Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTTTGCAAGTCTGATGTGAAAGGCGGGGGCTCAACCCCTGGACTGCATTGGAAACTGTGAGGCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.395665
feces0.367253
adult0.288703
zoological garden0.235294
rural community0.149750
homosexual0.122271
msm0.122271
city0.114286
child0.113636
united states of america0.112661
male0.098361
kingdom of spain0.092308
control0.090498
small village0.090361
gay0.090361
chimpanzee0.087719
obsolete_juvenile stage0.082873
gorilla gorilla0.072289
india0.072072
como zoo0.071429
pan troglodytes0.071429
LOWER IN crohn's disease0.070796
amsterdam0.068966
china0.068493
state of colorado0.067797
kingdom of the netherlands0.066667
female0.065466
jiangsu province0.062500
state of minnesota0.062500
infant0.061856
canada0.055300
papio anubis0.055300
LOWER IN heterosexual0.055046
LOWER IN msw0.055046
hunter gatherer0.054545
msw0.053812
heterosexual0.053812
biopsy0.053097
LOWER IN united states of america0.053097
thailand0.051724
LOWER IN wild0.050420
sweden0.044776
germany0.041958
olive baboon0.037383
denver0.037037
age 8-120.037037
lima0.037037
shantytown0.037037
age 30-500.037037
age >940.037037
glasgow0.037037
myanmar0.037037
karen0.037037
age 13-140.037037
toronto zoo0.037037
hadza0.037037
nouabale-ndoki national park0.037037
republic of congo0.037037
tunapuco0.037037
weaned0.037037
age 4-7 weeks0.037037
corn and soybean diet0.037037
lincoln park zoo0.037037
saint louis zoo0.037037
saint louis0.037037
chuquisaca department0.037037
LOWER IN nouabale-ndoki national park0.037037
LOWER IN republic of congo0.037037
LOWER IN infant0.036697
age < 3 years0.036364
tanzania0.036364
peru0.036364
jiangxi province0.036364
chicago0.036364
age 5-13 years0.036364
LOWER IN city0.036036
kingdom of denmark0.036036
biopsy site0.035714
kingdom of norway0.035714
LOWER IN finland0.035714
LOWER IN duodenum0.035714
bolivia0.035714
egypt0.035088
state of tennessee0.035088
pregnancy0.033333
captive0.033333
monkey0.033333
rattus norvegicus0.032787
sprague dawley0.032787
pig0.032787
sus scrofa0.032787
age0.032520
israel0.030769
rat0.030303
skin0.025316
farm0.025000
research facility0.022556
anorexia nervosa0.018868
madrid0.018868
azerbaijan0.018868
Fraction of dbbact annotations with this term covered by the query
TermScore
small village0.750000
gay0.750000
homosexual0.666667
msm0.666667
canada0.666667
papio anubis0.666667
olive baboon0.666667
LOWER IN heterosexual0.600000
LOWER IN msw0.600000
gorilla gorilla0.600000
india0.571429
rural community0.555556
anorexia nervosa0.500000
madrid0.500000
denver0.500000
azerbaijan0.500000
third trimester0.500000
age 8-120.500000
lima0.500000
shantytown0.500000
age 30-500.500000
irritable bowel syndrome0.500000
hunter gatherer0.500000
age >940.500000
glasgow0.500000
parkinson's disease0.500000
emperor tamarin0.500000
saguinus imperator0.500000
como zoo0.500000
zoological garden0.500000
myanmar0.500000
karen0.500000
cron diet0.500000
age 13-140.500000
rem sleep behavior disorder0.500000
toronto0.500000
oslo0.500000
age 30-400.500000
toronto zoo0.500000
el salvador0.500000
estonia0.500000
LOWER IN age 3-60.500000
hadza0.500000
age 130.500000
new delhi0.500000
village0.500000
nouabale-ndoki national park0.500000
republic of congo0.500000
spondyloarthritis0.500000
spondylitis0.500000
induced type 1 diabetes0.500000
atherosclerosis0.500000
LOWER IN el salado0.500000
bogota0.500000
LOWER IN municipality of santiago de cali0.500000
LOWER IN bucaramanga0.500000
LOWER IN barranquilla0.500000
age 1-20.500000
LOWER IN age 0-10.500000
black-handed spider monkey0.500000
ateles geoffroyi0.500000
bangladesh0.500000
tunapuco0.500000
nanchang city prefecture0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
LOWER IN hmong0.500000
lincoln park zoo0.500000
pan troglodytes0.500000
chimpanzee0.500000
zambia0.500000
baboon0.500000
papio0.500000
LOWER IN papio kindae0.500000
LOWER IN papio ursinus0.500000
saint louis zoo0.500000
saint louis0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
sigmoid colon0.500000
children0.500000
LOWER IN state of oklahoma0.500000
LOWER IN gorilla gorilla0.500000
pan troglodytes troglodytes0.500000
age one year0.500000
LOWER IN age one month0.500000
chuquisaca department0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
age 60-790.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
LOWER IN preweaned0.500000
LOWER IN suckling0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.942308
homo sapiens0.778846
adult0.375000
united states of america0.288462
zoological garden0.153846
china0.125000
control0.125000
rural community0.086538
child0.076923
city0.076923
homosexual0.067308
msm0.067308
male0.057692
kingdom of spain0.057692
small village0.048077
obsolete_juvenile stage0.048077
gay0.048077
female0.048077
chimpanzee0.048077
state of colorado0.038462
amsterdam0.038462
kingdom of the netherlands0.038462
jiangsu province0.038462
LOWER IN crohn's disease0.038462
state of minnesota0.038462
como zoo0.038462
infant0.038462
india0.038462
gorilla gorilla0.038462
pan troglodytes0.038462
sweden0.028846
msw0.028846
heterosexual0.028846
biopsy0.028846
hunter gatherer0.028846
LOWER IN heterosexual0.028846
LOWER IN msw0.028846
germany0.028846
thailand0.028846
LOWER IN united states of america0.028846
canada0.028846
research facility0.028846
papio anubis0.028846
LOWER IN wild0.028846
LOWER IN city0.019231
denver0.019231
biopsy site0.019231
israel0.019231
pregnancy0.019231
age 8-120.019231
lima0.019231
shantytown0.019231
age 30-500.019231
age >940.019231
glasgow0.019231
myanmar0.019231
karen0.019231
age 13-140.019231
egypt0.019231
kingdom of norway0.019231
LOWER IN infant0.019231
skin0.019231
captive0.019231
toronto zoo0.019231
age < 3 years0.019231
LOWER IN finland0.019231
tanzania0.019231
hadza0.019231
LOWER IN duodenum0.019231
nouabale-ndoki national park0.019231
republic of congo0.019231
rattus norvegicus0.019231
rat0.019231
sprague dawley0.019231
age0.019231
peru0.019231
tunapuco0.019231
pig0.019231
sus scrofa0.019231
farm0.019231
jiangxi province0.019231
weaned0.019231
