Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGTTGCAAGTCTGATGTGAAAGGCGGGGGCTCAACCCCTGGACTGCATTGGAAACTGTGATACTCGAGTGCCGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
canis lupus familiaris0.378151
dog0.353833
feces0.311997
china0.305331
homo sapiens0.204170
adult0.204091
italy0.166898
chicken0.142730
gallus gallus0.140721
united states of america0.134155
research facility0.104546
city of melbourne0.101408
cat0.085561
felis catus0.083770
male0.082278
child0.081633
control0.081560
australia0.080107
caecum0.075694
cobb broiler chicken0.074866
foxhound0.074866
rectum0.072822
age 35 days0.072165
sweden0.067308
colon0.067039
fourth decade human stage0.064171
kingdom of spain0.063063
formula fed0.060914
captive0.057416
seattle0.054645
colonized germ free0.054645
obesity0.054152
state of north carolina0.053191
broiler chicken0.052493
high bmi0.051370
2-5 year-old child stage0.049875
female0.048270
zoological garden0.047506
wolf0.044860
fifth decade human stage0.044199
skin0.043860
infant0.042017
russia0.041451
zhejiang province0.041451
canis lupus0.038523
germany0.037234
wild0.036199
mouse0.034884
age 30 days0.033803
cftr s489x0.033520
state of louisiana0.033520
sigmoid colon brushing0.033520
indonesia0.033520
municipality of yogyakarta0.033520
lake hulun0.033520
hydrolized diet0.033520
new zealand0.033520
jinzhou city prefecture0.033520
mus musculus0.033149
estonia0.032967
cystic fibrosis0.032967
colonic mucosa0.032967
milan0.032967
republic of china0.032967
farm0.032653
LOWER IN duodenum0.032609
sigmoid colon0.032432
taiwan0.032432
heterosexual0.031915
msw0.031915
mongolia0.031915
rectal swab0.031915
high fiber0.031414
2-year-old human stage0.031414
ovis aries0.031414
LOWER IN ileum0.030457
sus scrofa0.030457
pig0.030457
israel0.030227
cloaca0.030000
human adult stage0.029126
french republic0.028302
winter0.026786
canada0.024194
panthera tigris0.022599
tiger0.022599
age 7 months0.022599
non-celiac gluten sensitivity0.022599
dog breeding center0.022599
felis silvestris0.022599
wild cat0.022599
flagstaff0.022599
vulpes corsac0.022599
corsac fox0.022599
puppy0.022599
nephrolithiasis0.022599
nanning city prefecture0.022599
sixth decade human stage0.022599
LOWER IN exocrine pancreatic insufficiency0.022599
dairy0.022599
Fraction of dbbact annotations with this term covered by the query
TermScore
china7.000000
city of melbourne2.000000
colon1.000000
namibia1.000000
bile1.000000
wolf0.750000
canis lupus familiaris0.692308
age 30 days0.666667
dog0.652174
cat0.571429
LOWER IN primary progressive multiple sclerosis0.500000
panthera tigris0.500000
tiger0.500000
cobb broiler chicken0.500000
seattle0.500000
cftr s489x0.500000
colonized germ free0.500000
age 7 months0.500000
state of louisiana0.500000
sigmoid colon brushing0.500000
non-celiac gluten sensitivity0.500000
dog breeding center0.500000
felis silvestris0.500000
wild cat0.500000
indonesia0.500000
municipality of yogyakarta0.500000
enzyme supplement0.500000
LOWER IN no enzyme supplement0.500000
exocrine pancreatic insufficiency0.500000
flagstaff0.500000
lake hulun0.500000
vulpes corsac0.500000
corsac fox0.500000
puppy0.500000
foxhound0.500000
hydrolized diet0.500000
new zealand0.500000
type 1 diabetes mellitus0.500000
hangzhou city prefecture0.500000
age 6-14 years0.500000
bihar state0.500000
gout0.500000
nephrolithiasis0.500000
nanning city prefecture0.500000
sixth decade human stage0.500000
age 2-7 years0.500000
fifth decade human stage0.500000
LOWER IN lymphoma0.500000
lymphoma0.500000
domestic0.500000
wildlife sactuary0.500000
vegetarian diet0.500000
coronary heart disease0.500000
osteoarthritis0.500000
omnivore diet0.500000
sri lanka0.500000
age 1-18 years0.500000
usa born0.500000
LOWER IN non usa born0.500000
LOWER IN enzyme supplementation0.500000
LOWER IN exocrine pancreatic insufficiency0.500000
novosibirsk0.500000
dairy0.500000
LOWER IN age 7 months0.500000
LOWER IN meat diet0.500000
canis lupus arctos0.500000
toronto zoo0.500000
arctic wolf0.500000
african lion safari0.500000
LOWER IN age 2 days0.500000
canis mesomelas0.500000
meat diet0.500000
gallbladder0.500000
cholelithiasis0.500000
vulpes vulpes0.500000
red fox0.500000
suckling0.500000
preweaned0.500000
age 2-4 weeks0.500000
jinzhou city prefecture0.500000
panax notoginseng0.500000
xundian county0.500000
sanqi plants0.500000
LOWER IN age 0-6 months0.500000
LOWER IN weaned0.500000
LOWER IN corn and soybean diet0.500000
