Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGTGGCAAGTCTGATGTGAAAGGCATGGGCTCAACCTGTGGACTGCATTGGAAACTGTCATACTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.672359
feces0.638344
adult0.410285
united states of america0.304201
child0.217391
china0.184218
infant0.130818
control0.130531
city0.114064
obsolete_juvenile stage0.105541
rural community0.094752
pig0.077778
sus scrofa0.077778
female0.075355
jiangsu province0.062016
monkey0.055710
state of california0.052980
farm0.051948
biopsy0.051392
zoological garden0.050420
kingdom of spain0.049793
italy0.048780
state of colorado0.048583
research facility0.047498
state of michigan0.045688
age < 3 years0.045584
finland0.044734
biopsy site0.040191
age 5-13 years0.040057
india0.040057
river0.038889
age0.038763
canis lupus familiaris0.038330
united kingdom0.037787
state of oklahoma0.034483
nigeria0.034483
ulcerative colitis0.034335
state of tennessee0.033898
kingdom of denmark0.033613
water0.033373
dog0.033241
skin0.031873
caecum0.031332
canada0.029070
msw0.028860
heterosexual0.028860
age 2-4 years0.028653
himalayas0.028653
commonwealth of pennsylvania0.028653
chuquisaca department0.028653
rectum0.028551
thailand0.028249
nepal0.028249
crohn's disease0.028249
age 1 year0.028249
kingdom of norway0.027855
bolivia0.027855
commonwealth of virginia0.027473
australia0.027473
fresh water0.027100
colombia0.023256
small village0.023233
wastewater treatment plant0.023233
gay0.023188
metabolic syndrome0.023188
tonsil0.023188
clostridium difficile intestinal infectious disease0.023144
sea urchin0.023055
hmong0.023055
msm0.023055
homosexual0.023055
left colon0.023055
zambia0.023055
age 60-790.023055
age 130.023055
denver0.023055
obesity0.023055
oslo0.023055
kebbi state0.023055
age 10-15 years0.023055
age 30-500.023055
ethiopia0.023055
sprague dawley0.022967
right colon0.022923
high bmi0.022879
jiangxi province0.022792
lytechinus variegatus0.022792
czech republic0.022792
diarrhea0.022663
juvenile organism0.022535
rat0.022535
wild0.020672
state of florida0.020460
male0.017595
LOWER IN age < 1 year0.017493
hunter gatherer0.017493
LOWER IN rural community0.017442
weaned0.017391
age 4-7 weeks0.017391
corn and soybean diet0.017391
Fraction of dbbact annotations with this term covered by the query
TermScore
male1.500000
canada1.000000
rural community0.857143
biopsy0.800000
colombia0.800000
biopsy site0.750000
small village0.750000
LOWER IN age < 1 year0.750000
hunter gatherer0.750000
wastewater treatment plant0.750000
state of michigan0.714286
state of oklahoma0.666667
pig0.666667
sus scrofa0.666667
gay0.666667
nigeria0.666667
age < 3 years0.666667
msw0.666667
heterosexual0.666667
metabolic syndrome0.666667
age 5-13 years0.666667
india0.666667
age > 1 year0.666667
tonsil0.666667
amerindian0.666667
venezuela0.666667
gorilla gorilla0.666667
papio anubis0.666667
olive baboon0.666667
clostridium difficile intestinal infectious disease0.600000
child0.600000
LOWER IN rural community0.600000
homo sapiens0.584906
ulcerative colitis0.571429
adult0.518987
feces0.512315
LOWER IN native american0.500000
american0.500000
LOWER IN arapaho0.500000
LOWER IN cheyenne0.500000
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
sea urchin0.500000
eagle harbor0.500000
hmong0.500000
msm0.500000
homosexual0.500000
karen0.500000
myanmar0.500000
age >940.500000
age 2-4 years0.500000
tursiops truncatus0.500000
bottlenosed dolphin0.500000
left colon0.500000
schizophrenia0.500000
obsolete_juvenile stage0.500000
azerbaijan0.500000
pan troglodytes0.500000
chimpanzee0.500000
zoological garden0.500000
zambia0.500000
monkey0.500000
papio kindae0.500000
kinda baboon0.500000
cron diet0.500000
irritable bowel syndrome0.500000
age 200.500000
bangladesh0.500000
age 60-790.500000
atherosclerosis0.500000
himalayas0.500000
tharu0.500000
agrarian0.500000
LOWER IN chepang0.500000
LOWER IN forager0.500000
age 130.500000
native american0.500000
arapaho0.500000
cheyenne0.500000
age one year0.500000
denver0.500000
age 17-290.500000
obesity0.500000
oslo0.500000
age 30-400.500000
columbia0.500000
normal stool0.500000
LOWER IN hard stool0.500000
age<17 years0.500000
commonwealth of pennsylvania0.500000
inflammatory bowel disease0.500000
kebbi state0.500000
age 10-15 years0.500000
toronto0.500000
el salvador0.500000
glasgow0.500000
estonia0.500000
spondyloarthritis0.500000
spondylitis0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.846608
homo sapiens0.790560
united states of america0.359882
adult0.339233
china0.159292
child0.132743
control0.103245
infant0.076696
city0.064897
obsolete_juvenile stage0.058997
female0.050147
rural community0.050147
pig0.041298
sus scrofa0.041298
research facility0.035398
jiangsu province0.035398
state of california0.035398
farm0.029499
monkey0.029499
state of colorado0.026549
italy0.026549
