Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTTTGCAAGTCTGATGTGAAAGGCGGGGGCTCAACCCCTGGACTGCATTGGAAACTGTGAGGCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.427725
feces0.357652
adult0.310248
rural community0.181818
child0.158103
city0.148148
small village0.123967
obsolete_juvenile stage0.110294
homosexual0.100000
gay0.100000
msm0.100000
india0.100000
united states of america0.098284
LOWER IN crohn's disease0.096386
zoological garden0.095238
state of colorado0.090909
jiangsu province0.088889
infant0.081633
control0.076607
hunter gatherer0.075000
thailand0.075000
biopsy0.073620
LOWER IN united states of america0.073171
china0.072131
LOWER IN heterosexual0.051948
LOWER IN msw0.051948
denver0.051282
age 8-120.051282
lima0.051282
shantytown0.051282
age 30-500.051282
age >940.051282
glasgow0.051282
myanmar0.051282
karen0.051282
age 13-140.051282
hadza0.051282
tunapuco0.051282
corn and soybean diet0.051282
age 4-7 weeks0.051282
weaned0.051282
papio anubis0.051282
chuquisaca department0.051282
age 5-13 years0.051282
LOWER IN infant0.050633
LOWER IN city0.050000
egypt0.050000
age < 3 years0.050000
tanzania0.050000
peru0.050000
jiangxi province0.050000
kingdom of denmark0.050000
LOWER IN duodenum0.049383
biopsy site0.048780
kingdom of norway0.048780
LOWER IN finland0.048780
bolivia0.048780
state of tennessee0.047619
monkey0.044444
sus scrofa0.043478
pig0.043478
age0.043011
kingdom of spain0.042553
female0.037736
farm0.033898
anorexia nervosa0.026316
azerbaijan0.026316
irritable bowel syndrome0.026316
cron diet0.026316
toronto0.026316
oslo0.026316
age 30-400.026316
el salvador0.026316
estonia0.026316
LOWER IN age 3-60.026316
age 130.026316
new delhi0.026316
spondylitis0.026316
spondyloarthritis0.026316
atherosclerosis0.026316
LOWER IN el salado0.026316
bogota0.026316
LOWER IN municipality of santiago de cali0.026316
LOWER IN bucaramanga0.026316
LOWER IN barranquilla0.026316
age 1-20.026316
LOWER IN age 0-10.026316
bangladesh0.026316
nanchang city prefecture0.026316
LOWER IN pancreatitis0.026316
LOWER IN acute pancreatitis0.026316
olive baboon0.026316
LOWER IN nepal0.026316
LOWER IN himalayas0.026316
LOWER IN hmong0.026316
zambia0.026316
baboon0.026316
papio0.026316
LOWER IN papio kindae0.026316
LOWER IN papio ursinus0.026316
Fraction of dbbact annotations with this term covered by the query
TermScore
small village0.750000
homosexual0.666667
gay0.666667
msm0.666667
LOWER IN heterosexual0.666667
LOWER IN msw0.666667
india0.666667
rural community0.571429
anorexia nervosa0.500000
denver0.500000
azerbaijan0.500000
age 8-120.500000
lima0.500000
shantytown0.500000
age 30-500.500000
irritable bowel syndrome0.500000
hunter gatherer0.500000
age >940.500000
glasgow0.500000
myanmar0.500000
thailand0.500000
karen0.500000
cron diet0.500000
age 13-140.500000
toronto0.500000
oslo0.500000
age 30-400.500000
el salvador0.500000
estonia0.500000
LOWER IN age 3-60.500000
hadza0.500000
age 130.500000
new delhi0.500000
spondylitis0.500000
spondyloarthritis0.500000
atherosclerosis0.500000
LOWER IN el salado0.500000
bogota0.500000
LOWER IN municipality of santiago de cali0.500000
LOWER IN bucaramanga0.500000
LOWER IN barranquilla0.500000
age 1-20.500000
LOWER IN age 0-10.500000
bangladesh0.500000
tunapuco0.500000
nanchang city prefecture0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
corn and soybean diet0.500000
age 4-7 weeks0.500000
weaned0.500000
papio anubis0.500000
olive baboon0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
LOWER IN hmong0.500000
zambia0.500000
baboon0.500000
papio0.500000
LOWER IN papio kindae0.500000
LOWER IN papio ursinus0.500000
pan troglodytes0.500000
chimpanzee0.500000
africa0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
sigmoid colon0.500000
children0.500000
LOWER IN state of oklahoma0.500000
age one year0.500000
LOWER IN age one month0.500000
LOWER IN forearm0.500000
LOWER IN arm0.500000
chuquisaca department0.500000
age 5-13 years0.500000
age 60-790.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
LOWER IN age 2-4 weeks0.500000
LOWER IN suckling0.500000
LOWER IN preweaned0.500000
LOWER IN mouth mucosa0.500000
LOWER IN crohn's disease0.444444
biopsy0.400000
LOWER IN infant0.400000
zoological garden0.400000
LOWER IN united states of america0.375000
LOWER IN city0.333333
nigeria0.333333
american diet0.333333
state of oklahoma0.333333
amerindian0.333333
venezuela0.333333
LOWER IN obsolete_juvenile stage0.333333
caloric restriction diet0.333333
egypt0.333333
age < 3 years0.333333
tanzania0.333333
state of texas0.333333
Fraction of annotations for the query sequences containing the term
TermScore
feces0.945946
homo sapiens0.905405
adult0.391892
united states of america0.256757
china0.148649
rural community0.108108
child0.108108
city0.108108
control0.108108
small village0.067568
obsolete_juvenile stage0.067568
