Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGTGGCAAGTCTGATGTGAAAGGCATGGGCTCAACCTGTGGACTGCATTGGAAACTGTCATACTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
feces0.693062
homo sapiens0.674491
adult0.481275
united states of america0.285243
child0.193223
china0.187683
control0.139279
infant0.122024
female0.113405
research facility0.079973
monkey0.079156
zoological garden0.075591
pig0.073782
city0.072038
kingdom of spain0.071042
sus scrofa0.070377
rural community0.068478
germany0.066111
obsolete_juvenile stage0.063492
italy0.052809
obesity0.052345
state of california0.051576
macaca mulatta0.051447
male0.046832
captive0.046802
sweden0.043033
heterosexual0.039669
msw0.039669
farm0.039582
crohn's disease0.039088
12-month-old human stage0.038835
israel0.036474
biopsy0.036340
fourth decade human stage0.036274
wild0.036254
2-5 year-old child stage0.036164
pregnancy0.035948
state of colorado0.035787
jiangsu province0.034985
canada0.033820
gorilla gorilla0.033223
taiwan0.033149
homosexual0.033058
msm0.033058
amsterdam0.032787
rhesus macaque0.032787
state of minnesota0.032609
kingdom of the netherlands0.032258
state of new york0.032086
caecum0.032058
canis lupus familiaris0.031579
fifth decade human stage0.029900
ulcerative colitis0.029826
guangzhou city prefecture0.029752
dog0.028590
gay0.026637
nigeria0.026637
1-year-old human stage0.026637
republic of china0.026578
age < 3 years0.026578
india0.026543
state of michigan0.026473
finland0.026287
south korea0.025974
hiv infection0.025397
biopsy site0.023359
age 5-13 years0.023314
indonesia0.023179
municipality of yogyakarta0.023179
como zoo0.023179
high bmi0.023019
formula fed0.022913
commonwealth of pennsylvania0.022913
river0.022913
age0.022783
rat0.022654
japan0.022317
united kingdom0.022152
skin0.022006
water0.020401
state of oklahoma0.020033
2-year-old human stage0.019934
13-year-old human stage0.019934
state of tennessee0.019835
russia0.019802
male organism0.019544
kingdom of denmark0.019544
LOWER IN under-1-year-old human stage0.016750
ninth decade human stage0.016736
cameroon0.016736
breast fed0.016667
pan troglodytes0.016667
chimpanzee0.016667
systemic lupus erythematosus0.016667
ascending colon0.016667
province of alberta0.016667
himalayas0.016667
age 4-10 years0.016667
cayo santiago0.016667
indian rhesus macaque0.016667
Fraction of dbbact annotations with this term covered by the query
TermScore
rural community0.900000
gorilla gorilla0.833333
heterosexual0.800000
msw0.800000
gay0.750000
biopsy site0.750000
obesity0.750000
nigeria0.750000
1-year-old human stage0.750000
taiwan0.750000
fifth decade human stage0.750000
small village0.750000
obese body mass index status0.750000
hunter gatherer0.750000
biopsy0.714286
LOWER IN under-1-year-old human stage0.714286
pig0.687500
state of oklahoma0.666667
homosexual0.666667
msm0.666667
village0.666667
athlete0.666667
ninth decade human stage0.666667
tursiops truncatus0.666667
ulcerative colitis0.666667
age 1 month0.666667
republic of china0.666667
age < 3 years0.666667
fourth decade human stage0.666667
adolescent stage0.666667
metabolic syndrome0.666667
estonia0.666667
nanchang city prefecture0.666667
overweight body mass index status0.666667
sigmoid colon0.666667
age 5-13 years0.666667
LOWER IN human late adulthood stage0.666667
rheumatoid arthritis0.666667
colombia0.666667
young adult stage0.666667
venezuela0.666667
amerindian0.666667
LOWER IN canis lupus0.666667
LOWER IN wolf0.666667
cameroon0.666667
papio anubis0.666667
olive baboon0.666667
sus scrofa0.625000
india0.625000
homo sapiens0.604563
2-5 year-old child stage0.600000
monkey0.600000
parkinson's disease0.600000
guangzhou city prefecture0.600000
wastewater treatment plant0.600000
feces0.574675
adult0.562874
child0.555556
state of michigan0.555556
zoological garden0.533333
before hsct0.500000
LOWER IN after hcst0.500000
LOWER IN hematopoietic stem cell transplant0.500000
human immunodeficiency virus infectious disease0.500000
antiretroviral therapy0.500000
municipality of logrono0.500000
american0.500000
LOWER IN cheyenne0.500000
LOWER IN native american0.500000
LOWER IN arapaho0.500000
crohn's disease0.500000
amsterdam0.500000
weaned0.500000
corn and soybean diet0.500000
age 4-7 weeks0.500000
eagle harbor0.500000
sea urchin0.500000
tucson0.500000
hmong0.500000
republic of congo0.500000
nouabale-ndoki national park0.500000
infant0.500000
age 60-65 years0.500000
high exercise0.500000
clostridium difficile intestinal infectious disease0.500000
myanmar0.500000
karen0.500000
age >940.500000
tenth decade human stage0.500000
left colon0.500000
schizophrenia0.500000
bottlenosed dolphin0.500000
indonesia0.500000
municipality of yogyakarta0.500000
LOWER IN age 7 months0.500000
breast fed0.500000
azerbaijan0.500000
obsolete_juvenile stage0.500000
pan troglodytes0.500000
chimpanzee0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.872881
homo sapiens0.762712
adult0.420339
united states of america0.301695
china0.155932
child0.116949
control0.101695
female0.071186
infant0.069492
research facility0.062712
monkey0.042373
zoological garden0.040678
kingdom of spain0.038983
pig0.038983
city0.038983
germany0.038983
sus scrofa0.037288
rural community0.035593
obsolete_juvenile stage0.033898
state of california0.030508
italy0.028814
male0.028814
obesity0.027119
macaca mulatta0.027119
captive0.025424
sweden0.023729
farm0.022034
crohn's disease0.020339
jiangsu province0.020339
12-month-old human stage0.020339
wild0.020339
israel0.020339
heterosexual0.020339
msw0.020339
state of colorado0.018644
2-5 year-old child stage0.018644
biopsy0.018644
caecum0.018644
canada0.018644
pregnancy0.018644
fourth decade human stage0.018644
kingdom of the netherlands0.016949
amsterdam0.016949
homosexual0.016949
msm0.016949
state of minnesota0.016949
state of new york0.016949
rhesus macaque0.016949
taiwan0.016949
canis lupus familiaris0.016949
gorilla gorilla0.016949
ulcerative colitis0.015254
guangzhou city prefecture0.015254
fifth decade human stage0.015254
dog0.015254
hiv infection0.013559
gay0.013559
nigeria0.013559
finland0.013559
1-year-old human stage0.013559
state of michigan0.013559
republic of china0.013559
age < 3 years0.013559
south korea0.013559
india0.013559
biopsy site0.011864
skin0.011864
indonesia0.011864
municipality of yogyakarta0.011864
como zoo0.011864
rat0.011864
formula fed0.011864
united kingdom0.011864
high bmi0.011864
japan0.011864
commonwealth of pennsylvania0.011864
age 5-13 years0.011864
age0.011864
river0.011864
water0.011864
LOWER IN control0.010169
state of oklahoma0.010169
state of tennessee0.010169
russia0.010169
male organism0.010169
2-year-old human stage0.010169
13-year-old human stage0.010169
kingdom of denmark0.010169
thailand0.008475
ninth decade human stage0.008475
breast fed0.008475
pan troglodytes0.008475
chimpanzee0.008475
systemic lupus erythematosus0.008475
commonwealth of virginia0.008475
age 6 weeks0.008475
ascending colon0.008475
province of alberta0.008475
rattus norvegicus0.008475
nepal0.008475
Exp. ID User ID Description Date Region Flag Sequences
655amnon high in before hsct compared to after hcst hematopoietic stem cell transplant in feces homo sapiens italy 2020-09-13v3No1 / 4
794amnon high in hiv infection human immunodeficiency virus infectious disease antiretroviral therapy compared to control in feces homo sapiens adult kingdom of spain municipality of logrono 2021-06-08v4No1 / 5
242amnonlower in native-americans compared to non native-american ( high in american compared to cheyenne native american arapaho in feces homo sapiens united states of america state of oklahoma )2017-11-14v4No1 / 6
730amnon high in crohn's disease compared to control in feces homo sapiens child kingdom of the netherlands amsterdam 2021-01-05v1No1 / 7
521amnonhigh freq. in weaned pigs (dominant feces, farm, sus scrofa, jiangxi province, pig, weaned, corn and soybean diet, age 4-7 weeks, china)2019-07-02v3No1 / 9
351amnoncommon digestive system, united states of america, research facility, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 11
689amnoncommon feces, homo sapiens, united states of america, hospital, adult, non c. diff diarrhea, tucson2028-03-11v4No1 / 12
578amnondominant feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 12
400amnonhigh freq. in hmong (chinese) females from thailand (dominant feces, homo sapiens, female, adult, thailand, hmong, china)2018-11-18v4No1 / 13
620amnondominant feces, homo sapiens, rural community, village, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 13
669amnondominant feces, homo sapiens, infant, sweden, 2-month-old human stage2020-09-26v4No1 / 13
833amnondominant feces, homo sapiens, adult, slovak republic, athlete, age 60-65 years, high exercise2021-09-11v1No1 / 13