biopsy0.026549
zoological garden0.026549
kingdom of spain0.026549
finland0.023599
state of michigan0.023599
age < 3 years0.023599
biopsy site0.020649
united kingdom0.020649
canis lupus familiaris0.020649
age 5-13 years0.020649
india0.020649
age0.020649
river0.020649
water0.020649
state of oklahoma0.017699
skin0.017699
state of tennessee0.017699
nigeria0.017699
kingdom of denmark0.017699
ulcerative colitis0.017699
dog0.017699
caecum0.017699
thailand0.014749
age 2-4 years0.014749
commonwealth of virginia0.014749
canada0.014749
himalayas0.014749
nepal0.014749
crohn's disease0.014749
kingdom of norway0.014749
msw0.014749
heterosexual0.014749
commonwealth of pennsylvania0.014749
age 1 year0.014749
rectum0.014749
australia0.014749
bolivia0.014749
chuquisaca department0.014749
fresh water0.014749
jiangxi province0.011799
sea urchin0.011799
lytechinus variegatus0.011799
state of florida0.011799
hmong0.011799
clostridium difficile intestinal infectious disease0.011799
msm0.011799
gay0.011799
homosexual0.011799
left colon0.011799
zambia0.011799
wild0.011799
age 60-790.011799
age 130.011799
juvenile organism0.011799
denver0.011799
right colon0.011799
high bmi0.011799
obesity0.011799
oslo0.011799
diarrhea0.011799
metabolic syndrome0.011799
kebbi state0.011799
age 10-15 years0.011799
czech republic0.011799
small village0.011799
age 30-500.011799
colombia0.011799
sprague dawley0.011799
rat0.011799
tonsil0.011799
wastewater treatment plant0.011799
ethiopia0.011799
weaned0.008850
age 4-7 weeks0.008850
corn and soybean diet0.008850
eagle harbor0.008850
age >940.008850
papio kindae0.008850
kinda baboon0.008850
Exp. ID User ID Description Date Region Flag Sequences
242amnonlower in native-americans compared to non native-american ( high in american compared to native american arapaho cheyenne in homo sapiens feces united states of america state of oklahoma )2017-11-14v4No1 / 6
521amnonhigh freq. in weaned pigs (highfreq pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 9
351amnoncommon sea urchin, lytechinus variegatus, research facility, eagle harbor, state of florida, united states of america, digestive system2018-07-30v4No1 / 11
400amnonhigh freq. in hmong (chinese) females from thailand (highfreq homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 13
185amnoncommon in patients with c. diff infection before treatment (common homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 14
393amnonhighfreq homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 14
400amnonhigh freq. in karen (burma) females from thailand (highfreq homo sapiens, feces, adult, female, thailand, karen, myanmar)2018-11-18v4No1 / 14
438amnonhighfreq feces, homo sapiens, age >94, adult, jiangsu province, china2018-12-30v4No1 / 14
564amnon high in control compared to autistic disorder in feces italy age 2-4 years child homo sapiens 2019-11-18v3No1 / 14
51amnonhighfreq feces, homo sapiens, united states of america2017-01-19v4No1 / 15
74amnonhighfreq united states of america, feces, homo sapiens2017-02-27v4No1 / 15
79amnoncommon skin, united states of america, tursiops truncatus, bottlenosed dolphin2017-03-03v4No1 / 15
276amnonhighfreq feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 15
409amnonhighfreq homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 15
502amnonhighfreq homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 15
51amnonhighfreq homo sapiens, biopsy site, biopsy, united states of america2017-01-19v4No1 / 16
365amnonhighfreq homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 16
399amnonhighfreq pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 16
411amnonhighfreq zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 16
365amnonhighfreq homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 17
368amnon high in systemic lupus erythematosus compared to control in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 17
368amnonhighfreq feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 17
400amnonhigh freq. in feces of european american females (highfreq homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 17
293amnonhighfreq homo sapiens, feces, adult, united states of america, cron diet, caloric restriction diet2018-02-07v4No1 / 18
294amnonhighfreq homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 18
294amnonhigh freq. in non-IBS healthy controls (highfreq homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 18
368amnonhighfreq feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 18
430amnonhighfreq homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 18
564amnonhighfreq control, feces, italy, age 2-4 years, child, homo sapiens2019-11-18v3No1 / 18
62amnonhighfreq homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 19
121amnonhighfreq homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 19