state of colorado0.054054
homosexual0.054054
gay0.054054
msm0.054054
jiangsu province0.054054
LOWER IN crohn's disease0.054054
infant0.054054
india0.054054
zoological garden0.054054
biopsy0.040541
hunter gatherer0.040541
thailand0.040541
LOWER IN united states of america0.040541
LOWER IN city0.027027
denver0.027027
biopsy site0.027027
female0.027027
age 8-120.027027
lima0.027027
shantytown0.027027
age 30-500.027027
kingdom of spain0.027027
LOWER IN heterosexual0.027027
LOWER IN msw0.027027
age >940.027027
glasgow0.027027
myanmar0.027027
karen0.027027
age 13-140.027027
egypt0.027027
kingdom of norway0.027027
LOWER IN infant0.027027
age < 3 years0.027027
LOWER IN finland0.027027
tanzania0.027027
hadza0.027027
LOWER IN duodenum0.027027
age0.027027
peru0.027027
tunapuco0.027027
corn and soybean diet0.027027
age 4-7 weeks0.027027
weaned0.027027
jiangxi province0.027027
farm0.027027
sus scrofa0.027027
pig0.027027
monkey0.027027
papio anubis0.027027
kingdom of denmark0.027027
state of tennessee0.027027
chuquisaca department0.027027
bolivia0.027027
age 5-13 years0.027027
anorexia nervosa0.013514
LOWER IN control0.013514
nigeria0.013514
american diet0.013514
azerbaijan0.013514
right colon0.013514
state of california0.013514
state of oklahoma0.013514
left colon0.013514
irritable bowel syndrome0.013514
amerindian0.013514
venezuela0.013514
LOWER IN obsolete_juvenile stage0.013514
LOWER IN child0.013514
cron diet0.013514
caloric restriction diet0.013514
toronto0.013514
oslo0.013514
age 30-400.013514
LOWER IN age 1 year0.013514
el salvador0.013514
united kingdom0.013514
estonia0.013514
LOWER IN age 3-60.013514
LOWER IN colon0.013514
LOWER IN ileum0.013514
age 130.013514
juvenile organism0.013514
LOWER IN ulcerative colitis0.013514
state of texas0.013514
new delhi0.013514
LOWER IN small intestine0.013514
french republic0.013514
spondylitis0.013514
spondyloarthritis0.013514
Exp. ID User ID Description Date Region Flag Sequences
2amnon high in anorexia nervosa compared to control in homo sapiens feces 2016-10-05v4No1 / 20
290amnon high in rural community small village compared to city in homo sapiens feces china adult 2018-02-01v4No1 / 21
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 66
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 8-122018-12-30v4No1 / 106
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
438amnoncommon feces, homo sapiens, china, jiangsu province, age 30-50, adult2018-12-30v4No1 / 115
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
393amnon high in gay homosexual msm compared to heterosexual msw in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 121
438amnoncommon feces, homo sapiens, china, age >94, jiangsu province, adult2018-12-30v4No1 / 121
344amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to heterosexual msw in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 124
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to crohn's disease obsolete_juvenile stage child in glasgow feces homo sapiens )2017-02-26v4No1 / 125
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, china, jiangsu province, age 13-142018-12-30v4No1 / 134
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
62amnon high in egypt compared to united states of america in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 144
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 168
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
352amnon high in feces compared to small intestine duodenum in homo sapiens india new delhi 2018-07-30v4No1 / 190
312amnoncommon feces, homo sapiens, french republic, adult, spondylitis, spondyloarthritis2018-04-09v4No1 / 197
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, china, adult, small village, rural community2018-02-01v4No1 / 218
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 237
404amnon high in medellin metropolitan area bogota compared to municipality of santiago de cali bucaramanga barranquilla in homo sapiens feces adult colombia city 2018-11-20v4No1 / 237
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces india infant )2016-12-19v4No1 / 253
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces china nanchang city prefecture 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common corn and soybean diet, age 4-7 weeks, weaned, jiangxi province, farm, china, feces, sus scrofa, pig)2019-07-02v3No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
517amnon high in feces compared to forearm arm skin in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in corn and soybean diet age 4-7 weeks weaned compared to age 2-4 weeks suckling preweaned in jiangxi province farm china feces sus scrofa pig )2019-07-02v3No1 / 681
517amnon high in feces compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 752

Problems / suggestions? Please email info AT dbbact DOT org