuce planted in organic fertilized compared to npk fertilized haplic luvisol Switzerland ( high in manured soil manure fertilization bio-dynamic fertilizer organic fertilization compared to npk fertilization mineral fertilization in therwil switzerland haplic luvisol soil bulk soil lettuce pot expreiment )2021-04-07v3No1 / 294
780amnoncommon caecum, jinzhou city prefecture, china, research facility, chicken, gallus gallus2021-04-28v3No1 / 294
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
737amnoncommon ruminal fluid, rumen, hainan autonomous prefecture, age 2 months, research facility, hainan black goat, china, goat, capra hircus2021-01-27v3No1 / 295
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to metronidazole neomycin vancomycin antibiotic in state of california united states of america adult feces homo sapiens )2028-03-04v4No1 / 301
666amnoncommon wild boar, sus scrofa, italy, feces2020-09-25v3No1 / 305
565amnoncommon skin, canada, zoological garden, captive, african lion safari, giraffa camelopardalis, giraffe2019-11-21v3No1 / 310
650amnon high in asian compared to caucasian european in feces adult homo sapiens united states of america state of new york 2020-09-12v4No1 / 317
565amnoncommon skin, canada, farm, bos taurus, cow2019-11-21v3No1 / 318
827sheryoCommon in soil at 575cm depth in clayey till loam soil, Lund Denmark (common depth 550-600cm, lund, kingdom of denmark, agricultural field, clayey till, late weichselian glaciation, loam soil)2021-09-13v3No1 / 318
568amnoncommon gallus gallus, chicken, feces, broiler chicken, thailand2019-12-08v3No1 / 320
729amnoncommon cameroon, wild, feces, monkey, gorilla gorilla2021-01-05v3No1 / 321
522amnon high in mouse chow age 6 weeks compared to high sugar diet age 18 weeks in mouse mus musculus feces germany research facility female c57bl/6j janvier labs 2019-07-03v3No1 / 325
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
565amnoncommon skin, canada, equus asinus africanus, donkey, farm2019-11-21v3No1 / 335
729amnoncommon wild, cameroon, monkey, feces, pan troglodytes troglodytes, central chimpanzee2021-01-05v3No1 / 336
666amnoncommon horse, equus caballus, italy, feces2020-09-25v3No1 / 341
729amnoncommon western chimpanzee, pan troglodytes verus, europe, zoological garden, feces, monkey2021-01-05v3No1 / 343
776amnoncommon caecum, broiler chicken, research facility, captive, age 5 weeks, gallus gallus, chicken, hawaii2021-04-25v3No1 / 343
671amnon high in state of california compared to state of oregon in female adult united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 355
671amnoncommon female, adult, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 356
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to captive research facility in feces canada peromyscus maniculatus deer mice age 3-5 weeks province of ontario algonquin provincial park )2019-07-28v3No1 / 358
565amnoncommon skin, canada, macropus rufus, red kangaroo, zoological garden, captive, african lion safari2019-11-21v3No1 / 360
565amnoncommon skin, canada, papio anubis, olive baboon, zoological garden, captive, toronto zoo2019-11-21v3No1 / 368
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
770amnoncommon age 10-15 years, adult organism, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 396
561amnon high in spring green stage diet compared to summer grass growth diet in bos grunniens yak china tibetan plateau alpine meadow rumen ruminal fluid 2019-11-05v3No1 / 397
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
666amnoncommon rattus rattus, rat, italy, feces2020-09-25v3No1 / 406
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
666amnoncommon lama guanicoe, italy, feces2020-09-25v3No1 / 437
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
666amnoncommon donkey, equus asinus, equus asinus africanus, feces, italy2020-09-25v3No1 / 450
762sheryocommon in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (common bio-dynamic fertilizer, manured soil, manure fertilization, organic fertilization, thyrow, switzerland, haplic luvisol, pot expreiment, lettuce, soil, rhizosphere)2021-04-08v3No1 / 455
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
823sheryoCommon at 70-100cm depth in ultisol soil in auburn, alabama (common depth 70-100cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 459
787amnoncommon in high grain diet induced subacute acidosis (common acidosis, subacute rumen acidosis, capra hircus, goat, china, research facility, ruminal fluid, rumen, shanxi province, dairy goat)2021-05-23v3No1 / 463
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
666amnoncommon cow, bos taurus, italy, feces2020-09-25v3No1 / 482
617amnonlower in cow milk of cows in alpine pasture compared to lowland farm ( high in lowland farm lowland pasture compared to alpine pasture alpine in farm italy cow milk (raw) cow milk (fluid) milk )2020-05-03v3No1 / 484
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
578amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to msw heterosexual in homo sapiens feces hiv infection kingdom of spain sweden adult male )2020-01-14v3No1 / 519
603amnoncommon in baijiu fermentation pit mud in first 2 batches (common mud, fermentation pit mud, baijiu, china, hefei city prefecture, days 0-90)2020-04-05v3No1 / 542
729amnoncommon captive, gorilla gorilla, monkey, feces, zoological garden, europe2021-01-05v3No1 / 542
666amnoncommon alpaca, vicugna pacos, italy, feces2020-09-25v3No1 / 546
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
762sheryoHigh in bulk soil compared to rhizosphere of a pot experiment with lettuce planted in albic luvisol Germany ( high in bulk soil compared to rhizosphere in thyrow albic luvisol germany haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 578