401amnonhighfreq homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 19
438amnonhighfreq feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 19
455amnonhighfreq homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 19
477amnonhigher in agrarian tharu population compared to foraging chepang population ( high in tharu agrarian compared to chepang forager in homo sapiens feces adult himalayas nepal rural community )2019-01-28v4No1 / 19
477amnonhighfreq homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 19
516amnonhighfreq homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 19
197amnonhighfreq feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 20
242amnonhigh freq. in native-americans (highfreq homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 20
273amnonhighfreq feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-14v4No1 / 20
284amnoncommon homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v4No1 / 20
284amnonhighfreq homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v4No1 / 20
344amnonhigh freq. in feces of homosexual males (highfreq homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 20
394amnonhighfreq homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 20
409amnonhighfreq homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 20
484amnonhighfreq feces, adult, age 17-29, united states of america, state of michigan, homo sapiens2019-02-13v4No1 / 20
564amnonhighfreq autistic disorder, feces, italy, age 2-4 years, child, homo sapiens2019-11-18v3No1 / 20
122amnonhighfreq homo sapiens, feces, united kingdom2017-04-13v4No1 / 21
240amnonhigh freq. in infants age <3 years (highfreq homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 21
241amnonhigh freq. in babies age < 3 years in finland (highfreq homo sapiens, feces, infant, age < 3 years, finland)2017-11-13v4No1 / 21
247amnonhighfreq homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 21
249amnonhighfreq homo sapiens, feces, united states of america2017-11-22v4No1 / 21
320amnonhighfreq homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 21
330amnonhighfreq homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 21
393amnonhighfreq homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 21
398amnonhigh freq. in feces of healthy adults from belgium (highfreq homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 21
404amnon high in normal stool compared to hard stool in homo sapiens feces columbia city adult 2018-11-20v4No1 / 21
409amnonhighfreq homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 21
94amnonhighfreq homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 22
185amnonhigh freq. in patients with c. diff infection before treatment (highfreq homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 22
284amnonhighfreq homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 22
293amnonhighfreq homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 22
297amnonhighfreq homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 22
395amnonhighfreq homo sapiens, feces, united states of america, commonwealth of pennsylvania, child, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 22
467amnonhighfreq homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 22
502amnonhighfreq homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 22
509amnonhighfreq feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 22
552amnonhighfreq feces, homo sapiens, czech republic2019-09-05v3No1 / 22
10amnonhighfreq homo sapiens, feces, toronto2016-10-27v4No1 / 23
53amnonhighfreq homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 23
73amnonhighfreq homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 23
132amnonhighfreq homo sapiens, feces, united states of america2017-04-16v4No1 / 23
241amnonhigh freq. in babies age < 3 years in russia (highfreq homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 23
241amnoncommon in babies age < 3 years in finland (common homo sapiens, feces, infant, age < 3 years, finland)2017-11-13v4No1 / 23
241amnonhigh freq. in babies age < 3 years in estonia (highfreq homo sapiens, feces, infant, age < 3 years, estonia)2017-11-13v4No1 / 23
284amnonhighfreq homo sapiens, female, feces, state of california, infant, age 1 year2018-01-27v4No1 / 23
303amnonhighfreq homo sapiens, feces, germany, adult2018-03-12v4No1 / 23
312amnonhighfreq feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 23
344amnonhigh freq. in feces of heterosexuals (highfreq homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 23
394amnonhighfreq homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 23
487amnonhighfreq homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 23
509amnonhighfreq feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 23
