Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTTTTGCAAGTCTGAAGTGAAAGCCCGGGGCTTAACCCCGGGACTGCTTTGGAAACTGTAGAACTAGAGTGCAGGAGAGGTAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.590239
feces0.503800
adult0.495445
united states of america0.219780
control0.176205
child0.175084
china0.145524
city0.130570
infant0.099150
obsolete_juvenile stage0.091603
LOWER IN crohn's disease0.080000
rural community0.078329
kingdom of spain0.075377
age0.074074
jiangsu province0.073529
age 50-60 years0.064516
nanning city prefecture0.064516
female0.058480
LOWER IN age < 1 year0.050000
age 5-13 years0.049793
taiwan0.049180
taipei city0.049180
ethiopia0.049180
LOWER IN ulcerative colitis0.048780
finland0.048780
biopsy0.048583
monkey0.046875
pig0.046332
sus scrofa0.046332
age > 1 year0.033613
metabolic syndrome0.033613
guangzhou city prefecture0.033333
himalayas0.033333
commonwealth of pennsylvania0.033333
nanchang city prefecture0.033333
thailand0.033333
oslo0.033333
age 30-400.033333
gallbladder0.033333
bile0.033333
cholelithiasis0.033333
cron diet0.033333
toronto0.033333
LOWER IN russia0.033333
weaned0.033333
age 4-7 weeks0.033333
corn and soybean diet0.033333
africa0.033333
chlorocebus aethiops0.033333
chuquisaca department0.033333
colombia0.033058
LOWER IN infant0.033058
LOWER IN hiv infection0.032787
nepal0.032787
low bmi0.032787
LOWER IN child0.032787
caloric restriction diet0.032787
age < 3 years0.032787
india0.032787
jiangxi province0.032787
kingdom of denmark0.032787
state of michigan0.032520
LOWER IN high bmi0.032520
biopsy site0.032258
bolivia0.032258
united kingdom0.032000
rectum0.032000
state of colorado0.030769
belgium0.030769
kingdom of norway0.030303
state of california0.029630
farm0.024691
sudan0.016949
LOWER IN type i diabetes mellitus0.016949
LOWER IN stroke0.016949
LOWER IN endospore enriched fraction0.016949
LOWER IN lysis0.016949
schizophrenia0.016949
tharu0.016949
agrarian0.016949
raute0.016949
age 17-290.016949
quito0.016949
LOWER IN nephrolithiasis0.016949
age 200.016949
LOWER IN egypt0.016949
metabolic syndrome x0.016949
hmong0.016949
age 19-240.016949
age 8-120.016949
LOWER IN inflammatory bowel disease0.016949
age 3-60.016949
lima0.016949
shantytown0.016949
mild0.016949
LOWER IN severe0.016949
gangcha region0.016949
LOWER IN gannan tibetan autonomous prefecture0.016949
age 30-500.016949
irritable bowel syndrome0.016949
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN age < 1 year0.750000
age > 1 year0.666667
age 5-13 years0.666667
metabolic syndrome0.666667
LOWER IN crohn's disease0.555556
sudan0.500000
LOWER IN type i diabetes mellitus0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
taiwan0.500000
taipei city0.500000
guangzhou city prefecture0.500000
LOWER IN stroke0.500000
LOWER IN endospore enriched fraction0.500000
LOWER IN lysis0.500000
schizophrenia0.500000
himalayas0.500000
tharu0.500000
agrarian0.500000
commonwealth of pennsylvania0.500000
raute0.500000
age 17-290.500000
quito0.500000
LOWER IN nephrolithiasis0.500000
age 200.500000
LOWER IN egypt0.500000
metabolic syndrome x0.500000
nanchang city prefecture0.500000
thailand0.500000
hmong0.500000
age 19-240.500000
age 8-120.500000
LOWER IN inflammatory bowel disease0.500000
age 3-60.500000
lima0.500000
shantytown0.500000
mild0.500000
LOWER IN severe0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
age 30-500.500000
irritable bowel syndrome0.500000
age >940.500000
oslo0.500000
age 30-400.500000
gallbladder0.500000
bile0.500000
cholelithiasis0.500000
myanmar0.500000
karen0.500000
cron diet0.500000
age 13-140.500000
age 130.500000
toronto0.500000
LOWER IN russia0.500000
glasgow0.500000
age<17 years0.500000
estonia0.500000
low anterior resection0.500000
age 1-3 years0.500000
canada0.500000
atherosclerosis0.500000
theropithecus gelada0.500000
ethiopia0.500000
nephrolithiasis0.500000
age 1-20.500000
LOWER IN age 0-10.500000
bangladesh0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
africa0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
chlorocebus aethiops0.500000
grivet monkey0.500000
vervet monkey0.500000
sigmoid colon0.500000
children0.500000
age one year0.500000
LOWER IN age one month0.500000
central african republic0.500000
LOWER IN madagascar0.500000
bangui0.500000
LOWER IN antananarivo0.500000
LOWER IN age <1 year0.500000
estuary0.500000
estuary water0.500000
salinity <5 ppt0.500000
LOWER IN salinity >20 ppt0.500000
bilbao0.500000
chuquisaca department0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.922414
feces0.922414
adult0.525862
united states of america0.344828
control0.224138
china0.198276
child0.112069
city0.077586
infant0.060345
obsolete_juvenile stage0.051724
age0.043103
rural community0.043103
female0.043103
jiangsu province0.043103
LOWER IN crohn's disease0.043103
kingdom of spain0.043103
age 50-60 years0.034483
nanning city prefecture0.034483
taiwan0.025862
taipei city0.025862
LOWER IN age < 1 year0.025862
