Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTTAAGCAAGTCAGAAGTGAAAGGCTGGGGCTCAACCCCGGGACTGCTTTTGAAACTGTTTAACTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.325581
feces0.315880
canada0.264901
adult0.259134
zoological garden0.225519
china0.146479
captive0.142012
rural community0.120301
kingdom of spain0.108844
african lion safari0.103704
farm0.087805
child0.086822
control0.082702
united states of america0.082536
male0.081081
small village0.078329
city0.076433
thailand0.076336
gay0.076336
msm0.073529
homosexual0.073529
gallus gallus0.070922
chicken0.070922
peromyscus maniculatus0.062016
deer mice0.062016
province of ontario0.062016
algonquin provincial park0.062016
toronto zoo0.062016
hefei city prefecture0.062016
baijiu0.062016
age 3-5 weeks0.060150
fermentation pit mud0.060150
mud0.060150
broiler chicken0.058394
skin0.057866
wild0.051613
infant0.050314
sweden0.049689
days 180-2700.047244
cow milk (raw)0.047244
cow milk (fluid)0.047244
milk0.047244
kingdom of denmark0.046875
female0.046243
LOWER IN united states of america0.046154
age < 3 years0.046154
LOWER IN crohn&#39;s disease0.046154
kingdom of norway0.045113
chimpanzee0.045113
ethiopia0.045113
germany0.042705
monkey0.041379
hiv infection0.040541
obsolete_juvenile stage0.039735
research facility0.039062
italy0.038961
macropus rufus0.032000
red kangaroo0.032000
tragelaphus oryx0.032000
eland0.032000
taiwan0.032000
taipei city0.032000
oslo0.032000
age 30-400.032000
como zoo0.032000
cron diet0.032000
cameroon0.032000
el salvador0.032000
estonia0.032000
LOWER IN age 3-60.032000
caecum0.032000
nouabale-ndoki national park0.032000
republic of congo0.032000
lowland pasture0.032000
lowland farm0.032000
tunapuco0.032000
hunter gatherer0.032000
lincoln park zoo0.032000
alpine meadow0.032000
ruminal fluid0.032000
chlorocebus aethiops0.032000
chuquisaca department0.032000
LOWER IN nouabale-ndoki national park0.032000
LOWER IN republic of congo0.032000
russia0.031746
LOWER IN heterosexual0.031746
LOWER IN msw0.031746
viet nam0.031496
giraffe0.031496
biopsy0.031496
caloric restriction diet0.031496
jiangxi province0.031496
peru0.031496
chicago0.031496
yak0.031496
age 5-13 years0.031496
sugarcane0.031496
saccharum0.031496
guangzhou city prefecture0.031496
LOWER IN ulcerative colitis0.031250
Fraction of dbbact annotations with this term covered by the query
TermScore
small village0.750000
canada0.666667
rural community0.666667
macropus rufus0.500000
red kangaroo0.500000
african lion safari0.500000
peromyscus maniculatus0.500000
deer mice0.500000
province of ontario0.500000
algonquin provincial park0.500000
tragelaphus oryx0.500000
eland0.500000
toronto zoo0.500000
thailand0.500000
hefei city prefecture0.500000
baijiu0.500000
days 180-2700.500000
bihar state0.500000
gout0.500000
athlete0.500000
osteoarthritis0.500000
gay0.500000
madrid0.500000
taiwan0.500000
taipei city0.500000
eidolon helvum0.500000
fruit bat0.500000
hmong0.500000
sciurus carolinensis0.500000
eastern gray squirrel0.500000
pteropus giganteus0.500000
indian flying fox0.500000
LOWER IN irritable bowel syndrome0.500000
parkinson's disease0.500000
oslo0.500000
age 30-400.500000
emperor tamarin0.500000
saguinus imperator0.500000
como zoo0.500000
myanmar0.500000
karen0.500000
cron diet0.500000
rem sleep behavior disorder0.500000
cameroon0.500000
ngoantet0.500000
alpine pasture0.500000
alpine0.500000
cow milk (raw)0.500000
cow milk (fluid)0.500000
milk0.500000
yaounde0.500000
el salvador0.500000
gallbladder0.500000
bile0.500000
cholelithiasis0.500000
estonia0.500000
age 8-120.500000
age 13-140.500000
LOWER IN age 3-60.500000
LOWER IN russia0.500000
preweaned0.500000
age 2-4 weeks0.500000
suckling0.500000
low anterior resection0.500000
caecum0.500000
low income0.500000
LOWER IN sewer0.500000
LOWER IN wastewater treatment plant0.500000
village0.500000
nouabale-ndoki national park0.500000
republic of congo0.500000
induced type 1 diabetes0.500000
ammotragus lervia0.500000
barbary sheep0.500000
LOWER IN days 0-900.500000
toronto0.500000
lowland pasture0.500000
lowland farm0.500000
tunapuco0.500000
nanchang city prefecture0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
LOWER IN lima0.500000
LOWER IN shantytown0.500000
hadza0.500000
hunter gatherer0.500000
janvier labs0.500000
LOWER IN high sugar diet0.500000
LOWER IN age 18 weeks0.500000