age 4-7 weeks0.019231
corn and soybean diet0.019231
monkey0.019231
olive baboon0.019231
kingdom of denmark0.019231
lincoln park zoo0.019231
chicago0.019231
state of tennessee0.019231
saint louis zoo0.019231
saint louis0.019231
age 5-13 years0.019231
bolivia0.019231
chuquisaca department0.019231
LOWER IN nouabale-ndoki national park0.019231
LOWER IN republic of congo0.019231
LOWER IN control0.009615
anorexia nervosa0.009615
nigeria0.009615
Exp. ID User ID Description Date Region Flag Sequences
2amnon high in anorexia nervosa compared to control in homo sapiens feces 2016-10-05v4No1 / 20
290amnon high in rural community small village compared to city in homo sapiens feces adult china 2018-02-01v4No1 / 21
578amnondominant homo sapiens, feces, adult, male, kingdom of spain, sweden, control, msw, heterosexual2020-01-14v3No1 / 26
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 66
630amnoncommon madrid, kingdom of spain, feces, adult, homo sapiens2020-06-01v3No1 / 78
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
629amnoncommon female, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 89
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
578amnoncommon homo sapiens, feces, adult, male, kingdom of spain, sweden, control, msw, heterosexual2020-01-14v3No1 / 92
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
629amnoncommon msw, heterosexual, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 97
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v4No1 / 112
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
393amnon high in gay homosexual msm compared to heterosexual msw in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 121
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
344amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to heterosexual msw in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 124
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 125
607amnoncommon germany, homo sapiens, feces, parkinson's disease2020-04-19v4No1 / 125
607amnoncommon germany, homo sapiens, feces, control2020-04-19v4No1 / 128
625amnoncommon emperor tamarin, saguinus imperator, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 132
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
578amnoncommon homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, control2020-01-14v3No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
607amnoncommon germany, homo sapiens, feces, rem sleep behavior disorder2020-04-19v4No1 / 134
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
629amnoncommon amsterdam, kingdom of the netherlands, adult, homosexual, msm, feces, homo sapiens2020-05-31v4No1 / 141
62amnon high in egypt compared to united states of america in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 144
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
565amnoncommon skin, canada, captive, panthera leo, lion, zoological garden, toronto zoo2019-11-21v3No1 / 150
629amnon high in msm homosexual compared to msw heterosexual in male adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v4No1 / 154
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 168
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
620amnoncommon village, rural community, homo sapiens, nouabale-ndoki national park, republic of congo, feces2020-05-06v4No1 / 197
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
584amnoncommon male, rattus norvegicus, rat, sprague dawley, research facility, feces, china, type i diabetes mellitus, induced type 1 diabetes2020-01-31v3No1 / 202
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
584amnoncommon male, rattus norvegicus, rat, sprague dawley, research facility, feces, control, china2020-01-31v3No1 / 221
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 237
404amnon high in medellin metropolitan area bogota compared to municipality of santiago de cali bucaramanga barranquilla in homo sapiens feces adult colombia city 2018-11-20v4No1 / 237
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
625amnoncommon black-handed spider monkey, ateles geoffroyi, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 256
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
625amnoncommon gorilla gorilla, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 293
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
620amnoncommon lincoln park zoo, chicago, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 358
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
565amnoncommon skin, canada, papio anubis, olive baboon, zoological garden, captive, toronto zoo2019-11-21v3No1 / 368
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
620amnoncommon lincoln park zoo, united states of america, chicago, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 384
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
625amnoncommon pongo abelii, sumatran orangutan, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 414
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
592amnoncommon feces, united states of america, research facility, macaca mulatta, macaque2020-02-18v1No1 / 423
620amnoncommon saint louis zoo, saint louis, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 433
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
620amnon high in chimpanzee pan troglodytes troglodytes compared to gorilla gorilla in nouabale-ndoki national park republic of congo wild feces 2020-05-06v4No1 / 478
620amnoncommon saint louis zoo, saint louis, united states of america, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 530
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
620amnon high in united states of america zoological garden pan troglodytes compared to nouabale-ndoki national park republic of congo wild pan troglodytes troglodytes in chimpanzee feces 2020-05-06v4No1 / 964
620amnon high in united states of america zoological garden compared to nouabale-ndoki national park wild republic of congo in gorilla gorilla gorilla feces 2020-05-06v4No1 / 1019

Problems / suggestions? Please email info AT dbbact DOT org