Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTATGGCAAGTCTGATGTGAAAGGCCAGGGCTCAACCCTGGGACTGCATTGGAAACTGTCGAACTAGAGTGTCGGAGAGGCAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.515906
feces0.429501
adult0.374465
child0.190012
obsolete_juvenile stage0.172549
united states of america0.155525
city0.149254
india0.126697
rural community0.108597
control0.104928
infant0.081633
LOWER IN child0.075472
LOWER IN crohn's disease0.073394
state of colorado0.070175
age0.067227
female0.065217
china0.064516
small village0.057692
homosexual0.057416
gay0.057416
msm0.057416
new delhi0.056604
age 30-500.056604
age 130.056604
biopsy0.055814
zoological garden0.055814
finland0.054299
jiangsu province0.053571
duodenum0.053571
kingdom of norway0.053571
juvenile organism0.053571
italy0.052863
rectum0.052863
colon0.047244
state of california0.046693
caecum0.045627
sudan0.038462
kebbi state0.038462
age 10-15 years0.038462
bangladesh0.038462
denver0.038462
age 30 days0.038462
dairy0.038462
thailand0.038462
lima0.038462
shantytown0.038462
age >940.038462
glasgow0.038462
oslo0.038462
age 30-400.038462
age 13-140.038462
toronto0.038462
LOWER IN age 3-60.038462
hadza0.038462
LOWER IN age < 1 year0.038462
age 60-790.038462
chuquisaca department0.038462
age 5-13 years0.038462
colombia0.038095
LOWER IN infant0.038095
nigeria0.037736
tanzania0.037736
kingdom of denmark0.037736
ulcerative colitis0.037383
LOWER IN ulcerative colitis0.037383
high bmi0.037037
biopsy site0.037037
small intestine0.037037
hunter gatherer0.037037
bolivia0.037037
united kingdom0.036697
state of tennessee0.036364
germany0.036036
ovis aries0.035714
canada0.035088
kingdom of spain0.033333
high sugar diet0.019608
LOWER IN no fructose diet0.019608
age 18 weeks0.019608
janvier labs0.019608
LOWER IN type i diabetes mellitus0.019608
columbia0.019608
normal stool0.019608
LOWER IN hard stool0.019608
endospore enriched fraction0.019608
lysis0.019608
LOWER IN schistosomiasis0.019608
LOWER IN urinary schistosomiasis0.019608
LOWER IN egypt0.019608
hmong0.019608
azerbaijan0.019608
commonwealth of pennsylvania0.019608
LOWER IN inflammatory bowel disease0.019608
mild0.019608
LOWER IN severe0.019608
irritable bowel syndrome0.019608
myanmar0.019608
karen0.019608
cron diet0.019608
LOWER IN india0.019608
Fraction of dbbact annotations with this term covered by the query
TermScore
small village0.750000
india0.666667
homosexual0.666667
gay0.666667
msm0.666667
LOWER IN child0.666667
rural community0.571429
high sugar diet0.500000
LOWER IN no fructose diet0.500000
age 18 weeks0.500000
janvier labs0.500000
sudan0.500000
LOWER IN type i diabetes mellitus0.500000
columbia0.500000
normal stool0.500000
LOWER IN hard stool0.500000
endospore enriched fraction0.500000
lysis0.500000
kebbi state0.500000
age 10-15 years0.500000
LOWER IN schistosomiasis0.500000
LOWER IN urinary schistosomiasis0.500000
new delhi0.500000
bangladesh0.500000
denver0.500000
LOWER IN egypt0.500000
age 30 days0.500000
dairy0.500000
thailand0.500000
hmong0.500000
azerbaijan0.500000
commonwealth of pennsylvania0.500000
LOWER IN inflammatory bowel disease0.500000
lima0.500000
shantytown0.500000
mild0.500000
LOWER IN severe0.500000
age 30-500.500000
irritable bowel syndrome0.500000
age >940.500000
glasgow0.500000
oslo0.500000
age 30-400.500000
myanmar0.500000
karen0.500000
cron diet0.500000
age 13-140.500000
age 130.500000
toronto0.500000
LOWER IN india0.500000
el salvador0.500000
age 8-120.500000
LOWER IN age 3-60.500000
hadza0.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
spondylitis0.500000
spondyloarthritis0.500000
atherosclerosis0.500000
LOWER IN el salado0.500000
bogota0.500000
LOWER IN municipality of santiago de cali0.500000
LOWER IN bucaramanga0.500000
LOWER IN barranquilla0.500000
age 1-20.500000
LOWER IN age 0-10.500000
tunapuco0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
algonquin provincial park0.500000
province of ontario0.500000
age 3-5 weeks0.500000
deer mice0.500000
peromyscus maniculatus0.500000
zambia0.500000
baboon0.500000
papio0.500000
papio anubis0.500000
LOWER IN papio kindae0.500000
LOWER IN papio ursinus0.500000
pan troglodytes0.500000
chimpanzee0.500000
africa0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
sigmoid colon0.500000
children0.500000
age 60-790.500000
LOWER IN age 8-120.500000
age one year0.500000
LOWER IN age one month0.500000
LOWER IN age <1 year0.500000
LOWER IN forearm0.500000
LOWER IN arm0.500000
chuquisaca department0.500000
age 5-13 years0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.910000
feces0.900000
adult0.420000
united states of america0.300000
child0.130000
control0.120000
obsolete_juvenile stage0.110000
city0.100000
china0.100000
india0.070000
rural community0.060000
female0.050000
infant0.050000
state of colorado0.040000
LOWER IN child0.040000
LOWER IN crohn's disease0.040000
age0.040000
new delhi0.030000
state of california0.030000
italy0.030000
homosexual0.030000
gay0.030000
msm0.030000
caecum0.030000
colon0.030000
rectum0.030000
biopsy0.030000
jiangsu province0.030000
age 30-500.030000
duodenum0.030000
kingdom of norway0.030000
age 130.030000
juvenile organism0.030000
finland0.030000
small village0.030000
zoological garden0.030000
germany0.020000
sudan0.020000
LOWER IN control0.020000
nigeria0.020000
kebbi state0.020000
age 10-15 years0.020000
bangladesh0.020000
ulcerative colitis0.020000
high bmi0.020000
denver0.020000
ovis aries0.020000
age 30 days0.020000
dairy0.020000
thailand0.020000
colombia0.020000
biopsy site0.020000
LOWER IN ulcerative colitis0.020000
lima0.020000