LOWER IN age 4-7 weeks0.500000
age >940.500000
tenth decade human stage0.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN soldiers0.500000
size < 10um0.500000
clear day0.500000
multiple pregnancies0.500000
LOWER IN first pregnancy0.500000
LOWER IN ulcer0.500000
LOWER IN wound0.500000
felis catus0.444444
obesity0.428571
Fraction of annotations for the query sequences containing the term
TermScore
feces0.791908
homo sapiens0.404624
adult0.294798
united states of america0.271676
canis lupus familiaris0.260116
dog0.242775
research facility0.173410
china0.156069
italy0.115607
control0.109827
gallus gallus0.092486
chicken0.092486
male0.075145
child0.057803
australia0.057803
caecum0.052023
city of melbourne0.052023
felis catus0.046243
cat0.046243
cobb broiler chicken0.040462
age 35 days0.040462
germany0.040462
rectum0.040462
kingdom of spain0.040462
sweden0.040462
foxhound0.040462
captive0.034682
colon0.034682
mus musculus0.034682
mouse0.034682
formula fed0.034682
fourth decade human stage0.034682
female0.034682
2-5 year-old child stage0.028902
state of north carolina0.028902
broiler chicken0.028902
zoological garden0.028902
obesity0.028902
high bmi0.028902
seattle0.028902
colonized germ free0.028902
infant0.028902
skin0.028902
russia0.023121
canis lupus0.023121
wolf0.023121
farm0.023121
wild0.023121
zhejiang province0.023121
fifth decade human stage0.023121
cloaca0.017341
estonia0.017341
cystic fibrosis0.017341
cftr s489x0.017341
state of louisiana0.017341
colonic mucosa0.017341
sigmoid colon0.017341
milan0.017341
sigmoid colon brushing0.017341
human adult stage0.017341
indonesia0.017341
municipality of yogyakarta0.017341
midwest region0.017341
LOWER IN control0.017341
heterosexual0.017341
msw0.017341
mongolia0.017341
winter0.017341
lake hulun0.017341
french republic0.017341
rectal swab0.017341
hydrolized diet0.017341
high fiber0.017341
new zealand0.017341
israel0.017341
2-year-old human stage0.017341
taiwan0.017341
republic of china0.017341
LOWER IN duodenum0.017341
LOWER IN ileum0.017341
ovis aries0.017341
age 30 days0.017341
canada0.017341
sus scrofa0.017341
pig0.017341
jinzhou city prefecture0.017341
panthera tigris0.011561
tiger0.011561
viet nam0.011561
age 7 months0.011561
czech republic0.011561
thailand0.011561
non-celiac gluten sensitivity0.011561
dog breeding center0.011561
felis silvestris0.011561
wild cat0.011561
state of colorado0.011561
state of arizona0.011561
flagstaff0.011561
vulpes corsac0.011561
Exp. ID User ID Description Date Region Flag Sequences
574amnon high in control compared to primary progressive multiple sclerosis in feces homo sapiens adult russia 2020-01-05v3No1 / 2
666amnondominant feces, italy, panthera tigris, tiger2020-09-25v3No1 / 13
564amnon high in control compared to autistic disorder in feces homo sapiens child italy 2-5 year-old child stage 2019-11-18v3No1 / 14
702amnoncommon feces, united states of america, canis lupus familiaris, state of north carolina, dog2028-04-02v4No1 / 15
568amnondominant feces, gallus gallus, chicken, broiler chicken, viet nam2019-12-08v3No1 / 15
753amnondominant feces, zoological garden, adult, captive, canis lupus, china, wolf2021-03-12v4No1 / 16
744amnondominant research facility, cloaca, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 18
799amnonhigher before ketogenic diet compared to after ketogenic diet in obese participants ( high in control diet compared to ketogenic diet in feces homo sapiens obesity adult estonia high bmi )2021-06-13v3No1 / 18
301amnondominant united states of america, colon, canis lupus familiaris, dog2018-03-05v4No1 / 19
574amnondominant feces, homo sapiens, adult, russia2020-01-05v3No1 / 19
399amnondominant feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 20
619amnondominant feces, united states of america, research facility, mus musculus, mouse, cystic fibrosis, seattle, cftr s489x, colonized germ free2020-05-04v3No1 / 20
797amnondominant feces, homo sapiens, infant, germany, formula fed, age 7 months2021-06-13v3No1 / 20
744amnondominant research facility, caecum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 21
648amnondominant feces, canis lupus familiaris, dog, state of louisiana2020-09-06v4No1 / 22
552amnondominant feces, homo sapiens, czech republic2019-09-05v3No1 / 22
619amnondominant feces, control, united states of america, research facility, mus musculus, mouse, seattle, colonized germ free2020-05-04v3No1 / 22
