Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTAAAGCAAGTCTGAAGTGAAAGCCCGCGGCTCAACTGCGGGACTGCTTTGGAAACTGTTTAACTGGAGTGTCGGAGAGGTAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
china0.371670
feces0.321827
homo sapiens0.308535
infant0.246422
adult0.181709
united states of america0.164278
formula fed0.135338
germany0.129330
crohn's disease0.108527
research facility0.096373
child0.092715
mouse0.087336
farm0.085561
mus musculus0.082988
terminal ileum0.082192
clostridium difficile intestinal infectious disease0.081633
juvenile0.081633
12-month-old human stage0.078947
female0.078652
biopsy0.077922
1-year-old human stage0.074766
LOWER IN control0.073333
state of california0.067797
LOWER IN male0.067568
italy0.067416
adula0.067227
seattle0.065041
colonized germ free0.065041
sigmoid colon0.065041
LOWER IN breast fed0.065041
snake farm0.065041
taconic farms0.065041
caecum0.064171
obsolete_juvenile stage0.064000
LOWER IN rural community0.063492
snake0.062992
LOWER IN jackson laboratories0.062992
hospital0.062338
rectum0.061697
age0.058824
french republic0.056738
city0.056471
hunan province0.055944
LOWER IN small village0.050420
remission0.050209
colon0.050209
clostridium difficile infection0.049587
hyplus rabbit0.049587
LOWER IN 1-month-old human stage0.049587
hispanic or latin american0.049587
canada0.048485
age 5 weeks0.048387
age < 3 years0.048387
finland0.047809
state of georgia0.047244
rabbit0.047244
age 8 weeks0.047244
cecal content0.045113
LOWER IN under-1-year-old human stage0.044776
3-month-old human stage0.044118
monkey0.044118
oryctolagus cuniculus0.043165
captive0.042254
control0.035608
c57bl/60.035503
diarrhea0.034188
los angeles district0.034188
age 3-5 weeks0.033898
parkinson's disease0.033613
after hcst0.033613
hematopoietic stem cell transplant0.033613
valladolid0.033613
cftr s489x0.033613
age 7 months0.033613
exclusive breastmilk diet0.033613
children0.033613
rhesus macaque0.033613
suckling0.033613
preweaned0.033613
age 2-4 weeks0.033613
nanning city prefecture0.033613
sixth decade human stage0.033613
guangzhou city prefecture0.033333
cystic fibrosis0.033058
green turtle0.033058
chelonia mydas0.033058
hispanic0.033058
2-year-old human stage0.033058
age 1 month0.033058
breast fed0.032520
systemic lupus erythematosus0.032520
state of alabama0.032520
ulcerative colitis0.032520
6-month-old human stage0.032000
rural community0.031746
juvenile organism0.031496
macaca mulatta0.031496
jiangxi province0.031496
commonwealth of virginia0.031008
LOWER IN control diet0.031008
Fraction of dbbact annotations with this term covered by the query
TermScore
china6.500000
rem sleep behavior disorder1.000000
diarrhea1.000000
los angeles district1.000000
acute pancreatitis1.000000
pancreatitis1.000000
adula1.000000
atlanta1.000000
glasgow1.000000
lima1.000000
LOWER IN small village0.750000
terminal ileum0.750000
clostridium difficile intestinal infectious disease0.666667
remission0.666667
juvenile0.666667
colon0.666667
age 3-5 weeks0.666667
parkinson's disease0.500000
after hcst0.500000
hematopoietic stem cell transplant0.500000
schizophrenia0.500000
LOWER IN age 7 months0.500000
clostridium difficile infection0.500000
valladolid0.500000
icr/cd-1 mice0.500000
crohn's disease0.500000
tucson0.500000
seattle0.500000
cftr s489x0.500000
colonized germ free0.500000
formula fed0.500000
age 7 months0.500000
hyplus rabbit0.500000
soild food supplemented diet0.500000
solid food diet0.500000
exclusive breastmilk diet0.500000
sigmoid colon0.500000
stroke0.500000
before hsct0.500000
LOWER IN breast fed0.500000
children0.500000
LOWER IN 1-month-old human stage0.500000
hangzhou city prefecture0.500000
age 6-14 years0.500000
hispanic or latin american0.500000
age 50-70 years0.500000
little physical activity0.500000
LOWER IN cron diet0.500000
snake farm0.500000
elaphe carinata0.500000
king ratsnake0.500000
rhesus macaque0.500000
equine grass sickness0.500000
adriatic sea coastal waters of italy0.500000
caretta caretta0.500000
loggerhead sea turtle0.500000
trachemys scripta elegans0.500000
red-eared slider turtle0.500000
turtle farm0.500000
ptyas mucosa0.500000
oriental ratsnake0.500000
naja atra0.500000
chinese cobra0.500000
taconic farms0.500000
hmong0.500000
LOWER IN myanmar0.500000
LOWER IN karen0.500000
age<17 years0.500000
LOWER IN tunapuco0.500000
