Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTTTGCAAGTCTGATGTGAAAGGCGGGGGCTCAACCCCTGGACTGCATTGGAAACTGTGAGGCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.406501
feces0.345818
adult0.295047
rural community0.177778
child0.148148
city0.145455
zoological garden0.130435
small village0.120968
obsolete_juvenile stage0.107914
gay0.097561
india0.097561
united states of america0.095652
homosexual0.095238
msm0.095238
LOWER IN crohn's disease0.094118
state of colorado0.088889
jiangsu province0.086957
infant0.080000
canada0.075949
papio anubis0.074534
control0.073491
hunter gatherer0.073171
thailand0.073171
biopsy0.071856
LOWER IN united states of america0.071429
china0.069786
LOWER IN heterosexual0.050633
LOWER IN msw0.050633
olive baboon0.050633
denver0.050000
age 8-120.050000
lima0.050000
shantytown0.050000
age 30-500.050000
age >940.050000
glasgow0.050000
myanmar0.050000
karen0.050000
age 13-140.050000
toronto zoo0.050000
hadza0.050000
tunapuco0.050000
weaned0.050000
age 4-7 weeks0.050000
corn and soybean diet0.050000
chuquisaca department0.050000
LOWER IN infant0.049383
LOWER IN city0.048780
age < 3 years0.048780
tanzania0.048780
peru0.048780
jiangxi province0.048780
kingdom of denmark0.048780
age 5-13 years0.048780
biopsy site0.047619
kingdom of norway0.047619
LOWER IN finland0.047619
LOWER IN duodenum0.047619
bolivia0.047619
egypt0.046512
state of tennessee0.046512
captive0.045455
monkey0.043478
pig0.042553
sus scrofa0.042553
age0.042105
kingdom of spain0.041667
female0.036697
farm0.032787
skin0.031746
anorexia nervosa0.025641
azerbaijan0.025641
irritable bowel syndrome0.025641
cron diet0.025641
toronto0.025641
oslo0.025641
age 30-400.025641
el salvador0.025641
estonia0.025641
LOWER IN age 3-60.025641
age 130.025641
new delhi0.025641
spondyloarthritis0.025641
spondylitis0.025641
atherosclerosis0.025641
LOWER IN el salado0.025641
bogota0.025641
LOWER IN municipality of santiago de cali0.025641
LOWER IN bucaramanga0.025641
LOWER IN barranquilla0.025641
age 1-20.025641
LOWER IN age 0-10.025641
bangladesh0.025641
nanchang city prefecture0.025641
LOWER IN pancreatitis0.025641
LOWER IN acute pancreatitis0.025641
LOWER IN nepal0.025641
LOWER IN himalayas0.025641
LOWER IN hmong0.025641
zambia0.025641
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.000000
small village0.750000
gay0.666667
LOWER IN heterosexual0.666667
LOWER IN msw0.666667
india0.666667
papio anubis0.666667
olive baboon0.666667
rural community0.571429
anorexia nervosa0.500000
denver0.500000
homosexual0.500000
msm0.500000
azerbaijan0.500000
age 8-120.500000
lima0.500000
shantytown0.500000
age 30-500.500000
irritable bowel syndrome0.500000
hunter gatherer0.500000
age >940.500000
glasgow0.500000
myanmar0.500000
thailand0.500000
karen0.500000
cron diet0.500000
age 13-140.500000
toronto0.500000
oslo0.500000
age 30-400.500000
toronto zoo0.500000
el salvador0.500000
estonia0.500000
LOWER IN age 3-60.500000
hadza0.500000
age 130.500000
new delhi0.500000
spondyloarthritis0.500000
spondylitis0.500000
atherosclerosis0.500000
LOWER IN el salado0.500000
bogota0.500000
LOWER IN municipality of santiago de cali0.500000
LOWER IN bucaramanga0.500000
LOWER IN barranquilla0.500000
age 1-20.500000
LOWER IN age 0-10.500000
bangladesh0.500000
tunapuco0.500000
nanchang city prefecture0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
LOWER IN hmong0.500000
zambia0.500000
baboon0.500000
papio0.500000
LOWER IN papio kindae0.500000
LOWER IN papio ursinus0.500000
pan troglodytes0.500000
chimpanzee0.500000
africa0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
sigmoid colon0.500000
children0.500000
LOWER IN state of oklahoma0.500000
age one year0.500000
LOWER IN age one month0.500000
chuquisaca department0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
age 60-790.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
LOWER IN preweaned0.500000
LOWER IN suckling0.500000
LOWER IN age 2-4 weeks0.500000
LOWER IN mouth mucosa0.500000
LOWER IN crohn's disease0.444444
biopsy0.400000
LOWER IN infant0.400000
LOWER IN united states of america0.375000
