Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTCAAGCAAGTCAGAAGTGAAAGGCTGGGGCTCAACCCCGGGACTGCTTTTGAAACTGTTTGACTGGAGTGCTGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.559519
adult0.463920
feces0.463652
united states of america0.178044
child0.171254
control0.152064
china0.126582
city0.110345
sus scrofa0.106061
pig0.106061
obsolete_juvenile stage0.095238
india0.084388
biopsy0.083799
LOWER IN crohn's disease0.083333
rectum0.079365
united kingdom0.074906
infant0.074906
small village0.068768
canada0.068493
caecum0.068493
LOWER IN ulcerative colitis0.067797
algonquin provincial park0.067227
province of ontario0.067227
age 3-5 weeks0.067227
deer mice0.067227
peromyscus maniculatus0.067227
biopsy site0.067227
rural community0.066482
ileum0.065753
age0.061538
kingdom of spain0.061069
female0.060852
colon0.059259
africa0.051282
LOWER IN child0.051282
left colon0.051282
state of michigan0.050847
LOWER IN duodenum0.050847
right colon0.050633
kingdom of norway0.048780
ethiopia0.048780
monkey0.044444
farm0.041667
wild0.040816
amerindian0.035088
venezuela0.035088
central african republic0.034783
bangui0.034783
taipei city0.034783
taiwan0.034783
nanchang city prefecture0.034783
thailand0.034783
hunter gatherer0.034783
oslo0.034783
age 30-400.034783
cron diet0.034783
toronto0.034783
el salvador0.034783
LOWER IN finland0.034783
age 130.034783
LOWER IN age < 1 year0.034783
age 50-60 years0.034783
nanning city prefecture0.034783
mongolian sheep0.034783
chlorocebus aethiops0.034783
chuquisaca department0.034783
age 5-13 years0.034783
colombia0.034483
LOWER IN infant0.034483
tibet autonomous region0.034188
caloric restriction diet0.034188
jiangxi province0.034188
south america0.034188
kingdom of denmark0.034188
juvenile organism0.033613
bolivia0.033613
commonwealth of virginia0.033058
tibetan plateau0.033058
belgium0.032520
ovis aries0.032520
state of colorado0.032000
LOWER IN feces0.031746
state of california0.030769
research facility0.019231
daycare0.017699
age 1-5 years0.017699
trichuriasis0.017699
LOWER IN schizophrenia0.017699
mild0.017699
LOWER IN severe0.017699
guangzhou city prefecture0.017699
LOWER IN stroke0.017699
salmonella gastroenteritis0.017699
age 17-290.017699
age 200.017699
hmong0.017699
azerbaijan0.017699
intestinal contents0.017699
commonwealth of pennsylvania0.017699
LOWER IN inflammatory bowel disease0.017699
Fraction of dbbact annotations with this term covered by the query
TermScore
small village0.750000
amerindian0.666667
venezuela0.666667
india0.666667
biopsy0.600000
LOWER IN ulcerative colitis0.571429
LOWER IN crohn's disease0.555556
daycare0.500000
age 1-5 years0.500000
trichuriasis0.500000
algonquin provincial park0.500000
province of ontario0.500000
age 3-5 weeks0.500000
deer mice0.500000
peromyscus maniculatus0.500000
LOWER IN schizophrenia0.500000
biopsy site0.500000
mild0.500000
LOWER IN severe0.500000
guangzhou city prefecture0.500000
LOWER IN stroke0.500000
salmonella gastroenteritis0.500000
age 17-290.500000
africa0.500000
central african republic0.500000
bangui0.500000
taipei city0.500000
taiwan0.500000
age 200.500000
nanchang city prefecture0.500000
thailand0.500000
hmong0.500000
azerbaijan0.500000
intestinal contents0.500000
commonwealth of pennsylvania0.500000
LOWER IN child0.500000
LOWER IN inflammatory bowel disease0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
left colon0.500000
irritable bowel syndrome0.500000
LOWER IN irritable bowel syndrome0.500000
hunter gatherer0.500000
oslo0.500000
age 30-400.500000
myanmar0.500000
karen0.500000
cron diet0.500000
toronto0.500000
physical activity0.500000
LOWER IN little physical activity0.500000
el salvador0.500000
cholelithiasis0.500000
bile0.500000
gallbladder0.500000
estonia0.500000
LOWER IN finland0.500000
age<17 years0.500000
LOWER IN age 1-3 weeks0.500000
suckling0.500000
age 2-4 weeks0.500000
preweaned0.500000
age 130.500000
low anterior resection0.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
low income0.500000
LOWER IN sewer0.500000
LOWER IN wastewater treatment plant0.500000
new delhi0.500000
spondylitis0.500000
spondyloarthritis0.500000
atherosclerosis0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
age 1-20.500000
LOWER IN age 0-10.500000
bangladesh0.500000
tunapuco0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
