Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTTGTGCAAGTCTGAAGTGAAAGGCGGGGGCTTAACCCCCGGACTGCTTTGGAAACTGTACGGCTTGAGTACCGGAGGGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
LOWER IN equine grass sickness0.500000
LOWER IN equus przewalskii0.500000
equus caballus0.444444
LOWER IN disease0.333333
horse0.250000
united kingdom0.181818
farm0.066667
feces0.017391
control0.013986
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN equine grass sickness0.500000
LOWER IN equus przewalskii0.500000
equus caballus0.285714
LOWER IN disease0.250000
horse0.166667
united kingdom0.111111
farm0.035714
feces0.008772
control0.007092
Fraction of annotations for the query sequences containing the term
TermScore
equus caballus1.000000
feces1.000000
horse0.500000
farm0.500000
control0.500000
LOWER IN equine grass sickness0.500000
LOWER IN disease0.500000
united kingdom0.500000
LOWER IN equus przewalskii0.500000

Problems / suggestions? Please email info AT dbbact DOT org