zoological garden0.375000
LOWER IN city0.333333
nigeria0.333333
american diet0.333333
state of oklahoma0.333333
amerindian0.333333
venezuela0.333333
LOWER IN obsolete_juvenile stage0.333333
caloric restriction diet0.333333
lion0.333333
panthera leo0.333333
age < 3 years0.333333
Fraction of annotations for the query sequences containing the term
TermScore
feces0.921053
homo sapiens0.881579
adult0.381579
united states of america0.250000
china0.144737
rural community0.105263
child0.105263
city0.105263
control0.105263
zoological garden0.078947
small village0.065789
obsolete_juvenile stage0.065789
state of colorado0.052632
homosexual0.052632
gay0.052632
msm0.052632
jiangsu province0.052632
LOWER IN crohn's disease0.052632
infant0.052632
india0.052632
biopsy0.039474
hunter gatherer0.039474
thailand0.039474
LOWER IN united states of america0.039474
canada0.039474
papio anubis0.039474
LOWER IN city0.026316
denver0.026316
biopsy site0.026316
female0.026316
age 8-120.026316
lima0.026316
shantytown0.026316
age 30-500.026316
kingdom of spain0.026316
LOWER IN heterosexual0.026316
LOWER IN msw0.026316
age >940.026316
glasgow0.026316
myanmar0.026316
karen0.026316
age 13-140.026316
egypt0.026316
kingdom of norway0.026316
LOWER IN infant0.026316
toronto zoo0.026316
captive0.026316
skin0.026316
age < 3 years0.026316
LOWER IN finland0.026316
tanzania0.026316
hadza0.026316
LOWER IN duodenum0.026316
age0.026316
peru0.026316
tunapuco0.026316
pig0.026316
sus scrofa0.026316
farm0.026316
jiangxi province0.026316
weaned0.026316
age 4-7 weeks0.026316
corn and soybean diet0.026316
monkey0.026316
olive baboon0.026316
kingdom of denmark0.026316
state of tennessee0.026316
age 5-13 years0.026316
bolivia0.026316
chuquisaca department0.026316
LOWER IN control0.013158
anorexia nervosa0.013158
nigeria0.013158
american diet0.013158
azerbaijan0.013158
right colon0.013158
state of california0.013158
state of oklahoma0.013158
left colon0.013158
irritable bowel syndrome0.013158
amerindian0.013158
venezuela0.013158
LOWER IN obsolete_juvenile stage0.013158
LOWER IN child0.013158
cron diet0.013158
caloric restriction diet0.013158
toronto0.013158
oslo0.013158
age 30-400.013158
LOWER IN age 1 year0.013158
lion0.013158
panthera leo0.013158
el salvador0.013158
united kingdom0.013158
estonia0.013158
LOWER IN age 3-60.013158
LOWER IN colon0.013158
LOWER IN ileum0.013158
age 130.013158
juvenile organism0.013158
Exp. ID User ID Description Date Region Flag Sequences
2amnon high in anorexia nervosa compared to control in homo sapiens feces 2016-10-05v4No1 / 20
290amnon high in rural community small village compared to city in homo sapiens feces adult china 2018-02-01v4No1 / 21
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 66
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
393amnon high in gay homosexual msm compared to heterosexual msw in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 121
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
344amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to heterosexual msw in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 124
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 125
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
62amnon high in egypt compared to united states of america in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 144
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
565amnoncommon toronto zoo, zoological garden, lion, panthera leo, captive, canada, skin2019-11-21v3No1 / 150
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 168
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 237
404amnon high in medellin metropolitan area bogota compared to municipality of santiago de cali bucaramanga barranquilla in homo sapiens feces adult colombia city 2018-11-20v4No1 / 237
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
565amnoncommon toronto zoo, captive, zoological garden, olive baboon, papio anubis, canada, skin2019-11-21v3No1 / 368
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752

Problems / suggestions? Please email info AT dbbact DOT org