corn and soybean diet0.500000
age 4-7 weeks0.500000
weaned0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
LOWER IN lima0.500000
LOWER IN shantytown0.500000
LOWER IN age 18 weeks0.500000
LOWER IN high sugar diet0.500000
janvier labs0.500000
mongolian sheep0.500000
cecum0.500000
LOWER IN short bowel syndrome0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
chlorocebus aethiops0.500000
grivet monkey0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.855856
homo sapiens0.837838
adult0.468468
united states of america0.297297
control0.189189
china0.135135
child0.108108
city0.072072
sus scrofa0.063063
pig0.063063
obsolete_juvenile stage0.054054
canada0.045045
biopsy0.045045
rectum0.045045
female0.045045
united kingdom0.045045
caecum0.045045
LOWER IN crohn's disease0.045045
infant0.045045
india0.045045
algonquin provincial park0.036036
province of ontario0.036036
age 3-5 weeks0.036036
deer mice0.036036
peromyscus maniculatus0.036036
biopsy site0.036036
LOWER IN ulcerative colitis0.036036
colon0.036036
ileum0.036036
kingdom of spain0.036036
small village0.036036
age0.036036
rural community0.036036
wild0.027027
kingdom of norway0.027027
state of michigan0.027027
africa0.027027
right colon0.027027
LOWER IN child0.027027
left colon0.027027
farm0.027027
LOWER IN duodenum0.027027
monkey0.027027
ethiopia0.027027
colombia0.018018
LOWER IN control0.018018
commonwealth of virginia0.018018
tibet autonomous region0.018018
tibetan plateau0.018018
LOWER IN feces0.018018
central african republic0.018018
bangui0.018018
taipei city0.018018
taiwan0.018018
state of colorado0.018018
state of california0.018018
nanchang city prefecture0.018018
thailand0.018018
belgium0.018018
hunter gatherer0.018018
amerindian0.018018
venezuela0.018018
research facility0.018018
oslo0.018018
age 30-400.018018
cron diet0.018018
caloric restriction diet0.018018
toronto0.018018
LOWER IN infant0.018018
el salvador0.018018
LOWER IN finland0.018018
jiangxi province0.018018
age 130.018018
juvenile organism0.018018
LOWER IN age < 1 year0.018018
south america0.018018
age 50-60 years0.018018
nanning city prefecture0.018018
kingdom of denmark0.018018
mongolian sheep0.018018
ovis aries0.018018
chlorocebus aethiops0.018018
chuquisaca department0.018018
bolivia0.018018
age 5-13 years0.018018
medellin metropolitan area0.009009
daycare0.009009
age 1-5 years0.009009
trichuriasis0.009009
LOWER IN schizophrenia0.009009
mild0.009009
LOWER IN severe0.009009
guangzhou city prefecture0.009009
LOWER IN stroke0.009009
LOWER IN systemic lupus erythematosus0.009009
diarrhea0.009009
australia0.009009
hospital0.009009
salmonella gastroenteritis0.009009
age 17-290.009009
Exp. ID User ID Description Date Region Flag Sequences
482amnonhigher in kids with parasitic worms compared to non-infected kids ( high in trichuriasis compared to control in homo sapiens feces colombia medellin metropolitan area child daycare age 1-5 years )2019-02-12v4No1 / 6
537amnonhigh freq. in feces of wild caught deer mice feces (highfreq wild, algonquin provincial park, province of ontario, age 3-5 weeks, deer mice, peromyscus maniculatus, canada, feces)2019-07-28v3No1 / 10
502amnon high in control compared to schizophrenia in homo sapiens feces adult united states of america 2019-03-12v4No1 / 14
410amnonlower in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to ulcerative colitis severe in homo sapiens child united states of america biopsy biopsy site rectum )2018-11-22v4No1 / 26
333amnonlower in stroke patients compared to healthy controls ( high in control compared to stroke in homo sapiens feces china guangzhou city prefecture adult )2018-05-15v4No1 / 30
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 39
390amnoncommon homo sapiens, feces, diarrhea, australia, hospital, salmonella gastroenteritis2018-11-04v4No1 / 55
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
194amnon high in colon ileum compared to feces in homo sapiens kingdom of norway 2017-09-07v4No1 / 67
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 79
529amnoncommon control, adult, taipei city, taiwan, feces, homo sapiens2019-07-18v3No1 / 79
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
428amnoncommon homo sapiens, adult, feces, china, nanchang city prefecture, control2018-12-09v4No1 / 93