851amnondominant homo sapiens, colonic mucosa, sigmoid colon, adult, italy, milan, sigmoid colon brushing2021-12-16v3No1 / 22
702amnondominant feces, united states of america, canis lupus familiaris, state of north carolina, dog2028-04-02v4No1 / 23
568amnondominant feces, gallus gallus, thailand, chicken, broiler chicken2019-12-08v3No1 / 23
843amnondominant feces, adult, italy, human adult stage, non-celiac gluten sensitivity2021-11-17v3No1 / 23
150amnondominant feces, united states of america, canis lupus familiaris, dog2017-04-26v4No1 / 24
340amnondominant feces, felis catus, australia, city of melbourne, cat2018-05-27v4No1 / 24
702amnondominant feces, united states of america, felis catus, state of north carolina, cat2028-04-02v4No1 / 24
753amnondominant feces, farm, adult, canis lupus familiaris, dog, china, dog breeding center2021-03-12v4No1 / 24
666amnondominant feces, italy, felis silvestris, wild cat2020-09-25v3No1 / 24
723amnondominant feces, homo sapiens, child, indonesia, municipality of yogyakarta, 2-5 year-old child stage2021-01-02v3No1 / 24
745amnondominant feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 24
436amnondominant feces, united states of america, felis catus, state of colorado, cat2018-12-25v4No1 / 25
619amnon high in cystic fibrosis cftr s489x compared to control in feces united states of america research facility mus musculus mouse seattle colonized germ free 2020-05-04v3No1 / 25
301amnondominant united states of america, rectum, canis lupus familiaris, dog2018-03-05v4No1 / 26
578amnondominant feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 26
150amnonhigh in EPI dogs with enzyme supplement compared to no supplement ( high in enzyme supplement compared to no enzyme supplement in feces united states of america canis lupus familiaris dog exocrine pancreatic insufficiency )2017-04-26v4No1 / 27
488amnondominant feces, control, canis lupus familiaris, italy, dog2019-02-25v4No1 / 27
540amnondominant feces, united states of america, canis lupus familiaris, state of arizona, flagstaff, dog2019-07-31v4No1 / 27
815amnondominant feces, mongolia, winter, wild, lake hulun, vulpes corsac, corsac fox2021-07-04v3No1 / 27
540amnoncommon feces, united states of america, canis lupus familiaris, state of arizona, flagstaff, dog2019-07-31v4No1 / 28
766amnoncommon feces, canis lupus familiaris, french republic, dog, age 8 weeks, rectal swab, puppy2021-04-12v4No1 / 28
822amnondominant feces, research facility, canis lupus familiaris, australia, city of melbourne, dog, foxhound, hydrolized diet2021-08-29v4No1 / 29
822amnondominant feces, research facility, canis lupus familiaris, australia, city of melbourne, high fiber, dog, foxhound2021-08-29v4No1 / 29
668amnondominant feces, research facility, felis catus, new zealand, cat2020-09-26v3No1 / 29
573amnoncommon feces, united states of america, juvenile stage, canis lupus familiaris, commonwealth of pennsylvania, dog2019-12-22v4No1 / 30
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 7 months 2021-06-13v3No1 / 31
666amnoncommon feces, italy, wild, canis lupus, wolf2020-09-25v3No1 / 32
745amnon high in 25-44 year-old human stage compared to human late adulthood stage in feces homo sapiens united states of america adult midwest region 2021-02-25v3No1 / 32
856amnoncommon homo sapiens, rectum, ulcerative colitis, adult, biopsy, intestinal mucosa, ulcerative colitis, china, human adult stage2022-01-09v3No1 / 33
706amnoncommon feces, united states of america, canis lupus familiaris, state of north carolina, dog2028-04-10v4No1 / 37
681amnoncommon feces, homo sapiens, adult, seoul, south korea2028-03-04v3No1 / 37
744amnoncommon research facility, ileum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 38
835amnoncommon feces, homo sapiens, adult, japan2021-09-11v3No1 / 40
825amnoncommon feces, homo sapiens, type i diabetes mellitus, child, type 1 diabetes mellitus, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 41
564amnoncommon feces, homo sapiens, autistic disorder, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 42
666amnoncommon feces, italy, panthera tigris, tiger2020-09-25v3No1 / 43
831amnoncommon feces, homo sapiens, adult, israel, pancreatic cancer2021-09-11v3No1 / 43
570amnoncommon feces, homo sapiens, india, bihar state2019-12-16v3No1 / 46
597amnoncommon feces, homo sapiens, control, adult, zhejiang province, china2020-03-23v3No1 / 46