equus asinus africanus0.500000
donkey0.500000
lincoln park zoo0.500000
alpine meadow0.500000
ruminal fluid0.500000
green stage diet0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.727273
homo sapiens0.545455
adult0.289256
china0.181818
canada0.165289
united states of america0.165289
zoological garden0.157025
skin0.132231
captive0.099174
control0.099174
farm0.074380
kingdom of spain0.066116
rural community0.066116
african lion safari0.057851
child0.057851
male0.049587
city0.049587
gallus gallus0.041322
chicken0.041322
thailand0.041322
msm0.041322
gay0.041322
homosexual0.041322
research facility0.041322
small village0.041322
peromyscus maniculatus0.033058
deer mice0.033058
age 3-5 weeks0.033058
province of ontario0.033058
algonquin provincial park0.033058
wild0.033058
toronto zoo0.033058
broiler chicken0.033058
hefei city prefecture0.033058
baijiu0.033058
fermentation pit mud0.033058
mud0.033058
sweden0.033058
female0.033058
infant0.033058
days 180-2700.024793
hiv infection0.024793
kingdom of norway0.024793
germany0.024793
italy0.024793
cow milk (raw)0.024793
cow milk (fluid)0.024793
milk0.024793
LOWER IN united states of america0.024793
obsolete_juvenile stage0.024793
age < 3 years0.024793
LOWER IN crohn&#39;s disease0.024793
kingdom of denmark0.024793
chimpanzee0.024793
monkey0.024793
ethiopia0.024793
soil0.024793
macropus rufus0.016529
red kangaroo0.016529
tragelaphus oryx0.016529
eland0.016529
bos taurus0.016529
cow0.016529
viet nam0.016529
giraffa camelopardalis0.016529
giraffe0.016529
zhejiang province0.016529
LOWER IN feces0.016529
colon0.016529
russia0.016529
LOWER IN ulcerative colitis0.016529
taiwan0.016529
taipei city0.016529
state of colorado0.016529
rectum0.016529
biopsy0.016529
LOWER IN heterosexual0.016529
LOWER IN msw0.016529
oslo0.016529
age 30-400.016529
state of minnesota0.016529
como zoo0.016529
cron diet0.016529
caloric restriction diet0.016529
cameroon0.016529
egypt0.016529
el salvador0.016529
united kingdom0.016529
estonia0.016529
LOWER IN finland0.016529
LOWER IN age 3-60.016529
pig0.016529
sus scrofa0.016529
jiangxi province0.016529
caecum0.016529
nouabale-ndoki national park0.016529
republic of congo0.016529
rattus norvegicus0.016529
rat0.016529
sprague dawley0.016529
Exp. ID User ID Description Date Region Flag Sequences
565amnondominant skin, canada, macropus rufus, red kangaroo, zoological garden, captive, african lion safari2019-11-21v3No1 / 9
537amnonhigh freq. in feces of wild caught deer mice feces (dominant feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, wild)2019-07-28v3No1 / 10
565amnondominant skin, canada, zoological garden, captive, tragelaphus oryx, eland, toronto zoo2019-11-21v3No1 / 10
565amnondominant skin, canada, farm, bos taurus, cow2019-11-21v3No1 / 12
568amnondominant gallus gallus, chicken, feces, broiler chicken, viet nam2019-12-08v3No1 / 15
565amnondominant skin, canada, zoological garden, captive, african lion safari, giraffa camelopardalis, giraffe2019-11-21v3No1 / 18
568amnondominant gallus gallus, chicken, feces, broiler chicken, thailand2019-12-08v3No1 / 23
603amnondominant in baijiu fermentation pit mud in later batches (dominant hefei city prefecture, china, baijiu, fermentation pit mud, mud, days 180-270)2020-04-05v3No1 / 23
570amnoncommon homo sapiens, feces, india, bihar state2019-12-16v3No1 / 46
597amnoncommon homo sapiens, feces, adult, zhejiang province, china, control2020-03-23v3No1 / 46
597amnoncommon homo sapiens, feces, adult, zhejiang province, china, gout2020-03-23v3No1 / 47
578amnoncommon homo sapiens, feces, adult, male, kingdom of spain, sweden, msw, heterosexual, hiv infection2020-01-14v3No1 / 53
565amnoncommon skin, canada, equus caballus, horse, farm2019-11-21v3No1 / 58
627amnoncommon feces, pregnancy, adult, female, china2020-05-16v3No1 / 61
575amnoncommon in professional martial arts athletes (common homo sapiens, feces, athlete, high physical activity, adult, china, age 19-24)2020-01-05v3No1 / 63
194amnon high in colon ileum compared to feces in homo sapiens kingdom of norway 2017-09-07v4No1 / 67
574amnoncommon feces, homo sapiens, russia, adult2020-01-05v3No1 / 68
593amnoncommon homo sapiens, feces, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
394amnon high in control compared to ulcerative colitis in homo sapiens feces adult united states of america state of california 2018-11-06v4No1 / 71
