Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTATGGCAAGTCTGATGTGAAAGGCCAGGGCTCAACCCTGGGACTGCATTGGAAACTGTCGAACTAGAGTGTCGGAGAGGCAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.497346
feces0.427872
adult0.366497
child0.194444
obsolete_juvenile stage0.167300
united states of america0.150873
city0.144928
india0.122271
rural community0.104803
control0.100304
zoological garden0.085227
infant0.079051
canada0.075000
china0.074475
LOWER IN child0.072727
LOWER IN crohn's disease0.070796
state of colorado0.067797
age0.065041
female0.062893
small village0.055556
age 5-13 years0.055300
gay0.055300
new delhi0.054545
homosexual0.054545
msm0.054545
age 30-500.054545
age 130.054545
biopsy0.053812
finland0.052402
jiangsu province0.051724
kingdom of norway0.051724
juvenile organism0.051724
rectum0.051064
duodenum0.051064
italy0.050420
state of california0.045283
colon0.045283
caecum0.043796
papio anubis0.037383
sudan0.037037
kebbi state0.037037
age 10-15 years0.037037
bangladesh0.037037
denver0.037037
age 30 days0.037037
dairy0.037037
thailand0.037037
lima0.037037
shantytown0.037037
toronto zoo0.037037
age >940.037037
glasgow0.037037
oslo0.037037
age 30-400.037037
age 13-140.037037
toronto0.037037
LOWER IN age 3-60.037037
hadza0.037037
LOWER IN age < 1 year0.037037
age 60-790.037037
chuquisaca department0.037037
colombia0.036697
LOWER IN infant0.036697
nigeria0.036364
tanzania0.036364
kingdom of denmark0.036364
ulcerative colitis0.036036
LOWER IN ulcerative colitis0.036036
high bmi0.035714
biopsy site0.035714
small intestine0.035714
hunter gatherer0.035714
bolivia0.035714
united kingdom0.035398
state of tennessee0.035088
germany0.034783
ovis aries0.034483
captive0.034483
kingdom of spain0.032258
skin0.025974
janvier labs0.018868
age 18 weeks0.018868
LOWER IN no fructose diet0.018868
high sugar diet0.018868
LOWER IN type i diabetes mellitus0.018868
columbia0.018868
normal stool0.018868
LOWER IN hard stool0.018868
endospore enriched fraction0.018868
lysis0.018868
LOWER IN urinary schistosomiasis0.018868
LOWER IN schistosomiasis0.018868
quito0.018868
LOWER IN egypt0.018868
hmong0.018868
azerbaijan0.018868
commonwealth of pennsylvania0.018868
LOWER IN inflammatory bowel disease0.018868
mild0.018868
LOWER IN severe0.018868
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.500000
small village0.750000
india0.666667
age 5-13 years0.666667
gay0.666667
LOWER IN child0.666667
papio anubis0.666667
rural community0.571429
janvier labs0.500000
age 18 weeks0.500000
LOWER IN no fructose diet0.500000
high sugar diet0.500000
sudan0.500000
LOWER IN type i diabetes mellitus0.500000
columbia0.500000
normal stool0.500000
LOWER IN hard stool0.500000
endospore enriched fraction0.500000
lysis0.500000
kebbi state0.500000
age 10-15 years0.500000
LOWER IN urinary schistosomiasis0.500000
LOWER IN schistosomiasis0.500000
new delhi0.500000
bangladesh0.500000
quito0.500000
denver0.500000
homosexual0.500000
msm0.500000
LOWER IN egypt0.500000
age 30 days0.500000
dairy0.500000
thailand0.500000
hmong0.500000
azerbaijan0.500000
commonwealth of pennsylvania0.500000
LOWER IN inflammatory bowel disease0.500000
lima0.500000
shantytown0.500000
mild0.500000
LOWER IN severe0.500000
canis lupus arctos0.500000
arctic wolf0.500000
toronto zoo0.500000
age 30-500.500000
irritable bowel syndrome0.500000
age >940.500000
glasgow0.500000
oslo0.500000
age 30-400.500000
myanmar0.500000
karen0.500000
cron diet0.500000
age 13-140.500000
age 130.500000
toronto0.500000
LOWER IN india0.500000
el salvador0.500000
age 8-120.500000
LOWER IN age 3-60.500000
hadza0.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
spondyloarthritis0.500000
spondylitis0.500000
atherosclerosis0.500000
LOWER IN el salado0.500000
bogota0.500000
LOWER IN municipality of santiago de cali0.500000
LOWER IN bucaramanga0.500000
LOWER IN barranquilla0.500000
age 1-20.500000
LOWER IN age 0-10.500000
tunapuco0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
peromyscus maniculatus0.500000
deer mice0.500000
age 3-5 weeks0.500000
province of ontario0.500000
algonquin provincial park0.500000
zambia0.500000
baboon0.500000
papio0.500000
LOWER IN papio kindae0.500000
LOWER IN papio ursinus0.500000
pan troglodytes0.500000
chimpanzee0.500000
africa0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
sigmoid colon0.500000
children0.500000
age 60-790.500000
LOWER IN age 8-120.500000
age one year0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.884615
homo sapiens0.884615
adult0.413462
united states of america0.288462
child0.134615
control0.115385
obsolete_juvenile stage0.105769
china0.105769
city0.096154
india0.067308
rural community0.057692
female0.048077
zoological garden0.048077
infant0.048077
state of colorado0.038462
LOWER IN child0.038462
LOWER IN crohn's disease0.038462
canada0.038462
age0.038462
new delhi0.028846
state of california0.028846
age 5-13 years0.028846
italy0.028846
homosexual0.028846
gay0.028846
msm0.028846
caecum0.028846
colon0.028846
rectum0.028846