185amnoncommon in patients with c. diff infection before treatment (common feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 14
393amnondominant feces, homo sapiens, united states of america, city, adult, state of colorado, gay, homosexual, msm2018-11-06v4No1 / 14
400amnonhigh freq. in karen (burma) females from thailand (dominant feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 14
438amnondominant feces, homo sapiens, adult, jiangsu province, age >94, china, ninth decade human stage, tenth decade human stage2018-12-30v4No1 / 14
564amnon high in control compared to autistic disorder in feces homo sapiens child italy 2-5 year-old child stage 2019-11-18v3No1 / 14
51amnondominant feces, homo sapiens, united states of america2017-01-19v4No1 / 15
74amnondominant feces, homo sapiens, united states of america2017-02-27v4No1 / 15
276amnondominant feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 15
409amnondominant homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v4No1 / 15
502amnondominant feces, homo sapiens, united states of america, adult, schizophrenia2019-03-12v4No1 / 15
79amnoncommon united states of america, skin, tursiops truncatus, bottlenosed dolphin2017-03-03v4No1 / 15
723amnoncommon homo sapiens, female, vagina, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 15
797amnon high in 12-month-old human stage compared to age 7 months in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 15
51amnondominant homo sapiens, united states of america, biopsy site, biopsy2017-01-19v4No1 / 16
365amnondominant feces, homo sapiens, child, azerbaijan, obsolete_juvenile stage2018-08-30v4No1 / 16
399amnondominant feces, united states of america, state of tennessee, zoological garden, pan troglodytes, chimpanzee2018-11-16v4No1 / 16
411amnondominant feces, zambia, monkey, wild, papio kindae, kinda baboon2018-11-23v4No1 / 16
625amnondominant feces, united states of america, zoological garden, state of minnesota, pongo abelii, sumatran orangutan, como zoo2020-05-16v4No1 / 16
659amnon high in before antibiotics compared to antibiotic vancomycin metronidazole amoxicillin doxycycline in feces homo sapiens ulcerative colitis child acute severe colitis 2020-09-19v4No1 / 16
680amnondominant feces, homo sapiens, obesity, adult, russia, novosibirsk2028-03-04v3No1 / 16
723amnondominant feces, homo sapiens, female, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 16
365amnondominant feces, homo sapiens, child, nigeria, obsolete_juvenile stage2018-08-30v4No1 / 17
368amnon high in systemic lupus erythematosus compared to control in feces homo sapiens united states of america adult commonwealth of virginia 2018-09-03v4No1 / 17
368amnondominant feces, homo sapiens, united states of america, adult, commonwealth of virginia, systemic lupus erythematosus2018-09-03v4No1 / 17
400amnonhigh freq. in feces of european american females (dominant feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 17
607amnondominant feces, homo sapiens, control, germany2020-04-19v4No1 / 17
673amnondominant research facility, caecum, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, salmonella enterica subsp. enterica serovar typhimurium, salmonellosis, province of alberta2020-09-28v4No1 / 17
759amnondominant feces, united states of america, rattus norvegicus, state of new york, new york city, rat, wild2021-04-06v4No1 / 17
630amnondominant feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 17
293amnondominant feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 18
294amnondominant feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 18
294amnonhigh freq. in non-IBS healthy controls (dominant feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 18
368amnondominant feces, homo sapiens, control, united states of america, adult, commonwealth of virginia2018-09-03v4No1 / 18
430amnondominant feces, homo sapiens, united states of america, city, adult, state of arizona, 20-year-old human stage2018-12-15v4No1 / 18
607amnondominant feces, homo sapiens, germany, parkinson's disease2020-04-19v4No1 / 18
625amnondominant feces, united states of america, zoological garden, state of minnesota, saguinus imperator, como zoo, emperor tamarin2020-05-16v4No1 / 18
564amnondominant feces, homo sapiens, control, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 18
627amnondominant feces, female, pregnancy, adult, china2020-05-16v3No1 / 18
797amnondominant feces, homo sapiens, infant, germany, breast fed, 12-month-old human stage2021-06-13v3No1 / 18
831amnondominant feces, homo sapiens, control, adult, israel2021-09-11v3No1 / 18
833amnondominant feces, homo sapiens, adult, slovak republic, age 60-65 years, normal exercise2021-09-11v1No1 / 18
62amnondominant feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 19
121amnondominant feces, homo sapiens, adult, bangladesh2017-04-13v4No1 / 19
401amnondominant feces, homo sapiens, united states of america, adult2018-11-18v4No1 / 19
438amnondominant feces, homo sapiens, adult, jiangsu province, china, 65-79 year-old human stage2018-12-30v4No1 / 19
455amnondominant feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 19
477amnonhigher in agrarian tharu population compared to foraging chepang population ( high in tharu agrarian compared to forager chepang in feces homo sapiens adult nepal himalayas rural community )2019-01-28v4No1 / 19
477amnondominant feces, homo sapiens, united states of america, adult2019-01-28v4No1 / 19
516amnondominant feces, homo sapiens, united states of america, adult, state of ohio2019-05-29v4No1 / 19
574amnondominant feces, homo sapiens, adult, russia2020-01-05v3No1 / 19
637amnondominant feces, homo sapiens, female, pregnancy, adult, china, chengdu city prefecture, gestational age 8-12 weeks2020-08-18v3No1 / 19
797amnondominant feces, homo sapiens, child, germany, breast fed, 2-year-old human stage2021-06-13v3No1 / 19
197amnondominant feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, 13-year-old human stage2017-09-12v4No1 / 20
242amnonhigh freq. in native-americans (dominant feces, homo sapiens, united states of america, state of oklahoma, cheyenne, native american, arapaho)2017-11-14v4No1 / 20
273amnondominant feces, homo sapiens, infant, kingdom of denmark, 1-year-old human stage2018-01-14v4No1 / 20
284amnoncommon feces, homo sapiens, female, infant, state of california, age 2 months2018-01-27v4No1 / 20
284amnondominant feces, homo sapiens, female, infant, state of california, age 2 months2018-01-27v4No1 / 20
344amnonhigh freq. in feces of homosexual males (dominant feces, homo sapiens, united states of america, state of colorado, denver, gay, homosexual, msm)2018-05-31v4No1 / 20
394amnondominant feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 20
409amnondominant homo sapiens, united states of america, right colon, biopsy site, adult, biopsy2018-11-22v4No1 / 20
484amnondominant feces, homo sapiens, united states of america, adult, state of michigan, 17-29-years-old human2019-02-13v4No1 / 20
629amnondominant feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, homosexual, msm2020-05-31v4No1 / 20
629amnondominant feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, heterosexual, msw2020-05-31v4No1 / 20
650amnondominant feces, homo sapiens, united states of america, adult, caucasian, state of new york, european2020-09-09v4No1 / 20
671amnondominant feces, united states of america, research facility, macaca mulatta, age 1 month, monkey, captive, rhesus macaque2020-09-27v4No1 / 20
564amnondominant feces, homo sapiens, autistic disorder, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 20
578amnondominant feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 20
723amnoncommon feces, homo sapiens, infant, child, indonesia, municipality of yogyakarta, age 0-6 months2021-01-02v3No1 / 20
734amnondominant feces, homo sapiens, adult, taiwan, republic of china, vegetarian diet2021-01-22v3No1 / 20
797amnoncommon feces, homo sapiens, infant, germany, breast fed, 12-month-old human stage2021-06-13v3No1 / 20
797amnondominant feces, homo sapiens, infant, germany, formula fed, age 7 months2021-06-13v3No1 / 20
730amnondominant feces, homo sapiens, child, kingdom of the netherlands, amsterdam, crohn's disease2021-01-05v1No1 / 20
122amnondominant feces, homo sapiens, united kingdom2017-04-13v4No1 / 21
240amnonhigh freq. in infants age <3 years (dominant feces, homo sapiens, infant, finland, age < 3 years)2017-11-12v4No1 / 21
241amnonhigh freq. in babies age < 3 years in finland (dominant feces, homo sapiens, infant, finland, age < 3 years)2017-11-13v4No1 / 21
247amnondominant feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 21
249amnondominant feces, homo sapiens, united states of america2017-11-22v4No1 / 21
320amnondominant feces, homo sapiens, adult, crohn's disease2018-04-19v4No1 / 21