666amnoncommon feces, canis lupus familiaris, italy, dog2020-09-25v3No1 / 46
797amnoncommon feces, homo sapiens, child, germany, formula fed, 2-year-old human stage2021-06-13v3No1 / 46
301amnoncommon united states of america, duodenum, canis lupus familiaris, dog2018-03-05v4No1 / 47
597amnoncommon feces, homo sapiens, adult, zhejiang province, gout, china2020-03-23v3No1 / 47
564amnoncommon feces, homo sapiens, control, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 50
797amnoncommon feces, homo sapiens, child, germany, breast fed, 2-year-old human stage2021-06-13v3No1 / 50
849amnoncommon feces, homo sapiens, adult, zhejiang province, multiple sclerosis, multiple sclerosis, china, fourth decade human stage2021-12-14v3No1 / 50
702amnoncommon feces, united states of america, felis catus, state of north carolina, cat2028-04-02v4No1 / 51
694amnoncommon feces, homo sapiens, female, obesity, adult, china, shanghai district2028-03-17v3No1 / 52
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 53
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in feces homo sapiens adult nanning city prefecture china sixth decade human stage )2018-01-27v4No1 / 54
766amnoncommon in feces of dog females within 24h after parturition (common feces, canis lupus familiaris, french republic, dog, female organism, adult organism, rectal swab, age 2-7 years)2021-04-12v4No1 / 55
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 55
745amnoncommon feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 55
488amnonlower in feces of dogs with lymphoma compared to healthy controls ( high in control compared to lymphoma in feces canis lupus familiaris italy dog )2019-02-25v4No1 / 56
488amnoncommon feces, canis lupus familiaris, italy, dog, lymphoma2019-02-25v4No1 / 56
648amnon high in control compared to antibiotic metronidazole in feces united states of america canis lupus familiaris dog state of louisiana 2020-09-06v4No1 / 56
650amnon high in female compared to male in feces homo sapiens united states of america adult state of new york 2020-09-10v4No1 / 57
759amnoncommon feces, united states of america, canis lupus familiaris, state of minnesota, dog, domestic2021-04-04v4No1 / 57
759amnoncommon feces, united states of america, state of minnesota, canis lupus, wolf, wildlife sactuary2021-04-04v4No1 / 58
843amnoncommon feces, adult, italy, human adult stage, non-celiac gluten sensitivity2021-11-17v3No1 / 59
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, vegetarian diet2021-01-22v3No1 / 60
831amnoncommon feces, homo sapiens, control, adult, israel2021-09-11v3No1 / 60
619amnoncommon feces, control, united states of america, research facility, mus musculus, mouse, seattle, colonized germ free2020-05-04v3No1 / 61
627amnoncommon feces, female, pregnancy, adult, china2020-05-16v3No1 / 61
849amnoncommon feces, homo sapiens, control, adult, zhejiang province, china, fourth decade human stage2021-12-14v3No1 / 61
619amnoncommon feces, united states of america, research facility, cystic fibrosis, mus musculus, mouse, seattle, cftr s489x, colonized germ free2020-05-04v3No1 / 64
734amnoncommon feces, homo sapiens, adult, taiwan, coronary heart disease, republic of china2021-01-22v3No1 / 66
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
574amnoncommon feces, homo sapiens, adult, russia2020-01-05v3No1 / 68
593amnoncommon feces, homo sapiens, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, omnivore diet2021-01-22v3No1 / 68
72amnoncommon feces, united states of america, canis lupus familiaris, iowa2017-02-25v4No1 / 69
301amnoncommon united states of america, ileum, canis lupus familiaris, dog2018-03-05v4No1 / 69
723amnoncommon feces, homo sapiens, female, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 69
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
656amnoncommon feces, homo sapiens, sri lanka, age 1-18 years, child stage, adolescent stage2020-09-13v3No1 / 71
851amnoncommon homo sapiens, colonic mucosa, sigmoid colon, adult, italy, milan, sigmoid colon brushing2021-12-16v3No1 / 71
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 74
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany 3-month-old human stage 2021-06-13v3No1 / 75
122amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united kingdom )2017-04-13v4No1 / 77