suckling0.500000
preweaned0.500000
age 2-4 weeks0.500000
taipei city0.500000
low anterior resection0.500000
deinagkistrodon acutus0.500000
pit viper0.500000
spondyloarthritis0.500000
spondylitis0.500000
strain 129s0.500000
shantytown0.500000
LOWER IN el salado0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
sixth decade human stage0.500000
LOWER IN himalayas0.500000
LOWER IN weaned0.500000
LOWER IN corn and soybean diet0.500000
LOWER IN age 4-7 weeks0.500000
algonquin provincial park0.500000
peromyscus maniculatus0.500000
deer mice0.500000
perianal skin0.500000
santa catalina island0.500000
urocyon littoralis0.500000
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
rattus rattus0.500000
age >940.500000
tenth decade human stage0.500000
new delhi0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.869565
homo sapiens0.730435
united states of america0.330435
adult0.286957
china0.191304
infant0.191304
research facility0.165217
germany0.121739
LOWER IN control0.095652
mus musculus0.086957
mouse0.086957
formula fed0.078261
farm0.069565
crohn's disease0.060870
female0.060870
child0.060870
caecum0.052174
control0.052174
italy0.043478
clostridium difficile intestinal infectious disease0.043478
12-month-old human stage0.043478
juvenile0.043478
terminal ileum0.043478
biopsy0.043478
LOWER IN male0.043478
state of california0.043478
1-year-old human stage0.043478
city0.034783
LOWER IN rural community0.034783
obsolete_juvenile stage0.034783
hospital0.034783
seattle0.034783
colonized germ free0.034783
french republic0.034783
sigmoid colon0.034783
LOWER IN breast fed0.034783
rectum0.034783
age0.034783
hunan province0.034783
adula0.034783
snake0.034783
snake farm0.034783
taconic farms0.034783
LOWER IN jackson laboratories0.034783
canada0.034783
LOWER IN small village0.026087
LOWER IN adult0.026087
clostridium difficile infection0.026087
state of georgia0.026087
remission0.026087
3-month-old human stage0.026087
oryctolagus cuniculus0.026087
cecal content0.026087
rabbit0.026087
age 5 weeks0.026087
hyplus rabbit0.026087
colon0.026087
LOWER IN under-1-year-old human stage0.026087
LOWER IN 1-month-old human stage0.026087
hispanic or latin american0.026087
finland0.026087
age < 3 years0.026087
monkey0.026087
captive0.026087
c57bl/60.026087
age 8 weeks0.026087
parkinson's disease0.017391
after hcst0.017391
hematopoietic stem cell transplant0.017391
breast fed0.017391
diarrhea0.017391
kingdom of spain0.017391
valladolid0.017391
systemic lupus erythematosus0.017391
commonwealth of virginia0.017391
LOWER IN control diet0.017391
cystic fibrosis0.017391
cftr s489x0.017391
age 7 months0.017391
guangzhou city prefecture0.017391
juvenile organism0.017391
green turtle0.017391
chelonia mydas0.017391
exclusive breastmilk diet0.017391
state of alabama0.017391
diet0.017391
children0.017391
los angeles district0.017391
hispanic0.017391
6-month-old human stage0.017391
kingdom of denmark0.017391
2-year-old human stage0.017391
ulcerative colitis0.017391
state of new york0.017391
age 1 month0.017391
macaca mulatta0.017391
rhesus macaque0.017391
rat0.017391
age 3-5 weeks0.017391
LOWER IN feces0.017391
Exp. ID User ID Description Date Region Flag Sequences
607amnon high in rem sleep behavior disorder parkinson's disease compared to control in feces homo sapiens germany 2020-04-19v4No1 / 3
655amnoncommon in patients after hematopoietic stem cell transplant (common feces, homo sapiens, italy, after hcst, hematopoietic stem cell transplant)2020-09-13v3No1 / 10
502amnon high in schizophrenia compared to control in feces homo sapiens united states of america adult 2019-03-12v4No1 / 13
185amnoncommon in patients with c. diff infection before treatment (common feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 14
290amnon high in city compared to small village rural community in feces homo sapiens adult china 2018-02-01v4No1 / 14
371amnonNEGATIVELY correlated with age in amerindians ( high in infant obsolete_juvenile stage compared to adult in feces homo sapiens venezuela amerindian hunter gatherer )2018-09-06v4No1 / 15
797amnon high in 12-month-old human stage compared to age 7 months in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 15
94amnoncommon feces, homo sapiens, state of michigan, clostridium difficile intestinal infectious disease, diarrhea2017-03-12v4No1 / 16
