Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTCAAGCAAGTCAGAAGTGAAAGGCTGGGGCTCAACCCCGGGACTGCTTTTGAAACTGTTTGACTGGAGTGCTGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.522862
feces0.443777
adult0.422937
canada0.289655
united states of america0.165884
child0.145203
captive0.143713
control0.137886
china0.137667
zoological garden0.100457
city0.096970
african lion safari0.096552
sus scrofa0.092105
pig0.092105
obsolete_juvenile stage0.082192
farm0.075812
india0.072202
biopsy0.071770
LOWER IN crohn's disease0.071429
rectum0.068493
united kingdom0.065147
infant0.065147
skin0.060264
caecum0.059642
small village0.058680
LOWER IN ulcerative colitis0.057971
toronto zoo0.057554
peromyscus maniculatus0.057554
deer mice0.057554
age 3-5 weeks0.057554
province of ontario0.057554
algonquin provincial park0.057554
biopsy site0.057554
rural community0.057007
ileum0.056471
tibetan plateau0.055944
female0.053763
age0.053333
kingdom of spain0.052980
colon0.051173
africa0.043796
LOWER IN child0.043796
left colon0.043796
state of michigan0.043478
right colon0.043321
LOWER IN duodenum0.043165
kingdom of norway0.041958
ethiopia0.041958
monkey0.038710
wild0.035928
amerindian0.029851
venezuela0.029851
red kangaroo0.029630
macropus rufus0.029630
eland0.029630
tragelaphus oryx0.029630
central african republic0.029630
bangui0.029630
taiwan0.029630
taipei city0.029630
nanchang city prefecture0.029630
thailand0.029630
hunter gatherer0.029630
oslo0.029630
age 30-400.029630
cron diet0.029630
toronto0.029630
el salvador0.029630
LOWER IN finland0.029630
age 130.029630
LOWER IN age < 1 year0.029630
age 50-60 years0.029630
nanning city prefecture0.029630
mongolian sheep0.029630
ruminal fluid0.029630
alpine meadow0.029630
chlorocebus aethiops0.029630
chuquisaca department0.029630
colombia0.029412
LOWER IN infant0.029412
giraffe0.029197
tibet autonomous region0.029197
czech republic0.029197
caloric restriction diet0.029197
jiangxi province0.029197
south america0.029197
kingdom of denmark0.029197
yak0.029197
age 5-13 years0.029197
giraffa camelopardalis0.028777
juvenile organism0.028777
bos grunniens0.028777
bolivia0.028777
commonwealth of virginia0.028369
ovis aries0.027972
cow0.027586
state of colorado0.027586
belgium0.027586
LOWER IN feces0.027397
state of california0.026667
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.500000
small village0.750000
amerindian0.666667
venezuela0.666667
india0.666667
biopsy0.600000
LOWER IN ulcerative colitis0.571429
LOWER IN crohn's disease0.555556
daycare0.500000
age 1-5 years0.500000
trichuriasis0.500000
african lion safari0.500000
red kangaroo0.500000
macropus rufus0.500000
toronto zoo0.500000
eland0.500000
tragelaphus oryx0.500000
peromyscus maniculatus0.500000
deer mice0.500000
age 3-5 weeks0.500000
province of ontario0.500000
algonquin provincial park0.500000
LOWER IN schizophrenia0.500000
biopsy site0.500000
mild0.500000
LOWER IN severe0.500000
guangzhou city prefecture0.500000
LOWER IN stroke0.500000
salmonella gastroenteritis0.500000
age 17-290.500000
africa0.500000
central african republic0.500000
bangui0.500000
taiwan0.500000
taipei city0.500000
fruit bat0.500000
eidolon helvum0.500000
age 200.500000
nanchang city prefecture0.500000
thailand0.500000
hmong0.500000
azerbaijan0.500000
intestinal contents0.500000
eastern gray squirrel0.500000
sciurus carolinensis0.500000
commonwealth of pennsylvania0.500000
LOWER IN child0.500000
LOWER IN inflammatory bowel disease0.500000
indian flying fox0.500000
pteropus giganteus0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
left colon0.500000
irritable bowel syndrome0.500000
LOWER IN irritable bowel syndrome0.500000
hunter gatherer0.500000
oslo0.500000
age 30-400.500000
myanmar0.500000
karen0.500000
cron diet0.500000
toronto0.500000
physical activity0.500000
LOWER IN little physical activity0.500000
el salvador0.500000
gallbladder0.500000
bile0.500000
cholelithiasis0.500000
estonia0.500000
LOWER IN finland0.500000
age<17 years0.500000
LOWER IN age 1-3 weeks0.500000
preweaned0.500000
age 2-4 weeks0.500000
suckling0.500000
age 130.500000
low anterior resection0.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
low income0.500000
LOWER IN sewer0.500000
LOWER IN wastewater treatment plant0.500000
new delhi0.500000