330amnondominant feces, homo sapiens, adult, kingdom of norway, oslo, fourth decade human stage2018-05-13v4No1 / 21
393amnondominant feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v4No1 / 21
398amnonhigh freq. in feces of healthy adults from belgium (dominant feces, homo sapiens, control, adult, belgium)2018-11-15v4No1 / 21
404amnon high in normal stool compared to hard stool in feces homo sapiens city adult columbia 2018-11-20v4No1 / 21
409amnondominant feces, homo sapiens, united states of america, adult2018-11-22v4No1 / 21
607amnondominant feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 21
597amnondominant feces, homo sapiens, control, adult, zhejiang province, china2020-03-23v3No1 / 21
734amnondominant feces, homo sapiens, adult, taiwan, republic of china, omnivore diet2021-01-22v3No1 / 21
835amnondominant feces, homo sapiens, adult, japan2021-09-11v3No1 / 21
94amnondominant feces, homo sapiens, state of michigan, clostridium difficile intestinal infectious disease, diarrhea2017-03-12v4No1 / 22
185amnonhigh freq. in patients with c. diff infection before treatment (dominant feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 22
284amnondominant feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 22
293amnondominant feces, homo sapiens, united states of america, adult, american diet2018-02-07v4No1 / 22
297amnondominant feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v4No1 / 22
395amnondominant feces, homo sapiens, united states of america, child, commonwealth of pennsylvania, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 22
467amnondominant feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 22
502amnondominant feces, homo sapiens, control, united states of america, adult2019-03-12v4No1 / 22
509amnondominant feces, homo sapiens, control, child, nigeria, kebbi state, rural community, 10-15-years-old human2019-03-18v4No1 / 22
629amnondominant feces, homo sapiens, female, adult, kingdom of the netherlands, amsterdam2020-05-31v4No1 / 22
650amnondominant feces, homo sapiens, united states of america, adult, african american, state of new york2020-09-09v4No1 / 22
673amnondominant control, research facility, caecum, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, province of alberta2020-09-28v4No1 / 22
779amnoncommon feces, homo sapiens, adult, guangzhou city prefecture, crohn's disease, china2021-04-28v4No1 / 22
552amnondominant feces, homo sapiens, czech republic2019-09-05v3No1 / 22
655amnondominant in patients before hematopoietic stem cell transplant (dominant feces, homo sapiens, italy, before hsct)2020-09-13v3No1 / 22
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 22
713amnoncommon feces, homo sapiens, remission, crohn's disease2028-05-21v3No1 / 22
797amnondominant feces, homo sapiens, child, germany, formula fed, 2-year-old human stage2021-06-13v3No1 / 22
10amnondominant feces, homo sapiens, toronto2016-10-27v4No1 / 23
53amnondominant feces, homo sapiens, city, el salvador, small village2017-01-21v4No1 / 23
73amnondominant feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 23
132amnondominant feces, homo sapiens, united states of america2017-04-16v4No1 / 23
241amnonhigh freq. in babies age < 3 years in russia (dominant feces, homo sapiens, infant, russia, age < 3 years)2017-11-13v4No1 / 23
241amnoncommon in babies age < 3 years in finland (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-13v4No1 / 23
241amnonhigh freq. in babies age < 3 years in estonia (dominant feces, homo sapiens, infant, estonia, age < 3 years)2017-11-13v4No1 / 23
284amnondominant feces, homo sapiens, female, infant, state of california, 12-month-old human stage2018-01-27v4No1 / 23
303amnondominant feces, homo sapiens, adult, germany2018-03-12v4No1 / 23
312amnondominant feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 23
344amnonhigh freq. in feces of heterosexuals (dominant feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 23
394amnondominant feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v4No1 / 23
487amnondominant feces, homo sapiens, united states of america, metabolic syndrome x, metabolic syndrome2019-02-24v4No1 / 23
509amnondominant feces, homo sapiens, child, nigeria, kebbi state, rural community, schistosomiasis, urinary schistosomiasis, 10-15-years-old human2019-03-18v4No1 / 23
669amnondominant feces, homo sapiens, infant, sweden, 12-month-old human stage2020-09-26v4No1 / 23
830amnondominant feces, homo sapiens, peru, age 9-17 years, teenager2021-09-10v4No1 / 23
832amnondominant feces, homo sapiens, adult, nigeria, ibadan2021-09-11v4No1 / 23
841amnondominant feces, homo sapiens, united states of america, adult, state of texas, human adult stage2021-11-08v4No1 / 23
694amnondominant feces, homo sapiens, female, obesity, adult, china, shanghai district2028-03-17v3No1 / 23
713amnondominant feces, homo sapiens, crohn's disease, active disease2028-05-21v3No1 / 23
734amnondominant feces, homo sapiens, adult, taiwan, coronary heart disease, republic of china2021-01-22v3No1 / 23
797amnoncommon feces, homo sapiens, infant, germany, formula fed, 12-month-old human stage2021-06-13v3No1 / 23
843amnondominant feces, adult, italy, human adult stage, non-celiac gluten sensitivity2021-11-17v3No1 / 23
150amnondominant feces, united states of america, canis lupus familiaris, dog2017-04-26v4No1 / 24
239amnondominant feces, homo sapiens, united states of america2017-11-08v4No1 / 24
241amnoncommon in babies age < 3 years in estonia (common feces, homo sapiens, infant, estonia, age < 3 years)2017-11-13v4No1 / 24
330amnondominant feces, homo sapiens, infant, kingdom of norway, oslo, age 1 year2018-05-13v4No1 / 24
365amnondominant feces, homo sapiens, child, sudan, obsolete_juvenile stage2018-08-30v4No1 / 24
395amnondominant feces, homo sapiens, control, united states of america, commonwealth of pennsylvania2018-11-14v4No1 / 24
566amnondominant feces, homo sapiens, adult, china2019-11-24v4No1 / 24
580amnondominant feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 24
643amnondominant feces, homo sapiens, adult, south korea2020-08-30v4No1 / 24
683amnondominant feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 24
597amnondominant feces, homo sapiens, adult, zhejiang province, gout, china2020-03-23v3No1 / 24
713amnoncommon feces, homo sapiens, crohn's disease, active disease2028-05-21v3No1 / 24
723amnondominant feces, homo sapiens, child, indonesia, municipality of yogyakarta, 2-5 year-old child stage2021-01-02v3No1 / 24
745amnondominant feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 24
53amnondominant feces, homo sapiens, city, lima, shantytown2017-01-21v4No1 / 25
284amnoncommon feces, homo sapiens, female, infant, state of california, 6-month-old human stage2018-01-27v4No1 / 25
290amnondominant feces, homo sapiens, city, adult, china2018-02-01v4No1 / 25
395amnoncommon feces, homo sapiens, united states of america, child, commonwealth of pennsylvania, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 25
428amnoncommon feces, homo sapiens, adult, nanchang city prefecture, acute pancreatitis, pancreatitis, china2018-12-09v4No1 / 25
580amnondominant feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 25
683amnoncommon during antibiotics treatment in feces (common feces, homo sapiens, united states of america, antibiotic, vancomycin, adult, state of california, metronidazole, neomycin)2028-03-04v4No1 / 25
721amnondominant feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 25
779amnoncommon feces, homo sapiens, ulcerative colitis, adult, guangzhou city prefecture, china2021-04-28v4No1 / 25
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 25
714amnondominant homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 25
797amnondominant feces, homo sapiens, infant, germany, formula fed, 12-month-old human stage2021-06-13v3No1 / 25
62amnondominant feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 26
410amnonlower in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens united states of america rectum biopsy site child biopsy )2018-11-22v4No1 / 26
438amnondominant feces, homo sapiens, adult, jiangsu province, china, fourth decade human stage, fifth decade human stage2018-12-30v4No1 / 26
802amnondominant feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 26
578amnondominant feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 26
438amnondominant feces, homo sapiens, child, jiangsu province, age 8-12, china, 6-12 year-old child stage2018-12-30v4No1 / 27
659amnoncommon feces, homo sapiens, ulcerative colitis, child, acute severe colitis2020-09-19v4No1 / 27
695amnondominant feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v4No1 / 27
319amnondominant feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 28