728amnoncommon feces, homo sapiens, hospital, adult, kingdom of spain, clostridium difficile intestinal infectious disease, clostridium difficile infection, valladolid2021-01-05v3No1 / 16
368amnon high in systemic lupus erythematosus compared to control in feces homo sapiens united states of america adult commonwealth of virginia 2018-09-03v4No1 / 17
719amnonhigher in diet containing fiber compared to non fiber containing diet ( high in fiber diet compared to control diet in united states of america research facility dentition mus musculus state of georgia mouse charles river laboratories icr/cd-1 mice )2028-05-23v4No1 / 17
713amnondominant feces, homo sapiens, remission, crohn's disease2028-05-21v3No1 / 18
689amnoncommon feces, homo sapiens, united states of america, hospital, clostridium difficile colitis, adult, clostridium difficile infection, tucson2028-03-11v4No1 / 19
619amnondominant feces, united states of america, research facility, mus musculus, mouse, cystic fibrosis, seattle, cftr s489x, colonized germ free2020-05-04v3No1 / 20
797amnondominant feces, homo sapiens, infant, germany, formula fed, age 7 months2021-06-13v3No1 / 20
797amnondominant feces, homo sapiens, infant, germany, formula fed, 3-month-old human stage2021-06-13v3No1 / 20
728amnondominant feces, homo sapiens, hospital, adult, kingdom of spain, clostridium difficile intestinal infectious disease, clostridium difficile infection, valladolid2021-01-05v3No1 / 21
853amnondominant research facility, oryctolagus cuniculus, french republic, cecal content, rabbit, caecum, juvenile, age 5 weeks, hyplus rabbit, soild food supplemented diet, solid food diet2021-12-20v3No1 / 21
779amnoncommon feces, homo sapiens, adult, guangzhou city prefecture, crohn's disease, china2021-04-28v4No1 / 22
619amnondominant feces, control, united states of america, research facility, mus musculus, mouse, seattle, colonized germ free2020-05-04v3No1 / 22
655amnondominant in patients after hematopoietic stem cell transplant (dominant feces, homo sapiens, italy, after hcst, hematopoietic stem cell transplant)2020-09-13v3No1 / 22
713amnoncommon feces, homo sapiens, remission, crohn's disease2028-05-21v3No1 / 22
797amnoncommon feces, homo sapiens, infant, germany, formula fed, 12-month-old human stage2021-06-13v3No1 / 23
641amnoncommon feces, united states of america, research facility, juvenile organism, state of georgia, green turtle, chelonia mydas, juvenile2020-08-23v3No1 / 24
641amnondominant feces, united states of america, research facility, juvenile organism, state of georgia, green turtle, chelonia mydas, juvenile2020-08-23v3No1 / 24
853amnondominant research facility, caecum, oryctolagus cuniculus, french republic, cecal content, rabbit, juvenile, age 5 weeks, hyplus rabbit, exclusive breastmilk diet2021-12-20v3No1 / 24
714amnondominant homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 25
651amnon high in female compared to male in feces homo sapiens united states of america adult state of alabama 2020-09-13v4No1 / 28
211amnon high in female compared to male in feces united states of america research facility mus musculus diet high fat diet mouse 2017-10-22v4No1 / 30
333amnonhigher in stroke patients compared to healthy controls ( high in stroke compared to control in feces homo sapiens adult guangzhou city prefecture china )2018-05-15v4No1 / 30
390amnoncommon feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 31
655amnoncommon in patients before hematopoietic stem cell transplant (common feces, homo sapiens, italy, before hsct)2020-09-13v3No1 / 31
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 7 months 2021-06-13v3No1 / 31
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 34
284amnon high in 12-month-old human stage compared to age 2 months in feces homo sapiens female infant state of california 2018-01-27v4No1 / 35
233amnon high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens united states of america infant 2017-11-05v4No1 / 37
320amnonhigher in CD patients with remission ( high in remission compared to crohn's disease in feces homo sapiens adult )2018-04-19v4No1 / 38
797amnon high in 3-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 39
19amnoncommon in biopsies of children (IBD study) (common homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children)2016-11-14v4No1 / 40