age 5-13 years0.025862
biopsy0.025862
LOWER IN ulcerative colitis0.025862
finland0.025862
monkey0.025862
ethiopia0.025862
pig0.025862
sus scrofa0.025862
guangzhou city prefecture0.017241
age > 1 year0.017241
LOWER IN hiv infection0.017241
nepal0.017241
himalayas0.017241
commonwealth of pennsylvania0.017241
state of michigan0.017241
state of colorado0.017241
colombia0.017241
low bmi0.017241
LOWER IN high bmi0.017241
state of california0.017241
metabolic syndrome0.017241
nanchang city prefecture0.017241
thailand0.017241
biopsy site0.017241
LOWER IN child0.017241
belgium0.017241
kingdom of norway0.017241
oslo0.017241
age 30-400.017241
gallbladder0.017241
bile0.017241
LOWER IN control0.017241
cholelithiasis0.017241
cron diet0.017241
caloric restriction diet0.017241
toronto0.017241
LOWER IN infant0.017241
age < 3 years0.017241
LOWER IN russia0.017241
united kingdom0.017241
rectum0.017241
india0.017241
farm0.017241
jiangxi province0.017241
weaned0.017241
age 4-7 weeks0.017241
corn and soybean diet0.017241
kingdom of denmark0.017241
africa0.017241
chlorocebus aethiops0.017241
bolivia0.017241
chuquisaca department0.017241
sudan0.008621
LOWER IN type i diabetes mellitus0.008621
LOWER IN diabetes mellitus0.008621
LOWER IN stroke0.008621
LOWER IN endospore enriched fraction0.008621
LOWER IN lysis0.008621
schizophrenia0.008621
czech republic0.008621
tharu0.008621
agrarian0.008621
raute0.008621
age 17-290.008621
state of ohio0.008621
ecuador0.008621
quito0.008621
commonwealth of virginia0.008621
LOWER IN nephrolithiasis0.008621
msw0.008621
heterosexual0.008621
lean body mass0.008621
italy0.008621
high bmi0.008621
obesity0.008621
state of arizona0.008621
age 200.008621
LOWER IN egypt0.008621
metabolic syndrome x0.008621
Exp. ID User ID Description Date Region Flag Sequences
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces child obsolete_juvenile stage sudan 2018-08-30v4No1 / 14
286amnonhigh freq. in feces of individuals without kidney stones (highfreq homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 22
529amnonhighfreq homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v3No1 / 27
333amnonlower in stroke patients compared to healthy controls ( high in control compared to stroke in homo sapiens feces guangzhou city prefecture adult china )2018-05-15v4No1 / 30
233amnon high in age age > 1 year compared to age < 1 year in feces homo sapiens infant united states of america 2017-11-05v4No1 / 37
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in homo sapiens feces united states of america adult )2018-11-18v4No1 / 41
333amnoncommon in healthy controls feces (common homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 61
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 63
51amnon high in control compared to hiv infection in homo sapiens feces united states of america 2017-01-19v4No1 / 69
22amnon high in control compared to hiv infection in united states of america feces homo sapiens 2016-11-28v4No1 / 70
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v4No1 / 76
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 77
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
529amnoncommon homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v3No1 / 79
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v4No1 / 81
562amnoncommon age 5-13 years, child, ecuador, quito, feces2019-11-05v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in homo sapiens feces adult age 50-60 years nanning city prefecture china )2018-01-27v4No1 / 83
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
404amnon high in lean body mass low bmi compared to high bmi in homo sapiens feces adult colombia city 2018-11-20v4No1 / 84
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 85
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
293amnonhigher in lean participants in human feces ( high in low bmi compared to high bmi in united states of america feces adult homo sapiens )2018-02-07v4No1 / 96
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
438amnoncommon homo sapiens, feces, age 19-24, china2018-12-30v4No1 / 101
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
526amnon high in cholelithiasis compared to control in homo sapiens gallbladder bile adult kingdom of spain 2019-07-14v3No1 / 131
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 148
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens adult feces china 2018-02-05v4No1 / 161
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon adult, homo sapiens, china, feces2019-11-24v4No1 / 221
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
10amnonpositively correlated with age (6-35) ( high in adult compared to child in homo sapiens feces toronto )2016-10-27v4No1 / 228
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 232
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752

Problems / suggestions? Please email info AT dbbact DOT org