spondyloarthritis0.500000
spondylitis0.500000
barbary sheep0.500000
ammotragus lervia0.500000
atherosclerosis0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
age 1-20.500000
LOWER IN age 0-10.500000
bangladesh0.500000
tunapuco0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.740458
homo sapiens0.725191
adult0.404580
united states of america0.251908
canada0.160305
control0.160305
china0.137405
skin0.122137
child0.091603
captive0.091603
zoological garden0.083969
city0.061069
african lion safari0.053435
farm0.053435
sus scrofa0.053435
pig0.053435
obsolete_juvenile stage0.045802
biopsy0.038168
rectum0.038168
female0.038168
caecum0.038168
united kingdom0.038168
LOWER IN crohn's disease0.038168
infant0.038168
india0.038168
toronto zoo0.030534
peromyscus maniculatus0.030534
deer mice0.030534
age 3-5 weeks0.030534
province of ontario0.030534
algonquin provincial park0.030534
biopsy site0.030534
LOWER IN ulcerative colitis0.030534
tibetan plateau0.030534
colon0.030534
ileum0.030534
kingdom of spain0.030534
small village0.030534
age0.030534
rural community0.030534
wild0.022901
kingdom of norway0.022901
state of michigan0.022901
africa0.022901
right colon0.022901
LOWER IN child0.022901
left colon0.022901
LOWER IN duodenum0.022901
monkey0.022901
ethiopia0.022901
colombia0.015267
LOWER IN control0.015267
red kangaroo0.015267
macropus rufus0.015267
eland0.015267
tragelaphus oryx0.015267
cow0.015267
bos taurus0.015267
giraffe0.015267
giraffa camelopardalis0.015267
commonwealth of virginia0.015267
tibet autonomous region0.015267
LOWER IN feces0.015267
czech republic0.015267
central african republic0.015267
bangui0.015267
taiwan0.015267
taipei city0.015267
state of colorado0.015267
state of california0.015267
nanchang city prefecture0.015267
thailand0.015267
belgium0.015267
hunter gatherer0.015267
amerindian0.015267
venezuela0.015267
research facility0.015267
oslo0.015267
age 30-400.015267
cron diet0.015267
caloric restriction diet0.015267
toronto0.015267
LOWER IN infant0.015267
el salvador0.015267
LOWER IN finland0.015267
jiangxi province0.015267
age 130.015267
juvenile organism0.015267
LOWER IN age < 1 year0.015267
south america0.015267
age 50-60 years0.015267
nanning city prefecture0.015267
kingdom of denmark0.015267
mongolian sheep0.015267
ovis aries0.015267
ruminal fluid0.015267
rumen0.015267
alpine meadow0.015267
yak0.015267
bos grunniens0.015267
Exp. ID User ID Description Date Region Flag Sequences
482amnonhigher in kids with parasitic worms compared to non-infected kids ( high in trichuriasis compared to control in homo sapiens feces colombia medellin metropolitan area child daycare age 1-5 years )2019-02-12v4No1 / 6
565amnonhighfreq african lion safari, captive, zoological garden, red kangaroo, macropus rufus, canada, skin2019-11-21v3No1 / 9
565amnonhighfreq toronto zoo, eland, tragelaphus oryx, captive, zoological garden, canada, skin2019-11-21v3No1 / 10
537amnonhigh freq. in feces of wild caught deer mice feces (highfreq feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, wild)2019-07-28v3No1 / 10
565amnonhighfreq cow, bos taurus, farm, canada, skin2019-11-21v3No1 / 12
502amnon high in control compared to schizophrenia in homo sapiens feces adult united states of america 2019-03-12v4No1 / 14
565amnonhighfreq giraffe, giraffa camelopardalis, african lion safari, captive, zoological garden, canada, skin2019-11-21v3No1 / 18
410amnonlower in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america biopsy biopsy site rectum )2018-11-22v4No1 / 26
333amnonlower in stroke patients compared to healthy controls ( high in control compared to stroke in homo sapiens feces guangzhou city prefecture adult china )2018-05-15v4No1 / 30
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 39
390amnoncommon homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v4No1 / 55
565amnoncommon farm, horse, equus caballus, canada, skin2019-11-21v3No1 / 58
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
194amnon high in colon ileum compared to feces in homo sapiens kingdom of norway 2017-09-07v4No1 / 67
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 79
529amnoncommon homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v3No1 / 79
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