644amnonlower in individuals born in latin america compared to indivuals born in usa ( high in usa born compared to non usa born in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 77
799amnoncommon in obese participant fecal samples before ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi)2021-06-13v3No1 / 77
596amnon high in under-1-year-old human stage compared to age 1-7 years 2-5 year-old child stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 78
630amnoncommon feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 78
301amnon high in rectum colon compared to duodenum ileum in united states of america canis lupus familiaris dog 2018-03-05v4No1 / 79
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 82
648amnoncommon feces, united states of america, canis lupus familiaris, dog, state of louisiana2020-09-06v4No1 / 83
231amnoncommon in dog rectum (common feces, united states of america, rectum, canis lupus familiaris, dog)2017-11-02v4No1 / 84
150amnonhigh in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in control compared to enzyme supplementation exocrine pancreatic insufficiency in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 85
668amnoncommon feces, research facility, felis catus, new zealand, cat2020-09-26v3No1 / 85
680amnoncommon feces, homo sapiens, obesity, adult, russia, novosibirsk2028-03-04v3No1 / 85
340amnoncommon feces, felis catus, australia, city of melbourne, cat2018-05-27v4No1 / 87
666amnoncommon feces, italy, felis silvestris, wild cat2020-09-25v3No1 / 91
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 92
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 93
363amnoncommon dairy, rectum, caecum, colon, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 94
488amnoncommon feces, control, canis lupus familiaris, italy, dog2019-02-25v4No1 / 94
753amnoncommon feces, zoological garden, adult, captive, canis lupus, china, wolf2021-03-12v4No1 / 98
363amnon high in rectum caecum colon compared to ruminant reticulum omasum rumen in dairy ovis aries italy obsolete_juvenile stage age 30 days 2018-08-29v4No1 / 101
301amnoncommon united states of america, colon, canis lupus familiaris, dog2018-03-05v4No1 / 105
797amnon high in 12-month-old human stage compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 106
399amnoncommon feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 108
436amnoncommon feces, united states of america, felis catus, state of colorado, cat2018-12-25v4No1 / 108
822amnon high in hydrolized diet compared to high protein diet meat diet in feces research facility canis lupus familiaris australia city of melbourne dog foxhound 2021-08-29v4No1 / 110
565amnoncommon zoological garden, skin, captive, canada, canis lupus arctos, toronto zoo, arctic wolf2019-11-21v3No1 / 114
744amnoncommon research facility, cloaca, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 114
301amnoncommon united states of america, rectum, canis lupus familiaris, dog2018-03-05v4No1 / 116
822amnon high in high fiber compared to high protein diet meat diet in feces research facility canis lupus familiaris australia city of melbourne dog foxhound 2021-08-29v4No1 / 118
753amnoncommon feces, farm, adult, canis lupus familiaris, dog, china, dog breeding center2021-03-12v4No1 / 120
565amnoncommon zoological garden, skin, acinonyx jubatus, cheetah, captive, canada, african lion safari2019-11-21v3No1 / 123
69amnoncommon feces, united states of america, research facility, canis lupus familiaris, beagle dog2017-02-21v4No1 / 125
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 126
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 132
766amnon high in age 8 weeks compared to age 2 days in feces canis lupus familiaris french republic dog rectal swab puppy 2021-04-12v4No1 / 133
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united states of america )2017-04-11v4No1 / 139
797amnon high in child 2-year-old human stage compared to infant 12-month-old human stage in feces homo sapiens germany formula fed 2021-06-13v3No1 / 139
744amnoncommon research facility, caecum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 141
822amnoncommon feces, research facility, canis lupus familiaris, australia, city of melbourne, dog, foxhound, hydrolized diet2021-08-29v4No1 / 145
815amnoncommon feces, mongolia, winter, wild, lake hulun, vulpes corsac, corsac fox2021-07-04v3No1 / 146
15amnoncommon feces, namibia, canis mesomelas2016-11-08v4No1 / 147