714amnoncommon homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 40
825amnoncommon feces, homo sapiens, control, child, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 40
859amnon high in formula fed compared to breast fed in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 6-month-old human stage 2022-01-12v4No1 / 41
241amnonhigher in babies from finland compared to estonia ( high in finland compared to estonia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 45
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, 1-year-old human stage2018-01-14v4No1 / 46
428amnon high in acute pancreatitis pancreatitis compared to control in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 46
651amnoncommon feces, homo sapiens, united states of america, adult, state of alabama, parkinson's disease2020-09-13v4No1 / 49
797amnoncommon feces, homo sapiens, child, germany, breast fed, 2-year-old human stage2021-06-13v3No1 / 50
797amnon high in infant 12-month-old human stage compared to child 2-year-old human stage in feces homo sapiens germany formula fed 2021-06-13v3No1 / 52
292amnoncommon feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 53
292amnoncommon feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 55
368amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of virginia, systemic lupus erythematosus2018-09-03v4No1 / 56
650amnon high in female compared to male in feces homo sapiens united states of america adult state of new york 2020-09-10v4No1 / 57
814amnonhigher after 2 months of caloric restriction diet ( high in caloric restriction diet compared to control diet in feces homo sapiens female obesity adult obese body mass index status germany high bmi overweight body mass index status age 50-70 years )2021-06-30v4No1 / 58
63amnonhigher in individuals with low physical activity ( high in little physical activity compared to physical activity in feces homo sapiens united states of america )2017-12-04v4No1 / 59
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in diet american diet compared to cron diet caloric restriction diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 61
619amnoncommon feces, control, united states of america, research facility, mus musculus, mouse, seattle, colonized germ free2020-05-04v3No1 / 61
530amnoncommon feces, farm, hunan province, adula, snake, snake farm, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 63
671amnon high in age 1 month compared to 3-month-old human stage in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 64
619amnoncommon feces, united states of america, research facility, cystic fibrosis, mus musculus, mouse, seattle, cftr s489x, colonized germ free2020-05-04v3No1 / 64
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
644amnon high in female compared to male in feces homo sapiens united states of america adult hispanic or latin american 2020-08-31v4No1 / 69
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany 1-month-old human stage 2021-06-13v3No1 / 69
448amnon high in equine grass sickness disease compared to control in feces farm equus caballus horse united kingdom 2019-01-08v4No1 / 72
859amnon high in 6-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 2022-01-12v4No1 / 72
810amnoncommon in sea turtle feces from sea turtle rescue center (common feces, research facility, mediterranean sea, italy, adriatic sea coastal waters of italy, caretta caretta, loggerhead sea turtle)2021-06-22v3No1 / 72
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany 3-month-old human stage 2021-06-13v3No1 / 75
516amnoncommon feces, homo sapiens, united states of america, adult, state of ohio2019-05-29v4No1 / 77
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic ampicillin neomycin compared to control in feces research facility caecum rattus norvegicus sprague dawley switzerland rat )2018-12-20v4No1 / 80
292amnoncommon feces, homo sapiens, control, adult, china2018-02-05v4No1 / 81
590amnoncommon farm, intestine, age 3-5 weeks, china, hainan autonomous prefecture, trachemys scripta elegans, red-eared slider turtle, turtle farm2020-02-10v4No1 / 83
530amnoncommon feces, farm, hunan province, adula, snake, snake farm, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 86