365amnondominant feces, homo sapiens, child, jordan, obsolete_juvenile stage2018-08-30v4No1 / 28
562amnondominant feces, child, ecuador, age 5-13 years, quito2019-11-05v4No1 / 28
825amnondominant feces, homo sapiens, type i diabetes mellitus, child, type 1 diabetes mellitus, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 28
438amnondominant feces, homo sapiens, jiangsu province, age 13-14, china, 13-year-old human stage, 14-year-old human stage2018-12-30v4No1 / 29
817amnon high in lung bronchoalveolar lavage compared to saliva oral cavity oral wash cheek pouch in united states of america research facility commonwealth of pennsylvania captive macaca fascicularis cynomolgus macaque 2021-07-08v4No1 / 29
668amnondominant feces, research facility, felis catus, new zealand, cat2020-09-26v3No1 / 29
284amnoncommon feces, homo sapiens, female, infant, state of california, 12-month-old human stage2018-01-27v4No1 / 30
320amnoncommon feces, homo sapiens, adult, crohn's disease2018-04-19v4No1 / 30
438amnondominant feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v4No1 / 30
591amnon high in control compared to parkinson's disease in feces homo sapiens united states of america adult human late adulthood stage 2020-02-17v4No1 / 30
695amnondominant feces, homo sapiens, child, israel, food allergy, age 4-10 years, sesame allergy2028-03-27v4No1 / 30
723amnoncommon feces, homo sapiens, child, indonesia, municipality of yogyakarta, 2-5 year-old child stage2021-01-02v3No1 / 30
45amnoncommon in feces babies age 0-2 in india (common feces, homo sapiens, infant, india)2016-12-19v4No1 / 31
390amnoncommon feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 31
655amnoncommon in patients before hematopoietic stem cell transplant (common feces, homo sapiens, italy, before hsct)2020-09-13v3No1 / 31
681amnondominant feces, homo sapiens, adult, seoul, south korea2028-03-04v3No1 / 31
745amnon high in 25-44 year-old human stage compared to human late adulthood stage in feces homo sapiens united states of america adult midwest region 2021-02-25v3No1 / 32
411amnonhigher in wild baboons feeding on discarded human foods ( high in human contact compared to low human contact in feces zambia monkey wild papio kindae kinda baboon )2018-11-23v4No1 / 33
269amnondecreases during one month in refrigeration of yao meat ( high in early timepoint fresh compared to late timpoint food spoilage in foodon product type china )2018-01-09v4No1 / 34
24amnondisappears on transition to cow milk ( high in breast milk compared to mammalian milk beverage in feces homo sapiens infant )2016-12-01v4No1 / 35
284amnon high in 12-month-old human stage compared to age 2 months in feces homo sapiens female infant state of california 2018-01-27v4No1 / 35
669amnoncommon feces, homo sapiens, infant, sweden, 12-month-old human stage2020-09-26v4No1 / 35
51amnoncommon homo sapiens, united states of america, biopsy site, biopsy2017-01-19v4No1 / 36
240amnoncommon in infants age <3 years (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-12v4No1 / 36
191amnonlower in preterm birth vaginal samples ( high in control compared to premature birth in homo sapiens united states of america female pregnancy vagina )2017-09-05v4No1 / 37
233amnon high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens united states of america infant 2017-11-05v4No1 / 37
681amnoncommon feces, homo sapiens, adult, seoul, south korea2028-03-04v3No1 / 37
390amnoncommon feces, homo sapiens, hospital, australia, diarrhea2018-11-04v4No1 / 38
74amnonHigher in plant diet compared to animal product diet ( high in diet plant diet compared to animal product diet in feces homo sapiens united states of america )2017-02-27v4No1 / 39
131amnonnegatively correlated with age (30-80 years) ( high in age fourth decade human stage fifth decade human stage compared to human late adulthood stage in feces homo sapiens south korea )2017-04-16v4No1 / 39
330amnoncommon feces, homo sapiens, infant, kingdom of norway, oslo, age 1 year2018-05-13v4No1 / 39
19amnoncommon in biopsies of children (IBD study) (common homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children)2016-11-14v4No1 / 40
714amnoncommon homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 40
825amnoncommon feces, homo sapiens, control, child, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 40
835amnoncommon feces, homo sapiens, adult, japan2021-09-11v3No1 / 40
51amnoncommon feces, homo sapiens, united states of america2017-01-19v4No1 / 41
352amnoncommon feces, homo sapiens, new delhi, india2018-07-30v4No1 / 41
400amnonhigher in children of hmong migrands born in the usa compared to non-migrant usa people ( high in hmong hmong 2nd generation compared to united states of america in feces homo sapiens )2018-11-18v4No1 / 41
825amnoncommon feces, homo sapiens, type i diabetes mellitus, child, type 1 diabetes mellitus, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 41
564amnoncommon feces, homo sapiens, autistic disorder, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 42
831amnoncommon feces, homo sapiens, adult, israel, pancreatic cancer2021-09-11v3No1 / 43
36amnoncommon feces, homo sapiens, sichuan province2016-12-06v4No1 / 44
241amnoncommon in babies age < 3 years in russia (common feces, homo sapiens, infant, russia, age < 3 years)2017-11-13v4No1 / 44
365amnoncommon feces, homo sapiens, child, sudan, obsolete_juvenile stage2018-08-30v4No1 / 44
652amnon high in rheumatoid arthritis compared to control in homo sapiens saliva adult sichuan province china 2020-09-13v3No1 / 44
797amnon high in age 7 months compared to 3-month-old human stage in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 44
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, 1-year-old human stage2018-01-14v4No1 / 46
570amnoncommon feces, homo sapiens, india, bihar state2019-12-16v3No1 / 46
597amnoncommon feces, homo sapiens, control, adult, zhejiang province, china2020-03-23v3No1 / 46
797amnoncommon feces, homo sapiens, child, germany, formula fed, 2-year-old human stage2021-06-13v3No1 / 46
482amnoncommon feces, homo sapiens, child, colombia, medellin metropolitan area, daycare, 1-5-years-old human2019-02-12v4No1 / 47
591amnoncommon feces, homo sapiens, united states of america, adult, parkinson's disease, human late adulthood stage2020-02-17v4No1 / 47
779amnoncommon feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v4No1 / 47
830amnoncommon feces, homo sapiens, peru, age 9-17 years, teenager2021-09-10v4No1 / 47
597amnoncommon feces, homo sapiens, adult, zhejiang province, gout, china2020-03-23v3No1 / 47
720amnoncommon feces, homo sapiens, adult, autoimmune hepatitis, china, zhengzhou city prefecture2028-05-23v3No1 / 48
221amnonhigher in control compared to tnbs induced colitis in rat feces ( high in control compared to colitis in feces research facility sprague dawley rattus rat china )2017-10-25v4No1 / 49
651amnoncommon feces, homo sapiens, united states of america, adult, state of alabama, parkinson's disease2020-09-13v4No1 / 49
736amnoncommon feces, homo sapiens, child, tanzania, age 1-3 years, pemba island, 2-year-old human stage, 1-year-old human stage2021-01-25v3No1 / 49
121amnoncommon feces, homo sapiens, adult, bangladesh2017-04-13v4No1 / 50
564amnoncommon feces, homo sapiens, control, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 50
797amnoncommon feces, homo sapiens, child, germany, breast fed, 2-year-old human stage2021-06-13v3No1 / 50
834amnoncommon feces, homo sapiens, adult, japan2021-09-11v1No1 / 50
796amnoncommon feces, homo sapiens, control, adult, taiwan, republic of china, taoyuan city2021-06-10v3No1 / 51
730amnoncommon feces, homo sapiens, child, kingdom of the netherlands, amsterdam, crohn's disease2021-01-05v1No1 / 51
650amnoncommon feces, homo sapiens, united states of america, adult, african american, state of new york2020-09-09v4No1 / 52
651amnon high in control compared to parkinson's disease in feces homo sapiens united states of america adult state of alabama 2020-09-13v4No1 / 52
694amnoncommon feces, homo sapiens, female, obesity, adult, china, shanghai district2028-03-17v3No1 / 52
796amnoncommon feces, homo sapiens, adult, taiwan, graves' disease, republic of china, taoyuan city2021-06-10v3No1 / 52
847amnoncommon feces, japan, 80 year-old and over human stage, ninth decade human stage2021-12-01v1No1 / 52
292amnoncommon feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 53
847amnoncommon feces, japan, eleventh decade human stage, centenarian human stage2021-12-01v1No1 / 54
847amnoncommon feces, japan, human early adulthood stage2021-12-01v1No1 / 54
292amnoncommon feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 55
390amnoncommon feces, homo sapiens, hospital, salmonella gastroenteritis, australia, diarrhea2018-11-04v4No1 / 55