150amnonhighfreq canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 24
239amnonhighfreq homo sapiens, feces, united states of america2017-11-08v4No1 / 24
241amnoncommon in babies age < 3 years in estonia (common homo sapiens, feces, infant, age < 3 years, estonia)2017-11-13v4No1 / 24
330amnonhighfreq homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 24
365amnonhighfreq homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 24
395amnonhighfreq homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 24
566amnonhighfreq adult, homo sapiens, china, feces2019-11-24v4No1 / 24
53amnonhighfreq lima, homo sapiens, feces, city, shantytown2017-01-21v4No1 / 25
284amnoncommon homo sapiens, female, feces, state of california, infant, age 6 months2018-01-27v4No1 / 25
290amnonhighfreq homo sapiens, feces, adult, city, china2018-02-01v4No1 / 25
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, child, ulcerative colitis, inflammatory bowel disease, crohn's disease2018-11-14v4No1 / 25
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, pancreatitis, acute pancreatitis, china2018-12-09v4No1 / 25
62amnonhighfreq homo sapiens, feces, obsolete_juvenile stage, child, united states of america2017-02-13v4No1 / 26
410amnonlower in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america biopsy biopsy site rectum )2018-11-22v4No1 / 26
438amnonhighfreq feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 26
438amnonhighfreq homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 27
319amnonhighfreq homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 28
365amnonhighfreq homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 28
562amnonhighfreq age 5-13 years, child, ecuador, quito, feces2019-11-05v4No1 / 28
438amnonhighfreq homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 29
284amnoncommon homo sapiens, female, feces, state of california, infant, age 1 year2018-01-27v4No1 / 30
320amnoncommon homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 30
438amnonhighfreq homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 30
45amnoncommon in feces babies age 0-2 in india (common homo sapiens, feces, infant, india)2016-12-19v4No1 / 31
390amnoncommon homo sapiens, feces, clostridium difficile intestinal infectious disease, australia, hospital, diarrhea2018-11-04v4No1 / 31
411amnonhigher in wild baboons feeding on discarded human foods ( high in human contact compared to low human contact in zambia feces papio kindae wild monkey kinda baboon )2018-11-23v4No1 / 33
269amnondecreases during one month in refrigeration of yao meat ( high in fresh early timepoint compared to late timpoint food spoilage in china foodon product type )2018-01-09v4No1 / 34
24amnondisappears on transition to cow milk ( high in breast milk compared to mammalian milk beverage in homo sapiens feces infant )2016-12-01v4No1 / 35
284amnon high in age 1 year compared to age 2 months in homo sapiens female feces state of california infant 2018-01-27v4No1 / 35
240amnoncommon in infants age <3 years (common homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 36
191amnonlower in preterm birth vaginal samples ( high in control compared to premature birth in homo sapiens vagina female united states of america pregnancy )2017-09-05v4No1 / 37
233amnon high in age age > 1 year compared to age < 1 year in feces homo sapiens infant united states of america 2017-11-05v4No1 / 37
51amnoncommon homo sapiens, biopsy site, biopsy, united states of america2017-01-19v4No1 / 38
390amnoncommon homo sapiens, feces, australia, hospital, diarrhea2018-11-04v4No1 / 38
74amnonHigher in plant diet compared to animal product diet ( high in diet plant diet compared to animal product diet in homo sapiens feces united states of america )2017-02-27v4No1 / 39
131amnonnegatively correlated with age (30-80 years) ( high in age age 30-50 years compared to age 50-80 years in homo sapiens feces south korea )2017-04-16v4No1 / 39
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 39
19amnoncommon in biopsies of children (IBD study) (common rectum, terminal ileum, sigmoid colon, caecum, colon, biopsy, children, homo sapiens, united states of america)2016-11-14v4No1 / 40
352amnoncommon homo sapiens, feces, new delhi, india2018-07-30v4No1 / 41
400amnonhigher in children of hmong migrands born in the usa compared to non-migrant usa people ( high in hmong 2nd generation hmong compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 41
51amnoncommon feces, homo sapiens, united states of america2017-01-19v4No1 / 42
564amnoncommon autistic disorder, feces, italy, age 2-4 years, child, homo sapiens2019-11-18v3No1 / 42
36amnoncommon homo sapiens, feces, sichuan province2016-12-06v4No1 / 44
241amnoncommon in babies age < 3 years in russia (common homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 44