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (common ph 6.6, manured soil, manure fertilization, organic fertilization, bio-dynamic fertilizer, therwil, switzerland, haplic luvisol, soil, bulk soil, lettuce, pot expreiment)2021-04-07v3No1 / 602
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
603amnoncommon in baijiu fermentation pit mud in later batches (common hefei city prefecture, china, baijiu, fermentation pit mud, mud, days 180-270)2020-04-05v3No1 / 608
666amnoncommon mouflon, ovis aries musimon, italy, feces2020-09-25v3No1 / 649
561amnoncommon bos grunniens, yak, china, tibetan plateau, alpine meadow, rumen, ruminal fluid2019-11-05v3No1 / 670
565amnoncommon skin, canada, zoological garden, captive, tragelaphus oryx, eland, toronto zoo2019-11-21v3No1 / 674
666amnoncommon goat, capra hircus, italy, feces2020-09-25v3No1 / 674
666amnoncommon equus asinus africanus, african wild ass, feces, italy2020-09-25v3No1 / 683
666amnoncommon sheep, ovis aries, italy, feces2020-09-25v3No1 / 688
787amnoncommon control, capra hircus, goat, china, research facility, ruminal fluid, rumen, shanxi province, dairy goat2021-05-23v3No1 / 700
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol from Germany (common manured soil, manure fertilization, germany, organic fertilization, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v3No1 / 704
666amnoncommon italy, feces, wild horse, equus ferus2020-09-25v3No1 / 715
752sheryoCommon in soil planted with Panax notoginseng (common panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 730
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
735amnoncommon restricted feed, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v3No1 / 744
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
735amnoncommon control, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v3No1 / 761
823sheryoCommon at 90-100cm depth in foot slope ultisol soil in auburn, alabama (common depth 90-100cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 782
752sheryoCommon in soil planted with Panax notoginseng amended with2% biochar (common biochar, panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 783
827sheryoCommon in soil at 465cm depth in clayey till loam soil, Lund Denmark (common depth 450-480cm, lund, kingdom of denmark, agricultural field, clayey till, late weichselian glaciation, loam soil)2021-09-13v3No1 / 786
827sheryoCommon in soil at 325cm depth in clayey till loam soil, Lund Denmark (common lund, kingdom of denmark, agricultural field, clayey till, late weichselian glaciation, loam soil, depth 300-350cm)2021-08-24v3No1 / 866
649amnon high in colon compared to ileum in lamb age 6 weeks research facility new zealand ovis aries sheep 2020-09-07v3No1 / 897
701amnoncommon municipality of beijing, research facility, china, male, male organism, age 2 years, rumen liquid, rumen, bos taurus, cow2028-04-01v3No1 / 953
620amnon high in united states of america zoological garden pan troglodytes compared to nouabale-ndoki national park republic of congo wild pan troglodytes troglodytes in chimpanzee feces 2020-05-06v4No1 / 964
610sheryoCommon in agricultural field soil amended with straw (common straw, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 998
620amnon high in united states of america zoological garden compared to nouabale-ndoki national park wild republic of congo in gorilla gorilla gorilla feces 2020-05-06v4No1 / 1019
827sheryoCommon in soil at 25cm depth in clayey till loam soil, Lund Denmark (common depth (soil) 20-30cm, plough layer , loam soil, late weichselian glaciation, clayey till, agricultural field, kingdom of denmark, lund)2021-08-24v3No1 / 1111
764sheryocommon in leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany (common bernburg, germany, soil, triticum aestivum, crop rotation, ph 7.6, brassica napus, rapeseed pre-crop)2021-04-12v3No1 / 1129
764sheryoCommon in leoss soil in wheat field grown under conservation tillage and crop rotation in germany (common ph 7.6, crop rotation, cultivator tillage, conservation tillage, triticum aestivum, soil, germany, bernburg)2021-04-12v3No1 / 1140
827sheryoCommon in soil at 95cm depth in clayey till loam soil, Lund Denmark (common sandy till , depth 70-120cm, loam soil, late weichselian glaciation, clayey till, agricultural field, kingdom of denmark, lund)2021-08-24v3No1 / 1142
764sheryoCommon in leoss soil in wheat field grown under conventional tillage and crop rotation in germany (common crop rotation, triticum aestivum, ph 7.6, mouldboard plough, conventional tillage, loess chernozem, bernburg, germany, soil)2021-04-12v3No1 / 1213
764sheryoCommon in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany (common maize pre-crop, ph 7.6, crop rotation, triticum aestivum, soil, germany, bernburg)2021-04-12v3No1 / 1225
649amnon high in colon compared to jejunum duodenum in lamb age 6 weeks research facility new zealand ovis aries sheep 2020-09-07v3No1 / 1261
616amnoncommon in topsoil of non-fertilized sugarcane field (common ph 6.7, sugarcane, saccharum, soil, topsoil, depth 0-20cm, china, guangzhou city prefecture, non-fertilized soil)2020-04-27v3No1 / 1277
696amnon high in alycaeus jagori compared to opisthostoma concinnum plectostoma concinnum in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 1672
616amnoncommon in topsoil of PK/NP/NPK/NK fertilized sugarcane field (common fertilized soil, ph 5.5-6, sugarcane, saccharum, soil, topsoil, depth 0-20cm, china, guangzhou city prefecture)2020-04-27v3No1 / 1710

Problems / suggestions? Please email info AT dbbact DOT org