814amnoncommon feces, homo sapiens, female, obesity, adult, obese body mass index status, germany, high bmi, overweight body mass index status, age 50-70 years2021-06-30v4No1 / 55
578amnon high in sweden compared to kingdom of spain in feces homo sapiens hiv infection adult gay homosexual msm male 2020-01-14v3No1 / 55
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 55
745amnoncommon feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 55
368amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of virginia, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 56
488amnonlower in feces of dogs with lymphoma compared to healthy controls ( high in control compared to lymphoma in feces canis lupus familiaris italy dog )2019-02-25v4No1 / 56
591amnoncommon feces, homo sapiens, control, united states of america, adult, human late adulthood stage2020-02-17v4No1 / 56
650amnoncommon feces, homo sapiens, united states of america, adult, caucasian, state of new york, european2020-09-09v4No1 / 56
720amnoncommon feces, homo sapiens, control, adult, china, zhengzhou city prefecture2028-05-23v3No1 / 56
651amnoncommon feces, homo sapiens, control, united states of america, adult, state of alabama2020-09-13v4No1 / 58
666amnoncommon feces, homo sapiens, italy2020-09-25v3No1 / 58
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, plantar part of pes, epidermis, bottom of foot2028-05-22v3No1 / 58
843amnoncommon feces, adult, italy, human adult stage, non-celiac gluten sensitivity2021-11-17v3No1 / 59
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, vegetarian diet2021-01-22v3No1 / 60
831amnoncommon feces, homo sapiens, control, adult, israel2021-09-11v3No1 / 60
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in diet american diet compared to cron diet caloric restriction diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 61
333amnoncommon in healthy controls feces (common feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 61
627amnoncommon feces, female, pregnancy, adult, china2020-05-16v3No1 / 61
637amnoncommon feces, homo sapiens, female, pregnancy, adult, china, chengdu city prefecture, gestational age 8-12 weeks2020-08-18v3No1 / 61
593amnoncommon feces, homo sapiens, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 62
380amnoncommon feces, homo sapiens, adult, tibetan plateau, tibet autonomous region2018-10-03v4No1 / 63
502amnoncommon feces, homo sapiens, united states of america, adult, schizophrenia2019-03-12v4No1 / 63
575amnoncommon in professional martial arts athletes (common feces, homo sapiens, adult, high physical activity, china, athlete, young adult stage)2020-01-05v3No1 / 63
695amnon high in sesame allergy compared to milk allergy in feces homo sapiens child israel food allergy age 4-10 years 2028-03-27v4No1 / 64
242amnoncommon in native-americans (common feces, homo sapiens, united states of america, state of oklahoma, cheyenne, native american, arapaho)2017-11-14v4No1 / 65
365amnoncommon feces, homo sapiens, child, nigeria, obsolete_juvenile stage2018-08-30v4No1 / 66
650amnoncommon feces, homo sapiens, united states of america, adult, state of new york, asian2020-09-09v4No1 / 66
734amnoncommon feces, homo sapiens, adult, taiwan, coronary heart disease, republic of china2021-01-22v3No1 / 66
365amnoncommon feces, homo sapiens, child, jordan, obsolete_juvenile stage2018-08-30v4No1 / 67
757amnoncommon feces, homo sapiens, adult, brazil, santa catarina state2021-03-28v3No1 / 67
840amnoncommon farm, ileum, gallus gallus, broiler chicken, china2021-11-08v3No1 / 67
574amnoncommon feces, homo sapiens, adult, russia2020-01-05v3No1 / 68
593amnoncommon feces, homo sapiens, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, omnivore diet2021-01-22v3No1 / 68
72amnoncommon feces, united states of america, canis lupus familiaris, iowa2017-02-25v4No1 / 69
644amnon high in female compared to male in feces homo sapiens united states of america adult hispanic or latin american 2020-08-31v4No1 / 69
723amnoncommon feces, homo sapiens, female, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 69
803amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of massachusetts, type 2 diabetes mellitus, caribbean latino, human late adulthood stage2021-06-18v4No1 / 70
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 4 weeks2018-11-04v4No1 / 71
644amnoncommon feces, homo sapiens, united states of america, adult, hispanic or latin american2020-08-31v4No1 / 71
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, switzerland2020-09-22v4No1 / 71
656amnoncommon feces, homo sapiens, sri lanka, age 1-18 years, child stage, adolescent stage2020-09-13v3No1 / 71
425amnoncommon feces, homo sapiens, child, africa, madagascar, antananarivo2018-12-08v4No1 / 73
477amnoncommon feces, homo sapiens, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
832amnoncommon feces, homo sapiens, adult, nigeria, ibadan2021-09-11v4No1 / 74
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 74
395amnoncommon feces, homo sapiens, control, united states of america, commonwealth of pennsylvania2018-11-14v4No1 / 75
794amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, human immunodeficiency virus infectious disease, municipality of logrono, antiretroviral therapy2021-06-08v4No1 / 75
74amnoncommon feces, homo sapiens, united states of america2017-02-27v4No1 / 76
477amnoncommon feces, homo sapiens, nepal, himalayas, rural community, raute2019-01-29v4No1 / 76
484amnoncommon feces, homo sapiens, united states of america, adult, state of michigan, 17-29-years-old human2019-02-13v4No1 / 76
666amnoncommon feces, tursiops truncatus, italy, rectal swab, common bottlenose dolphin2020-09-25v3No1 / 76
122amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united kingdom )2017-04-13v4No1 / 77
516amnoncommon feces, homo sapiens, united states of america, adult, state of ohio2019-05-29v4No1 / 77
799amnoncommon in obese participant fecal samples before ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi)2021-06-13v3No1 / 77
556amnoncommon feces, homo sapiens, united states of america, adult2019-09-14v1No1 / 77
596amnon high in under-1-year-old human stage compared to age 1-7 years 2-5 year-old child stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 78
630amnoncommon feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 78
401amnoncommon feces, homo sapiens, united states of america, adult2018-11-18v4No1 / 79
404amnoncommon feces, homo sapiens, city, adult, colombia2018-11-20v4No1 / 79
425amnoncommon feces, homo sapiens, child, africa, central african republic, bangui2018-12-08v4No1 / 79
529amnoncommon feces, homo sapiens, control, adult, taipei city, taiwan2019-07-18v3No1 / 79
732amnoncommon feces, homo sapiens, adult, kingdom of spain, municipality of reus2021-01-11v3No1 / 79
203amnonnegatively correlated with age in child dental plaque ( high in young age compared to age old age in homo sapiens oral cavity dentition australia obsolete_juvenile stage mouth )2017-10-01v4No1 / 80
695amnoncommon feces, homo sapiens, child, israel, food allergy, age 4-10 years, sesame allergy2028-03-27v4No1 / 80
292amnoncommon feces, homo sapiens, control, adult, china2018-02-05v4No1 / 81
339amnoncommon feces, homo sapiens, adult, india2018-05-24v4No1 / 81
643amnoncommon feces, homo sapiens, adult, south korea2020-08-30v4No1 / 81
671amnoncommon feces, united states of america, research facility, macaca mulatta, age 1 month, monkey, captive, rhesus macaque2020-09-27v4No1 / 81
344amnoncommon in feces of heterosexuals (common feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of virginia2018-09-03v4No1 / 82
562amnoncommon feces, child, ecuador, age 5-13 years, quito2019-11-05v4No1 / 82
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 82
502amnoncommon feces, homo sapiens, control, united states of america, adult2019-03-12v4No1 / 83
721amnon high in weight loss weight loss diet high protein diet compared to high fiber fiber diet in feces homo sapiens obesity adult scotland overweight body mass index status gaz:00052100 2028-05-23v4No1 / 83
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v4No1 / 84
247amnoncommon feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 85
601amnoncommon feces, homo sapiens, adult, type 2 diabetes mellitus, china2020-03-30v4No1 / 85
663amnoncommon feces, homo sapiens, adult, switzerland, low bmi2020-09-22v4No1 / 85
680amnoncommon feces, homo sapiens, obesity, adult, russia, novosibirsk2028-03-04v3No1 / 85
249amnoncommon feces, homo sapiens, united states of america2017-11-22v4No1 / 86
394amnoncommon feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v4No1 / 86
841amnoncommon feces, homo sapiens, united states of america, adult, state of texas, human adult stage2021-11-08v4No1 / 86