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 44
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-14v4No1 / 46
482amnoncommon homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, age 1-5 years2019-02-12v4No1 / 47
221amnonhigher in control compared to tnbs induced colitis in rat feces ( high in control compared to colitis in rattus sprague dawley rat feces research facility china )2017-10-25v4No1 / 49
121amnoncommon homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 50
564amnoncommon control, feces, italy, age 2-4 years, child, homo sapiens2019-11-18v3No1 / 50
292amnoncommon homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
292amnoncommon homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 55
390amnoncommon homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v4No1 / 55
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
488amnonlower in feces of dogs with lymphoma compared to healthy controls ( high in control compared to lymphoma in canis lupus familiaris dog feces italy )2019-02-25v4No1 / 56
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in american diet diet compared to cron diet caloric restriction diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 61
333amnoncommon in healthy controls feces (common homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 61
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 63
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 66
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
72amnoncommon canis lupus familiaris, feces, united states of america, iowa2017-02-25v4No1 / 69
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 4 weeks2018-11-04v4No1 / 71
425amnoncommon homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 73
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
74amnoncommon united states of america, feces, homo sapiens2017-02-27v4No1 / 76
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v4No1 / 76
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
122amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 77
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 77
556amnoncommon homo sapiens, feces, united states of america, adult2019-09-14v1No1 / 77
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 79
529amnoncommon homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v3No1 / 79
203amnonnegatively correlated with age in child dental plaque ( high in young age compared to age old age in homo sapiens oral cavity dentition australia obsolete_juvenile stage mouth )2017-10-01v4No1 / 80
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v4No1 / 81
339amnoncommon homo sapiens, feces, adult, india2018-05-24v4No1 / 81
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
562amnoncommon age 5-13 years, child, ecuador, quito, feces2019-11-05v4No1 / 82
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 85
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
488amnoncommon canis lupus familiaris, dog, feces, italy, control2019-02-25v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 97
532amnoncommon homo sapiens, feces, czech republic, adult, control2019-07-21v1No1 / 98
455amnoncommon homo sapiens, adult, canada, saliva, atherosclerosis2019-01-10v4No1 / 100
438amnoncommon homo sapiens, feces, age 19-24, china2018-12-30v4No1 / 101
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in sus scrofa pig caecum united kingdom )2017-11-26v4No1 / 103
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
273amnon high in age age one month compared to age one week in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 107
393amnon high in heterosexual msw compared to gay homosexual msm in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
399amnoncommon feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 108
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
438amnoncommon feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 111
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 112
269amnoncommon in fresh yao meat food (common china, foodon product type)2018-01-09v4No1 / 113
517amnoncommon feces, homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department2019-05-29v4No1 / 113
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v4No1 / 120
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 121
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 121
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 126
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to biopsy rectum biopsy site in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 126
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
39amnoncommon in obese lepr-db mice (common mus musculus, research facility, feces, obesity)2016-12-09v4No1 / 132