62amnon high in united states of america compared to egypt in feces homo sapiens child obsolete_juvenile stage 2017-02-13v4No1 / 88
530amnoncommon feces, farm, hunan province, adula, snake, snake farm, naja atra, chinese cobra, china2019-07-21v4No1 / 90
293amnonhigher in lean participants in human feces ( high in low bmi compared to high bmi in feces homo sapiens united states of america adult )2018-02-07v4No1 / 96
853amnoncommon research facility, caecum, oryctolagus cuniculus, french republic, cecal content, rabbit, juvenile, age 5 weeks, hyplus rabbit, exclusive breastmilk diet2021-12-20v3No1 / 96
538amnon high in taconic farms compared to jackson laboratories in research facility ileum mus musculus c57bl/6 terminal ileum canada mouse age 8 weeks 2019-07-29v4No1 / 104
215amnoncommon feces, homo sapiens, united states of america2017-10-23v4No1 / 107
538amnon high in taconic farms compared to jackson laboratories in research facility colon right colon mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 108
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy site biopsy compared to feces in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 118
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in feces homo sapiens toronto )2016-10-27v4No1 / 125
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to myanmar karen in feces homo sapiens thailand rural community )2018-11-18v4No1 / 135
538amnon high in taconic farms compared to jackson laboratories in feces research facility mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 135
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 148
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 169
521amnoncommon in pre-weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 169
529amnoncommon in patients that underwent low anterior resection (common feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years 2-year-old human stage 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant )2017-11-13v4No1 / 173
530amnoncommon feces, farm, hunan province, adula, snake, deinagkistrodon acutus, pit viper, snake farm, china2019-07-21v4No1 / 178
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in child obsolete_juvenile stage crohn's disease compared to control adult in feces homo sapiens glasgow )2017-02-26v4No1 / 185
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
669amnon high in 12-month-old human stage compared to 2-month-old human stage in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 217
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
214amnonlower in mice from jackson laboratories compared to taconic farms ( high in taconic farms compared to jackson laboratories in feces united states of america research facility mus musculus mouse strain 129s )2017-10-23v4No1 / 232
53amnon high in lima shantytown compared to el salado small village in feces homo sapiens city 2017-01-21v4No1 / 236
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v4No1 / 239
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v4No1 / 281
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v4No1 / 295
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v3No1 / 347
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to research facility captive in feces canada province of ontario algonquin provincial park peromyscus maniculatus deer mice age 3-5 weeks )2019-07-28v3No1 / 358
63amnon high in female compared to male in feces homo sapiens united states of america 2017-12-04v4No1 / 384
582amnon high in rectum perianal skin compared to external acoustic meatus ear canal in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 400
666amnoncommon feces, italy, rat, rattus rattus2020-09-25v3No1 / 406
438amnonhigher in centenarians compared to adults ( high in age >94 ninth decade human stage tenth decade human stage compared to 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 474
650amnon high in caucasian european compared to asian in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 475
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age 1-year-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant finland )2017-11-12v4No1 / 567
729amnon high in zoological garden captive europe compared to wild cameroon in feces gorilla gorilla monkey 2021-01-05v3No1 / 656

Problems / suggestions? Please email info AT dbbact DOT org