344amnoncommon in feces of homosexual males (common feces, homo sapiens, united states of america, state of colorado, denver, gay, homosexual, msm)2018-05-31v4No1 / 87
430amnoncommon feces, homo sapiens, united states of america, city, adult, state of arizona, 20-year-old human stage2018-12-15v4No1 / 87
62amnon high in united states of america compared to egypt in feces homo sapiens child obsolete_juvenile stage 2017-02-13v4No1 / 88
477amnoncommon feces, homo sapiens, raji, nepal, himalayas, rural community2019-01-29v4No1 / 88
487amnoncommon feces, homo sapiens, united states of america, metabolic syndrome x, metabolic syndrome2019-02-24v4No1 / 88
293amnoncommon feces, homo sapiens, united states of america, adult, american diet2018-02-07v4No1 / 89
629amnoncommon feces, homo sapiens, female, adult, kingdom of the netherlands, amsterdam2020-05-31v4No1 / 89
803amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of massachusetts, caribbean latino, human late adulthood stage2021-06-18v4No1 / 89
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 92
668amnon high in age 5 years compared to age 4 months in feces research facility felis catus new zealand cat 2020-09-26v3No1 / 92
303amnoncommon feces, homo sapiens, adult, germany2018-03-12v4No1 / 93
428amnoncommon feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v4No1 / 93
601amnoncommon feces, homo sapiens, control, adult, china2020-03-30v4No1 / 93
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 93
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, gay, homosexual, msm2018-11-06v4No1 / 94
488amnoncommon feces, control, canis lupus familiaris, italy, dog2019-02-25v4No1 / 94
695amnoncommon feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v4No1 / 94
759amnoncommon feces, united states of america, rattus norvegicus, state of new york, new york city, rat, wild2021-04-06v4No1 / 94
400amnoncommon in feces of european american females (common feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common feces, homo sapiens, female, adult, thailand, hmong, china)2018-11-18v4No1 / 95
736amnoncommon feces, homo sapiens, female, adult, tanzania, pemba island2021-01-25v3No1 / 95
238amnoncommon feces, homo sapiens, colombia2017-11-07v4No1 / 96
759amnon high in state of new york new york city wild compared to research facility commonwealth of massachusetts city of boston in feces united states of america rattus norvegicus rat 2021-04-06v4No1 / 96
365amnoncommon feces, homo sapiens, child, azerbaijan, obsolete_juvenile stage2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, right colon, biopsy site, adult, biopsy2018-11-22v4No1 / 97
477amnoncommon feces, homo sapiens, adult, nepal, himalayas, forager, rural community, chepang2019-01-28v4No1 / 97
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, heterosexual, msw2020-05-31v4No1 / 97
730amnoncommon feces, homo sapiens, control, child, kingdom of the netherlands, amsterdam2021-01-05v1No1 / 97
663amnoncommon feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 98
753amnoncommon feces, zoological garden, adult, captive, canis lupus, china, wolf2021-03-12v4No1 / 98
532amnoncommon feces, homo sapiens, control, adult, czech republic2019-07-21v1No1 / 98
673amnoncommon research facility, caecum, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, salmonella enterica subsp. enterica serovar typhimurium, salmonellosis, province of alberta2020-09-28v4No1 / 99
455amnoncommon homo sapiens, saliva, adult, canada, atherosclerosis2019-01-10v4No1 / 100
438amnoncommon feces, homo sapiens, china, young adult stage2018-12-30v4No1 / 101
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in caecum sus scrofa pig united kingdom )2017-11-26v4No1 / 103
477amnoncommon feces, homo sapiens, united states of america, adult2019-01-28v4No1 / 103
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 103
693amnoncommon feces, homo sapiens, female, adult, austria, graz city district2028-03-16v1No1 / 104
284amnoncommon feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 105
683amnoncommon feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 105
438amnoncommon feces, homo sapiens, child, jiangsu province, age 8-12, china, 6-12 year-old child stage2018-12-30v4No1 / 106
797amnon high in 12-month-old human stage compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 106
215amnoncommon feces, homo sapiens, united states of america2017-10-23v4No1 / 107
273amnon high in age 1-month-old human stage compared to age one week 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 107
393amnon high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america city adult state of colorado 2018-11-06v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common feces, homo sapiens, control, adult, belgium)2018-11-15v4No1 / 107
399amnoncommon feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 108
409amnoncommon feces, homo sapiens, united states of america, adult2018-11-22v4No1 / 108
802amnoncommon feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 108
289amnoncommon feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 109
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v4No1 / 109
53amnoncommon feces, homo sapiens, city, lima, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in feces homo sapiens united states of america child )2018-11-22v4No1 / 110
770amnoncommon macaca mulatta, age > 1 year, penis, male organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 110
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, 65-79 year-old human stage2018-12-30v4No1 / 111
770amnon high in infant age < 1 year compared to age 10-15 years adult organism in feces macaca mulatta cayo santiago puerto rico rectal swab indian rhesus macaque 2021-04-19v4No1 / 111
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 6-10 weeks2018-11-03v4No1 / 112
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 112
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, poland2020-09-22v4No1 / 112
269amnoncommon in fresh yao meat food (common foodon product type, china)2018-01-09v4No1 / 113
517amnoncommon feces, homo sapiens, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 113
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, fourth decade human stage, fifth decade human stage2018-12-30v4No1 / 115
239amnoncommon feces, homo sapiens, united states of america2017-11-08v4No1 / 117
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, age 6 months, captive, rhesus macaque2020-09-27v4No1 / 117
409amnoncommon homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v4No1 / 118
212amnoncommon feces, control, united states of america, research facility, mus musculus, lean body mass, mouse2017-10-22v4No1 / 120
294amnoncommon feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
753amnoncommon feces, farm, adult, canis lupus familiaris, dog, china, dog breeding center2021-03-12v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, small intestine, duodenum, new delhi, india)2018-07-30v4No1 / 121
371amnoncommon feces, homo sapiens, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 121
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china, ninth decade human stage, tenth decade human stage2018-12-30v4No1 / 121
517amnoncommon homo sapiens, arm, skin, forearm, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 121
660amnoncommon feces, homo sapiens, ecuador, rural community, village, shuar population2020-09-20v4No1 / 123
449amnoncommon feces, homo sapiens, colombia2019-01-09v4No1 / 124
607amnoncommon feces, homo sapiens, germany, parkinson's disease2020-04-19v4No1 / 125
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 126
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to rectum biopsy site biopsy in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 126
753amnon high in farm canis lupus familiaris dog dog breeding center compared to zoological garden captive canis lupus wolf in feces adult china 2021-03-12v4No1 / 127
131amnoncommon feces, homo sapiens, south korea2017-04-16v4No1 / 128
607amnoncommon feces, homo sapiens, control, germany2020-04-19v4No1 / 128
330amnoncommon feces, homo sapiens, adult, kingdom of norway, oslo, fourth decade human stage2018-05-13v4No1 / 130
721amnoncommon feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 131
39amnoncommon in obese lepr-db mice (common feces, research facility, mus musculus, obesity)2016-12-09v4No1 / 132
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
625amnoncommon feces, united states of america, zoological garden, state of minnesota, saguinus imperator, como zoo, emperor tamarin2020-05-16v4No1 / 132
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 132
711amnon high in adult compared to child age 8-12 years in homo sapiens united states of america oral cavity state of colorado mouth 2028-05-21v4No1 / 133