578amnoncommon homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, hiv infection2020-01-14v3No1 / 74
630amnoncommon madrid, kingdom of spain, feces, adult, homo sapiens2020-06-01v3No1 / 78
529amnoncommon homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v3No1 / 79
565amnoncommon skin, canada, eidolon helvum, fruit bat, zoological garden, toronto zoo, captive2019-11-21v3No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
565amnoncommon skin, canada, sciurus carolinensis, eastern gray squirrel2019-11-21v3No1 / 104
565amnoncommon skin, canada, pteropus giganteus, indian flying fox, zoological garden, captive, african lion safari2019-11-21v3No1 / 109
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
294amnon high in control compared to irritable bowel syndrome in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 121
393amnon high in gay homosexual msm compared to heterosexual msw in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 121
537amnoncommon in feces of captive grown deer mice feces (common feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, research facility, captive)2019-07-28v3No1 / 121
565amnoncommon skin, canada, zoological garden, captive, african lion safari, ceratotherium simum, white rhinoceros2019-11-21v3No1 / 122
607amnoncommon germany, homo sapiens, feces, parkinson's disease2020-04-19v4No1 / 125
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
625amnoncommon emperor tamarin, saguinus imperator, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 132
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
578amnoncommon homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, control2020-01-14v3No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
607amnoncommon germany, homo sapiens, feces, rem sleep behavior disorder2020-04-19v4No1 / 134
594amnoncommon adult, cameroon, feces, homo sapiens, ngoantet, rural community2020-03-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
617amnoncommon alpine pasture, alpine, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 137
62amnon high in egypt compared to united states of america in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 144
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
594amnoncommon adult, cameroon, feces, homo sapiens, city, yaounde2020-03-12v4No1 / 154
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
537amnoncommon in feces of wild caught deer mice feces (common feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, wild)2019-07-28v3No1 / 163
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 168
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
521amnoncommon in pre-weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No1 / 169
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
604amnoncommon chicken, gallus gallus, cecal content, caecum, china, research facility2020-04-06v3No1 / 185
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 188
620amnoncommon village, rural community, homo sapiens, nouabale-ndoki national park, republic of congo, feces2020-05-06v4No1 / 197
584amnoncommon male, rattus norvegicus, rat, sprague dawley, research facility, feces, china, type i diabetes mellitus, induced type 1 diabetes2020-01-31v3No1 / 202
565amnoncommon skin, canada, ammotragus lervia, barbary sheep, zoological garden, captive, african lion safari2019-11-21v3No1 / 205
603amnonlower in inital batches of baijiu fermentation pit mud ( high in days 180-270 compared to days 0-90 in mud hefei city prefecture china baijiu fermentation pit mud )2020-04-05v3No1 / 205
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
584amnoncommon male, rattus norvegicus, rat, sprague dawley, research facility, feces, control, china2020-01-31v3No1 / 221
10amnonpositively correlated with age (6-35) ( high in adult compared to child in homo sapiens feces toronto )2016-10-27v4No1 / 228
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
617amnoncommon lowland pasture, lowland farm, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 257
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
568amnoncommon gallus gallus, chicken, feces, broiler chicken, viet nam2019-12-08v3No1 / 272
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