565amnoncommon zoological garden, skin, panthera leo, lion, captive, canada, toronto zoo2019-11-21v3No1 / 150
822amnoncommon feces, research facility, canis lupus familiaris, australia, city of melbourne, dog, high protein diet, foxhound, meat diet2021-08-29v4No1 / 151
822amnoncommon feces, research facility, canis lupus familiaris, australia, city of melbourne, high fiber, dog, foxhound2021-08-29v4No1 / 153
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, bile, gallbladder, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
815amnoncommon feces, mongolia, winter, wild, vulpes vulpes, lake hulun, red fox2021-07-04v3No1 / 160
521amnoncommon in pre-weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 169
851amnon high in colonic mucosa sigmoid colon sigmoid colon brushing compared to feces in homo sapiens adult italy milan 2021-12-16v3No1 / 174
150amnoncommon feces, united states of america, canis lupus familiaris, dog2017-04-26v4No1 / 208
669amnon high in 12-month-old human stage compared to 2-month-old human stage in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
780amnon high in caecum compared to small intestine duodenum jejunum in research facility gallus gallus chicken china jinzhou city prefecture 2021-04-28v3No1 / 212
584amnoncommon feces, control, research facility, rattus norvegicus, sprague dawley, rat, china, male2020-01-31v3No1 / 221
10amnonpositively correlated with age (6-35) ( high in adult compared to child in feces homo sapiens toronto )2016-10-27v4No1 / 228
780amnoncommon research facility, small intestine, duodenum, jejunum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 232
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v4No1 / 239
744amnon high in cloaca compared to ileum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 265
568amnoncommon feces, gallus gallus, chicken, broiler chicken, viet nam2019-12-08v3No1 / 272
752sheryoHigher in treatments without biochar compared to treatments with biochar in soil planted with Panax notoginseng amended with 2% biochar ( high in without biochar compared to biochar in soil yunnan province ph 6 china panax notoginseng pot expreiment xundian county sanqi plants )2021-03-11v3No1 / 273
744amnon high in caecum compared to ileum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 286
780amnoncommon research facility, caecum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 294
723amnon high in 2-5 year-old child stage compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
208amnoncommon feces, united states of america, mus musculus, balb/c, state of texas, mouse2017-10-06v4No1 / 316
568amnoncommon feces, gallus gallus, thailand, chicken, broiler chicken2019-12-08v3No1 / 320
61amnoncommon united states of america, research facility, skin, inguinal region, canis lupus familiaris2017-02-05v4No1 / 327
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
776amnoncommon research facility, caecum, gallus gallus, hawaii, chicken, captive, broiler chicken, age 5 weeks2021-04-25v3No1 / 343
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v3No1 / 347
438amnonhigher in centenarians compared to adults ( high in age >94 ninth decade human stage tenth decade human stage compared to 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 474
738amnon high in age 30 days compared to age 1 week in caecum gallus gallus chicken united kingdom 2021-01-30v3No1 / 474
650amnon high in caucasian european compared to asian in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 475
438amnon high in adult 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage in feces homo sapiens china 2018-12-30v4No1 / 486
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage compared to soldiers young adult stage in feces homo sapiens china )2018-12-30v4No1 / 617
752sheryoCommon in soil planted with Panax notoginseng (common soil, yunnan province, ph 6, china, panax notoginseng, pot expreiment, xundian county, sanqi plants)2021-03-11v3No1 / 730
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
816amnonlower in sows in first pregnancy compared to later pregnancies ( high in multiple pregnancies compared to first pregnancy in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism )2021-07-04v4No1 / 780
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v4No1 / 836
649amnon high in colon compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 1261

Problems / suggestions? Please email info AT dbbact DOT org