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in sus scrofa pig united kingdom caecum )2017-11-26v4No1 / 103
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
294amnon high in control compared to irritable bowel syndrome in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 121
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
537amnoncommon in feces of captive grown deer mice feces (common captive, research facility, algonquin provincial park, province of ontario, age 3-5 weeks, deer mice, peromyscus maniculatus, canada, feces)2019-07-28v3No1 / 121
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in homo sapiens feces united states of america )2017-12-04v4No1 / 140
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common cholelithiasis, kingdom of spain, adult, bile, gallbladder, homo sapiens)2019-07-14v3No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens china adult feces 2018-02-05v4No1 / 161
290amnoncommon homo sapiens, feces, china, adult, city2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
537amnoncommon in feces of wild caught deer mice feces (common wild, algonquin provincial park, province of ontario, age 3-5 weeks, deer mice, peromyscus maniculatus, canada, feces)2019-07-28v3No1 / 163
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
521amnoncommon in pre-weaned pigs (common suckling, age 2-4 weeks, preweaned, jiangxi province, farm, china, feces, sus scrofa, pig)2019-07-02v3No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common low anterior resection, adult, taipei city, taiwan, feces, homo sapiens)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 188
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
352amnon high in feces compared to small intestine duodenum in homo sapiens india new delhi 2018-07-30v4No1 / 190
312amnoncommon feces, homo sapiens, french republic, adult, spondylitis, spondyloarthritis2018-04-09v4No1 / 197
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, china, adult, small village, rural community2018-02-01v4No1 / 218
10amnonpositively correlated with age (6-35) ( high in adult compared to child in homo sapiens feces toronto )2016-10-27v4No1 / 228
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, nephrolithiasis)2018-01-27v4No1 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces india infant )2016-12-19v4No1 / 253
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, control)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces china nanchang city prefecture 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common corn and soybean diet, age 4-7 weeks, weaned, jiangxi province, farm, china, feces, sus scrofa, pig)2019-07-02v3No1 / 288
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
299amnon high in cancer mouth neoplasm compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
522amnon high in age 6 weeks mouse chow compared to age 18 weeks high sugar diet in janvier labs c57bl/6j female research facility germany feces mus musculus mouse 2019-07-03v3No1 / 325
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
111amnoncommon mongolian sheep, china, ovis aries, rectum, ileum, cecum, colon2017-04-09v4No1 / 330
532amnon high in control compared to short bowel syndrome in adult czech republic feces homo sapiens 2019-07-21v1No1 / 334
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to research facility captive in algonquin provincial park province of ontario age 3-5 weeks deer mice peromyscus maniculatus canada feces )2019-07-28v3No1 / 358
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
256amnoncommon sus scrofa, pig, united kingdom, duodenum, jejunum, ileum2017-11-26v4No1 / 380
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
111amnon high in rectum caecum ileum colon compared to rumen ruminant reticulum omasum in mongolian sheep china ovis aries 2017-04-09v4No1 / 464
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
256amnoncommon sus scrofa, pig, united kingdom, caecum, right colon, left colon2017-11-26v4No1 / 490
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
517amnon high in feces compared to forearm arm skin in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 606
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 752

Problems / suggestions? Please email info AT dbbact DOT org