565amnoncommon skin, canada, zoological garden, captive, african lion safari, giraffa camelopardalis, giraffe2019-11-21v3No1 / 310
190amnon high in dry season compared to wet season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 311
565amnoncommon skin, canada, farm, bos taurus, cow2019-11-21v3No1 / 318
568amnoncommon gallus gallus, chicken, feces, broiler chicken, thailand2019-12-08v3No1 / 320
522amnon high in mouse chow age 6 weeks compared to high sugar diet age 18 weeks in mouse mus musculus feces germany research facility female c57bl/6j janvier labs 2019-07-03v3No1 / 325
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
565amnoncommon skin, canada, equus asinus africanus, donkey, farm2019-11-21v3No1 / 335
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 345
620amnoncommon lincoln park zoo, chicago, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 358
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to captive research facility in feces canada peromyscus maniculatus deer mice age 3-5 weeks province of ontario algonquin provincial park )2019-07-28v3No1 / 358
565amnoncommon skin, canada, macropus rufus, red kangaroo, zoological garden, captive, african lion safari2019-11-21v3No1 / 360
565amnoncommon skin, canada, papio anubis, olive baboon, zoological garden, captive, toronto zoo2019-11-21v3No1 / 368
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
620amnoncommon lincoln park zoo, united states of america, chicago, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 384
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
561amnon high in green stage diet spring compared to summer grass growth diet in bos grunniens yak china tibetan plateau alpine meadow rumen ruminal fluid 2019-11-05v3No1 / 397
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
625amnoncommon pongo abelii, sumatran orangutan, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 414
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
620amnon high in chimpanzee pan troglodytes troglodytes compared to gorilla gorilla in nouabale-ndoki national park republic of congo wild feces 2020-05-06v4No1 / 478
617amnonlower in cow milk of cows in alpine pasture compared to lowland farm ( high in lowland farm lowland pasture compared to alpine pasture alpine in farm italy cow milk (raw) cow milk (fluid) milk )2020-05-03v3No1 / 484
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
578amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to msw heterosexual in homo sapiens feces hiv infection kingdom of spain sweden adult male )2020-01-14v3No1 / 519
620amnoncommon saint louis zoo, saint louis, united states of america, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 530
603amnoncommon in baijiu fermentation pit mud in first 2 batches (common mud, fermentation pit mud, baijiu, china, hefei city prefecture, days 0-90)2020-04-05v3No1 / 542
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
603amnoncommon in baijiu fermentation pit mud in later batches (common hefei city prefecture, china, baijiu, fermentation pit mud, mud, days 180-270)2020-04-05v3No1 / 608
561amnoncommon bos grunniens, yak, china, tibetan plateau, alpine meadow, rumen, ruminal fluid2019-11-05v3No1 / 670
565amnoncommon skin, canada, zoological garden, captive, tragelaphus oryx, eland, toronto zoo2019-11-21v3No1 / 674
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
620amnon high in united states of america zoological garden pan troglodytes compared to nouabale-ndoki national park republic of congo wild pan troglodytes troglodytes in chimpanzee feces 2020-05-06v4No1 / 964
610sheryoCommon in agricultural field soil amended with straw (common straw, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 998
620amnon high in united states of america zoological garden compared to nouabale-ndoki national park wild republic of congo in gorilla gorilla gorilla feces 2020-05-06v4No1 / 1019
616amnoncommon in topsoil of non-fertilized sugarcane field (common ph 6.7, sugarcane, saccharum, soil, topsoil, depth 0-20cm, china, guangzhou city prefecture, non-fertilized soil)2020-04-27v3No1 / 1277
616amnoncommon in topsoil of PK/NP/NPK/NK fertilized sugarcane field (common fertilized soil, ph 5.5-6, sugarcane, saccharum, soil, topsoil, depth 0-20cm, china, guangzhou city prefecture)2020-04-27v3No1 / 1710

Problems / suggestions? Please email info AT dbbact DOT org