biopsy0.028846
jiangsu province0.028846
age 30-500.028846
duodenum0.028846
kingdom of norway0.028846
age 130.028846
juvenile organism0.028846
finland0.028846
small village0.028846
germany0.019231
sudan0.019231
LOWER IN control0.019231
nigeria0.019231
kebbi state0.019231
age 10-15 years0.019231
bangladesh0.019231
ulcerative colitis0.019231
high bmi0.019231
denver0.019231
ovis aries0.019231
age 30 days0.019231
dairy0.019231
thailand0.019231
colombia0.019231
biopsy site0.019231
LOWER IN ulcerative colitis0.019231
lima0.019231
shantytown0.019231
toronto zoo0.019231
captive0.019231
skin0.019231
kingdom of spain0.019231
small intestine0.019231
age >940.019231
glasgow0.019231
oslo0.019231
age 30-400.019231
age 13-140.019231
toronto0.019231
LOWER IN infant0.019231
united kingdom0.019231
LOWER IN age 3-60.019231
tanzania0.019231
hadza0.019231
hunter gatherer0.019231
LOWER IN age < 1 year0.019231
kingdom of denmark0.019231
papio anubis0.019231
state of tennessee0.019231
age 60-790.019231
bolivia0.019231
chuquisaca department0.019231
mouse0.009615
mus musculus0.009615
research facility0.009615
c57bl/6j0.009615
janvier labs0.009615
age 18 weeks0.009615
fructose diet0.009615
LOWER IN no fructose diet0.009615
high sugar diet0.009615
fructose0.009615
LOWER IN type i diabetes mellitus0.009615
LOWER IN diabetes mellitus0.009615
columbia0.009615
normal stool0.009615
LOWER IN hard stool0.009615
endospore enriched fraction0.009615
lysis0.009615
LOWER IN urinary schistosomiasis0.009615
LOWER IN schistosomiasis0.009615
Exp. ID User ID Description Date Region Flag Sequences
522amnonhigher in fructose supplemented diets ( high in fructose diet fructose compared to no fructose diet in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks high sugar diet )2019-07-03v3No1 / 13
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces child obsolete_juvenile stage sudan 2018-08-30v4No1 / 14
404amnon high in normal stool compared to hard stool in homo sapiens feces columbia city adult 2018-11-20v4No1 / 21
401amnonhigher in endospore enriched (lysis resistant) replicates ( high in endospore enriched fraction lysis compared to control in homo sapiens feces united states of america adult )2018-11-18v4No1 / 31
509amnon high in control compared to urinary schistosomiasis schistosomiasis in feces homo sapiens nigeria kebbi state rural community child age 10-15 years 2019-03-18v4No1 / 35
352amnoncommon homo sapiens, feces, new delhi, india2018-07-30v4No1 / 41
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 44
121amnoncommon homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 50
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
339amnoncommon homo sapiens, feces, adult, india2018-05-24v4No1 / 81
562amnoncommon age 5-13 years, child, ecuador, quito, feces2019-11-05v4No1 / 82
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 85
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 94
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
363amnon high in caecum colon rectum compared to rumen ruminant reticulum omasum in ovis aries age 30 days obsolete_juvenile stage italy dairy 2018-08-29v4No1 / 101
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
565amnoncommon canis lupus arctos, arctic wolf, toronto zoo, captive, zoological garden, canada, skin2019-11-21v3No1 / 114
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 121
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
344amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to heterosexual msw in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 124
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 125
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to biopsy rectum biopsy site in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 126
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 138
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens united states of america feces )2017-04-11v4No1 / 139
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 168
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon adult, homo sapiens, china, feces2019-11-24v4No1 / 221
10amnonpositively correlated with age (6-35) ( high in adult compared to child in homo sapiens feces toronto )2016-10-27v4No1 / 228
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 237
404amnon high in medellin metropolitan area bogota compared to municipality of santiago de cali bucaramanga barranquilla in homo sapiens feces adult colombia city 2018-11-20v4No1 / 237
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to captive research facility in feces canada peromyscus maniculatus deer mice age 3-5 weeks province of ontario algonquin provincial park )2019-07-28v3No1 / 358
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
565amnoncommon toronto zoo, captive, zoological garden, olive baboon, papio anubis, canada, skin2019-11-21v3No1 / 368
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752

Problems / suggestions? Please email info AT dbbact DOT org