shantytown0.020000
kingdom of spain0.020000
small intestine0.020000
age >940.020000
glasgow0.020000
oslo0.020000
age 30-400.020000
age 13-140.020000
toronto0.020000
LOWER IN infant0.020000
united kingdom0.020000
LOWER IN age 3-60.020000
tanzania0.020000
hadza0.020000
hunter gatherer0.020000
LOWER IN age < 1 year0.020000
canada0.020000
kingdom of denmark0.020000
state of tennessee0.020000
age 60-790.020000
chuquisaca department0.020000
bolivia0.020000
age 5-13 years0.020000
fructose0.010000
high sugar diet0.010000
LOWER IN no fructose diet0.010000
fructose diet0.010000
age 18 weeks0.010000
janvier labs0.010000
c57bl/6j0.010000
research facility0.010000
mus musculus0.010000
mouse0.010000
LOWER IN type i diabetes mellitus0.010000
LOWER IN diabetes mellitus0.010000
columbia0.010000
normal stool0.010000
LOWER IN hard stool0.010000
endospore enriched fraction0.010000
lysis0.010000
LOWER IN schistosomiasis0.010000
LOWER IN urinary schistosomiasis0.010000
msw0.010000
heterosexual0.010000
obesity0.010000
LOWER IN egypt0.010000
Exp. ID User ID Description Date Region Flag Sequences
522amnonhigher in fructose supplemented diets ( high in fructose fructose diet compared to no fructose diet in high sugar diet age 18 weeks janvier labs c57bl/6j female research facility germany feces mus musculus mouse )2019-07-03v3No1 / 13
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces child obsolete_juvenile stage sudan 2018-08-30v4No1 / 14
404amnon high in normal stool compared to hard stool in homo sapiens feces columbia city adult 2018-11-20v4No1 / 21
401amnonhigher in endospore enriched (lysis resistant) replicates ( high in endospore enriched fraction lysis compared to control in homo sapiens feces united states of america adult )2018-11-18v4No1 / 31
509amnon high in control compared to schistosomiasis urinary schistosomiasis in feces homo sapiens nigeria kebbi state rural community child age 10-15 years 2019-03-18v4No1 / 35
352amnoncommon homo sapiens, feces, india, new delhi2018-07-30v4No1 / 41
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 44
121amnoncommon homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 50
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
339amnoncommon homo sapiens, feces, india, adult2018-05-24v4No1 / 81
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
247amnoncommon homo sapiens, italy, feces, obesity, high bmi2017-11-21v4No1 / 85
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 94
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
363amnon high in caecum colon rectum compared to rumen ruminant reticulum omasum in ovis aries age 30 days obsolete_juvenile stage italy dairy 2018-08-29v4No1 / 101
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to ulcerative colitis severe in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
438amnoncommon feces, homo sapiens, china, jiangsu province, age 30-50, adult2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, india, new delhi, duodenum, small intestine)2018-07-30v4No1 / 121
438amnoncommon feces, homo sapiens, china, age >94, jiangsu province, adult2018-12-30v4No1 / 121
344amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to heterosexual msw in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 124
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to crohn's disease obsolete_juvenile stage child in glasgow feces homo sapiens )2017-02-26v4No1 / 125
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to biopsy rectum biopsy site in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 126
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, china, jiangsu province, age 13-142018-12-30v4No1 / 134
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 138
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens united states of america feces )2017-04-11v4No1 / 139
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
290amnoncommon homo sapiens, feces, china, adult, city2018-02-01v4No1 / 162
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 168
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
312amnoncommon feces, homo sapiens, french republic, adult, spondylitis, spondyloarthritis2018-04-09v4No1 / 197
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, china, adult, small village, rural community2018-02-01v4No1 / 218
10amnonpositively correlated with age (6-35) ( high in adult compared to child in homo sapiens feces toronto )2016-10-27v4No1 / 228
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 237
404amnon high in medellin metropolitan area bogota compared to municipality of santiago de cali bucaramanga barranquilla in homo sapiens feces adult colombia city 2018-11-20v4No1 / 237
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces india infant )2016-12-19v4No1 / 253
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
299amnon high in cancer mouth neoplasm compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to research facility captive in algonquin provincial park province of ontario age 3-5 weeks deer mice peromyscus maniculatus canada feces )2019-07-28v3No1 / 358
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
352amnon high in small intestine duodenum compared to feces in homo sapiens india new delhi 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
517amnon high in feces compared to forearm arm skin in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
517amnon high in feces compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 752

Problems / suggestions? Please email info AT dbbact DOT org