794amnoncommon feces, homo sapiens, control, adult, kingdom of spain, municipality of logrono2021-06-08v4No1 / 133
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china, 13-year-old human stage, 14-year-old human stage2018-12-30v4No1 / 134
607amnoncommon feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to myanmar karen in feces homo sapiens thailand rural community )2018-11-18v4No1 / 135
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, 13-year-old human stage2017-09-12v4No1 / 136
594amnoncommon feces, homo sapiens, adult, rural community, cameroon, ngoantet2020-03-12v4No1 / 136
212amnoncommon feces, united states of america, research facility, mus musculus, obese body mass index status, mouse, db/db mouse, obesity2017-10-22v4No1 / 137
294amnoncommon in non-IBS healthy controls (common feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 137
10amnoncommon feces, homo sapiens, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens juvenile organism obsolete_juvenile stage 13-year-old human stage 2017-09-12v4No1 / 138
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united states of america )2017-04-11v4No1 / 139
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, homosexual, msm2020-05-31v4No1 / 141
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
509amnoncommon feces, homo sapiens, child, nigeria, kebbi state, rural community, schistosomiasis, urinary schistosomiasis, 10-15-years-old human2019-03-18v4No1 / 146
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
509amnoncommon feces, homo sapiens, control, child, nigeria, kebbi state, rural community, 10-15-years-old human2019-03-18v4No1 / 147
759amnon high in canis lupus familiaris dog compared to canis lupus wolf wildlife sactuary in feces united states of america state of minnesota 2021-04-06v4No1 / 148
780amnon high in small intestine duodenum jejunum compared to caecum in research facility gallus gallus chicken china jinzhou city prefecture 2021-04-28v3No1 / 153
594amnoncommon feces, homo sapiens, city, adult, cameroon, yaounde2020-03-12v4No1 / 154
673amnoncommon control, research facility, caecum, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, province of alberta2020-09-28v4No1 / 154
833amnoncommon feces, homo sapiens, adult, slovak republic, age 60-65 years, normal exercise2021-09-11v1No1 / 154
833amnoncommon feces, homo sapiens, adult, slovak republic, athlete, age 60-65 years, high exercise2021-09-11v1No1 / 154
53amnoncommon feces, homo sapiens, city, el salvador, small village2017-01-21v4No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, bile, gallbladder, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
122amnoncommon feces, homo sapiens, united kingdom2017-04-13v4No1 / 157
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v4No1 / 162
700amnoncommon feces, research facility, sus scrofa, belgium, age 1 month, pig2028-04-01v3No1 / 164
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
389amnon high in age 4 weeks compared to age 1-3 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-04v4No1 / 168
190amnoncommon feces, homo sapiens, tanzania, hunter gatherer, hadza2017-09-04v4No1 / 169
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
770amnoncommon vagina, macaca mulatta, age > 1 year, female organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 169
521amnoncommon in pre-weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 169
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, india, 13-year-old human stage2017-09-12v4No1 / 170
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, 3-month-old human stage2020-09-27v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years 2-year-old human stage 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant )2017-11-13v4No1 / 173
625amnoncommon feces, united states of america, zoological garden, state of minnesota, pithecia pithecia, white-faced saki, como zoo2020-05-16v4No1 / 179
671amnon high in age 8 months compared to female adult in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 182
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 183
402amnon high in zone 1 compared to zone 2,3 in mine tailing sediment soil guangxi zhuang autonomous region alkaline mine tailing china 2018-11-18v4No1 / 189
620amnoncommon feces, gorilla gorilla, wild, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 196
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
620amnoncommon feces, homo sapiens, rural community, village, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 197
411amnoncommon feces, zambia, monkey, wild, papio kindae, kinda baboon2018-11-23v4No1 / 200
6amnoncommon homo sapiens, urine, female, pregnancy, state of tennessee2016-10-13v4No1 / 201
438amnonlower in centenarians compared to adults ( high in 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to age >94 ninth decade human stage tenth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 203
120amnoncommon feces, homo sapiens, brazil2017-04-12v4No1 / 208
150amnoncommon feces, united states of america, canis lupus familiaris, dog2017-04-26v4No1 / 208
388amnon high in age 6-10 weeks compared to age 12-19 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-03v4No1 / 210
669amnon high in 12-month-old human stage compared to 2-month-old human stage in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 217
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
578amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens hiv infection adult kingdom of spain sweden male )2020-01-14v3No1 / 220
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
666amnoncommon feces, italy, pig, sus scrofa domesticus2020-09-25v3No1 / 223
411amnoncommon feces, zambia, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 224
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
673amnon high in caecum ascending colon compared to ileum in control research facility sus scrofa male canada pig age 6 weeks male organism province of alberta 2020-09-28v4No1 / 228
780amnoncommon research facility, small intestine, duodenum, jejunum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 232
351amnoncommon feces, united states of america, research facility, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 233
53amnon high in lima shantytown compared to el salado small village in feces homo sapiens city 2017-01-21v4No1 / 236
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v4No1 / 239
406amnoncommon feces, zoological garden, gorilla gorilla, french republic, monkey, gorilla2018-11-21v4No1 / 239
483amnoncommon united states of america, research facility, hawaii, pearl harbor, hydroides elegans, tubeworm, shelled egg2019-02-13v4No1 / 243
161amnoncommon in barn swallows in colorado (common feces, united states of america, state of colorado, hirundo rustica, barn swallow)2017-07-12v4No1 / 245
351amnoncommon united states of america, research facility, coelomic fluid, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 249
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, age 8 months2020-09-27v4No1 / 252
45amnonlower in young babies compared to 2 year olds in india ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant india )2016-12-19v4No1 / 253
625amnoncommon feces, united states of america, zoological garden, state of minnesota, ateles geoffroyi, como zoo, black-handed spider monkey2020-05-16v4No1 / 256
63amnon high in male compared to female in feces homo sapiens united states of america 2017-12-04v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, adult, peru, small village, tunapuco, rural community2018-01-22v4No1 / 263
160amnoncommon in river water upstream of WTP effluent in spring in china (common river, water, china, spring)2017-07-12v4No1 / 278
688amnoncommon feces, research facility, sus scrofa, nanchang city prefecture, pig, china, duroc pig, age 140 days2028-03-09v4No1 / 278
438amnon high in child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage compared to adult 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china 2018-12-30v4No1 / 279
770amnoncommon feces, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 280
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v4No1 / 281
428amnon high in control compared to acute pancreatitis pancreatitis in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, weaned, corn and soybean diet, age 4-7 weeks, china)2019-07-02v3No1 / 288
411amnoncommon feces, united states of america, zoological garden, papio anubis, monkey, olive baboon2018-11-23v4No1 / 292
625amnoncommon feces, united states of america, zoological garden, gorilla gorilla, state of minnesota, como zoo2020-05-16v4No1 / 293
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v4No1 / 295