565amnoncommon captive, toronto zoo, zoological garden, fruit bat, eidolon helvum, canada, skin2019-11-21v3No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in sus scrofa pig caecum united kingdom )2017-11-26v4No1 / 103
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
565amnoncommon eastern gray squirrel, sciurus carolinensis, canada, skin2019-11-21v3No1 / 104
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
565amnoncommon african lion safari, captive, zoological garden, indian flying fox, pteropus giganteus, canada, skin2019-11-21v3No1 / 109
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
294amnon high in control compared to irritable bowel syndrome in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 121
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
537amnoncommon in feces of captive grown deer mice feces (common feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, research facility, captive)2019-07-28v3No1 / 121
565amnoncommon white rhinoceros, ceratotherium simum, african lion safari, captive, zoological garden, canada, skin2019-11-21v3No1 / 122
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in homo sapiens feces united states of america )2017-12-04v4No1 / 140
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens adult feces china 2018-02-05v4No1 / 161
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
537amnoncommon in feces of wild caught deer mice feces (common feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, wild)2019-07-28v3No1 / 163
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
521amnoncommon in pre-weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 188
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
565amnoncommon african lion safari, captive, zoological garden, barbary sheep, ammotragus lervia, canada, skin2019-11-21v3No1 / 205
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon adult, homo sapiens, china, feces2019-11-24v4No1 / 221
10amnonpositively correlated with age (6-35) ( high in adult compared to child in homo sapiens feces toronto )2016-10-27v4No1 / 228
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
565amnoncommon giraffe, giraffa camelopardalis, african lion safari, captive, zoological garden, canada, skin2019-11-21v3No1 / 310
565amnoncommon cow, bos taurus, farm, canada, skin2019-11-21v3No1 / 318
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
522amnon high in mouse chow age 6 weeks compared to high sugar diet age 18 weeks in mouse mus musculus feces germany research facility female c57bl/6j janvier labs 2019-07-03v3No1 / 325
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
111amnoncommon mongolian sheep, ovis aries, rectum, ileum, cecum, colon, china2017-04-09v4No1 / 330
532amnon high in control compared to short bowel syndrome in homo sapiens feces czech republic adult 2019-07-21v1No1 / 334
565amnoncommon farm, donkey, equus asinus africanus, canada, skin2019-11-21v3No1 / 335
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to captive research facility in feces canada peromyscus maniculatus deer mice age 3-5 weeks province of ontario algonquin provincial park )2019-07-28v3No1 / 358
565amnoncommon african lion safari, captive, zoological garden, red kangaroo, macropus rufus, canada, skin2019-11-21v3No1 / 360
565amnoncommon toronto zoo, captive, zoological garden, olive baboon, papio anubis, canada, skin2019-11-21v3No1 / 368
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
561amnon high in spring green stage diet compared to grass growth diet summer in ruminal fluid rumen alpine meadow tibetan plateau china yak bos grunniens 2019-11-05v3No1 / 397
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
111amnon high in rectum caecum ileum colon compared to rumen ruminant reticulum omasum in mongolian sheep ovis aries china 2017-04-09v4No1 / 464
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
561amnoncommon ruminal fluid, rumen, alpine meadow, tibetan plateau, china, yak, bos grunniens2019-11-05v3No1 / 670
565amnoncommon toronto zoo, eland, tragelaphus oryx, captive, zoological garden, canada, skin2019-11-21v3No1 / 674
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752

Problems / suggestions? Please email info AT dbbact DOT org