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, obese body mass index status, db/db mouse, obesity2017-10-22v4No1 / 137
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 138
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens united states of america feces )2017-04-11v4No1 / 139
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 146
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
521amnoncommon in pre-weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
402amnon high in zone 1 compared to zone 2,3 in sediment soil mine tailing alkaline mine tailing guangxi zhuang autonomous region china 2018-11-18v4No1 / 189
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
411amnoncommon zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 200
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
150amnoncommon canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 208
388amnon high in age 6-10 weeks compared to age 12-19 weeks in pig sus scrofa tonsil farm united states of america state of michigan 2018-11-03v4No1 / 210
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon adult, homo sapiens, china, feces2019-11-24v4No1 / 221
411amnoncommon zambia, feces, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 224
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
351amnoncommon sea urchin, lytechinus variegatus, research facility, eagle harbor, state of florida, united states of america, feces2018-07-30v4No1 / 233
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 237
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, shelled egg2019-02-13v4No1 / 243
161amnoncommon in barn swallows in colorado (common hirundo rustica, feces, united states of america, colorado, barn swallow)2017-07-12v4No1 / 245
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
160amnoncommon in river water upstream of WTP effluent in spring in china (common river, water, spring, china)2017-07-12v4No1 / 278
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 279
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
419amnoncommon in rats with induced constipation (common rat, rattus norvegicus, sprague dawley, research facility, feces, constipation, china)2018-12-02v4No1 / 300
78amnon high in male compared to female in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v4No1 / 304
510amnoncommon kingdom of spain, water, estuary, estuary water, fresh water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
532amnon high in control compared to short bowel syndrome in homo sapiens feces czech republic adult 2019-07-21v1No1 / 334
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 343
254amnoncommon river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 347
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth 0.5m jiulong river fujian province china )2017-11-23v4No1 / 356
565amnoncommon african lion safari, captive, zoological garden, red kangaroo, macropus rufus, canada, skin2019-11-21v3No1 / 360
565amnoncommon toronto zoo, captive, zoological garden, olive baboon, papio anubis, canada, skin2019-11-21v3No1 / 368
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
442amnoncommon rattus norvegicus, rat, sprague dawley, male, research facility, feces, china2019-01-06v4No1 / 378
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
424amnoncommon sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 452
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
111amnon high in rectum caecum ileum colon compared to rumen ruminant reticulum omasum in mongolian sheep ovis aries china 2017-04-09v4No1 / 464
160amnoncommon in wastewater treatment plant effluent in autumn in china (common autumn, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 469
221amnoncommon rattus, sprague dawley, rat, feces, research facility, china2017-10-25v4No1 / 470
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
160amnoncommon in wastewater treatment plant effluent in spring in china (common wastewater treatment plant, effluent, spring, china)2017-07-12v4No1 / 573
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
200amnoncommon in river downstream of wastewater treatment plant (common river, fresh water, water, united states of america, wastewater treatment plant, effluent)2017-10-01v4No1 / 655
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
331amnon high in wet season compared to dry season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 818
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
193amnonhigher in nares of people working in dairy farms ( high in bos taurus farm compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
5amnoncommon periplaneta americana, digestive system, united states of america, wild type2016-10-13v4No1 / 1142
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181

Problems / suggestions? Please email info AT dbbact DOT org