419amnoncommon in rats with induced constipation (common feces, research facility, rattus norvegicus, sprague dawley, rat, constipation, china)2018-12-02v4No1 / 300
78amnon high in male compared to female in feces tropical grassland biome kenya nanger granti gazelle 2017-03-01v4No1 / 301
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
723amnon high in 2-5 year-old child stage compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
816amnon high in late pregnancy compared to early pregnancy in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism 2021-07-04v4No1 / 312
510amnoncommon estuary, water, fresh water, kingdom of spain, estuary water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
399amnoncommon feces, united states of america, state of tennessee, zoological garden, sus scrofa, pig2018-11-16v4No1 / 319
729amnoncommon feces, gorilla gorilla, monkey, wild, cameroon2021-01-05v3No1 / 321
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
532amnon high in control compared to short bowel syndrome in feces homo sapiens adult czech republic 2019-07-21v1No1 / 334
729amnoncommon feces, monkey, wild, pan troglodytes troglodytes, cameroon, central chimpanzee2021-01-05v3No1 / 336
351amnoncommon in artificial sea water where sea urchins were grown (common united states of america, research facility, sea water, state of florida, lytechinus variegatus, sea urchin, artificial seawater)2018-07-30v4No1 / 338
847amnon high in ninth decade human stage compared to eleventh decade human stage centenarian human stage in feces japan 80 year-old and over human stage 2021-12-01v1No1 / 341
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
729amnoncommon feces, zoological garden, monkey, europe, pan troglodytes verus, western chimpanzee2021-01-05v3No1 / 343
254amnoncommon river, water, fresh water, fujian province, depth (soil) 50cm, jiulong river, china2017-11-23v4No1 / 347
620amnon high in gorilla gorilla compared to chimpanzee pan troglodytes troglodytes in feces wild republic of congo nouabale-ndoki national park 2020-05-06v4No1 / 351
671amnon high in state of california compared to state of oregon in feces united states of america female research facility adult macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 355
254amnonhigher in river when close to populated region compared to downstream ( high in populated place city upstream compared to downstream in river water fresh water fujian province depth (soil) 50cm jiulong river china )2017-11-23v4No1 / 356
671amnoncommon feces, united states of america, female, research facility, adult, macaca mulatta, monkey, captive, rhesus macaque2020-09-27v4No1 / 356
620amnoncommon feces, united states of america, zoological garden, pan troglodytes, chicago, chimpanzee, lincoln park zoo2020-05-06v4No1 / 358
565amnoncommon zoological garden, skin, captive, canada, african lion safari, macropus rufus, red kangaroo2019-11-21v3No1 / 360
565amnoncommon zoological garden, skin, papio anubis, captive, olive baboon, canada, toronto zoo2019-11-21v3No1 / 368
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
442amnoncommon feces, research facility, rattus norvegicus, sprague dawley, male, rat, china2019-01-06v4No1 / 378
256amnoncommon duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 380
729amnon high in wild cameroon compared to zoological garden captive europe in feces gorilla gorilla monkey 2021-01-05v3No1 / 383
620amnoncommon feces, united states of america, zoological garden, gorilla gorilla, chicago, lincoln park zoo2020-05-06v4No1 / 384
399amnoncommon feces, united states of america, state of tennessee, zoological garden, gorilla gorilla2018-11-16v4No1 / 395
770amnoncommon feces, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 396
399amnoncommon feces, united states of america, state of tennessee, zoological garden, macaca mulatta, macaque2018-11-16v4No1 / 404
399amnoncommon feces, united states of america, state of tennessee, zoological garden, pan troglodytes, chimpanzee2018-11-16v4No1 / 407
625amnoncommon feces, united states of america, zoological garden, state of minnesota, pongo abelii, sumatran orangutan, como zoo2020-05-16v4No1 / 414
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
620amnoncommon feces, united states of america, zoological garden, pan troglodytes, chimpanzee, saint louis, saint louis zoo2020-05-06v4No1 / 433
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
274amnoncommon feces, chlorocebus aethiops, ethiopia, monkey, grivet monkey2018-01-16v4No1 / 440
75amnoncommon feces, homo sapiens, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 442
274amnoncommon feces, chlorocebus aethiops, ethiopia, monkey, vervet monkey2018-01-16v4No1 / 446
424amnoncommon feces, farm, sus scrofa, jinhua city prefecture, pig, jinhua pig, china2018-12-06v4No1 / 452
339amnon high in adult compared to infant under-1-year-old human stage in feces homo sapiens india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
111amnon high in rectum caecum colon ileum compared to ruminant reticulum omasum rumen in ovis aries mongolian sheep china 2017-04-09v4No1 / 464
160amnoncommon in wastewater treatment plant effluent in autumn in china (common wastewater treatment plant, effluent, autumn, china)2017-07-12v4No1 / 469
221amnoncommon feces, research facility, sprague dawley, rattus, rat, china2017-10-25v4No1 / 470
274amnoncommon feces, ethiopia, monkey, chlorocebus djamdjamensis, bale monkey2018-01-16v4No1 / 489
256amnoncommon caecum, left colon, right colon, sus scrofa, pig, united kingdom2017-11-26v4No1 / 490
620amnoncommon feces, united states of america, zoological garden, gorilla gorilla, saint louis, saint louis zoo2020-05-06v4No1 / 530
729amnoncommon feces, zoological garden, gorilla gorilla, monkey, captive, europe2021-01-05v3No1 / 542
725amnon high in subgingival plaque subgingival dental plaque compared to mouth mucosa buccal mucosa in homo sapiens adult china municipality of beijing 2021-01-03v3No1 / 544
273amnon high in age 1-year-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant finland )2017-11-12v4No1 / 567
160amnoncommon in wastewater treatment plant effluent in spring in china (common wastewater treatment plant, effluent, china, spring)2017-07-12v4No1 / 573
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in estuary water kingdom of spain estuary water bilbao 2019-03-20v4No1 / 592
517amnon high in feces compared to arm skin forearm in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage compared to soldiers young adult stage in feces homo sapiens china )2018-12-30v4No1 / 617
200amnoncommon in river downstream of wastewater treatment plant (common united states of america, river, water, fresh water, wastewater treatment plant, effluent)2017-10-01v4No1 / 655
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned corn and soybean diet age 4-7 weeks compared to suckling preweaned age 2-4 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v3No1 / 681
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium officinale, flowerpot2021-06-20v4No1 / 715
752sheryoCommon in soil planted with Panax notoginseng (common soil, yunnan province, ph 6, china, panax notoginseng, pot expreiment, xundian county, sanqi plants)2021-03-11v3No1 / 730
256amnonlower in small intestine compared to colon in pigs ( high in caecum left colon right colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 752
752sheryoCommon in soil planted with Panax notoginseng amended with2% biochar (common soil, yunnan province, ph 6, biochar, china, panax notoginseng, pot expreiment, xundian county, sanqi plants)2021-03-11v3No1 / 783
331amnon high in wet season compared to dry season in feces ethiopia monkey theropithecus gelada 2018-05-13v4No1 / 818
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v4No1 / 836
671amnon high in age 8 months compared to age 6 months 3-month-old human stage in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 955
620amnon high in united states of america zoological garden pan troglodytes compared to wild pan troglodytes troglodytes republic of congo nouabale-ndoki national park in feces chimpanzee 2020-05-06v4No1 / 964
193amnonhigher in nares of people working in dairy farms ( high in farm bos taurus compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
252amnoncommon in river rock biofilm (common river, rock, biofilm, kingdom of spain, epilithic, biofilm)2017-11-22v4No1 / 1081
5amnoncommon periplaneta americana, digestive system, united states of america, wild type2016-10-13v4No1 / 1142
252amnoncommon in river sand biofilm (common river, biofilm, sand, kingdom of spain, biofilm)2017-11-22v4No1 / 1181
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium huoshanense, flowerpot2021-06-20v4No1 / 1356

Problems / suggestions? Please email info AT dbbact DOT org