Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTTTTGCAAGTCTGAAGTGAAAGCCCGGGGCTTAACCCCGGGACTGCTTTGGAAACTGTAGGACTAGAGTGCAGGAGAGGTAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.619395
feces0.511416
adult0.448211
child0.230668
rural community0.196721
united states of america0.184877
control0.154545
obsolete_juvenile stage0.128280
city0.125595
china0.119326
sus scrofa0.084848
pig0.084848
kingdom of spain0.083665
small village0.078947
jiangsu province0.071429
united kingdom0.060060
infant0.060060
colombia0.053691
nigeria0.053333
africa0.052632
himalayas0.052632
india0.052632
chuquisaca department0.052632
age 5-13 years0.052632
LOWER IN crohn's disease0.052288
nepal0.051282
bolivia0.050000
age0.049080
caecum0.043011
female0.042857
hunter gatherer0.040541
taipei city0.040000
taiwan0.040000
age 60-790.040000
age 30-500.040000
thailand0.040000
right colon0.039604
LOWER IN united states of america0.039474
state of colorado0.038835
ethiopia0.038462
czech republic0.037736
monkey0.035714
farm0.033898
state of oklahoma0.027211
homosexual0.027211
gay0.027211
msm0.027211
metabolic syndrome0.027211
amerindian0.027211
venezuela0.027211
azerbaijan0.027027
madagascar0.027027
antananarivo0.027027
nanchang city prefecture0.027027
glasgow0.027027
oslo0.027027
age 30-400.027027
cholelithiasis0.027027
bile0.027027
gallbladder0.027027
myanmar0.027027
karen0.027027
cron diet0.027027
age 130.027027
kebbi state0.027027
age 10-15 years0.027027
el salvador0.027027
LOWER IN age < 1 year0.027027
age 50-60 years0.027027
nanning city prefecture0.027027
tunapuco0.027027
corn and soybean diet0.027027
age 4-7 weeks0.027027
weaned0.027027
bilbao0.027027
estuary0.027027
estuary water0.027027
salinity <5 ppt0.027027
chlorocebus aethiops0.027027
LOWER IN mouth mucosa0.027027
biopsy0.026846
LOWER IN infant0.026846
LOWER IN city0.026667
LOWER IN child0.026667
caloric restriction diet0.026667
egypt0.026667
south america0.026667
peru0.026667
jiangxi province0.026667
kingdom of denmark0.026667
state of michigan0.026490
finland0.026490
LOWER IN ulcerative colitis0.026490
LOWER IN duodenum0.026490
duodenum0.026316
juvenile organism0.026316
left colon0.026316
rectum0.026144
LOWER IN mouth0.025316
kingdom of norway0.025000
Fraction of dbbact annotations with this term covered by the query
TermScore
rural community0.857143
colombia0.800000
small village0.750000
hunter gatherer0.750000
nigeria0.666667
state of oklahoma0.666667
homosexual0.666667
gay0.666667
msm0.666667
metabolic syndrome0.666667
amerindian0.666667
venezuela0.666667
LOWER IN type i diabetes mellitus0.500000
azerbaijan0.500000
non c. diff diarrhea0.500000
LOWER IN clostridium difficile intestinal infectious disease0.500000
taipei city0.500000
taiwan0.500000
plant diet0.500000
LOWER IN endospore enriched fraction0.500000
LOWER IN lysis0.500000
daycare0.500000
age 1-5 years0.500000
native american0.500000
arapaho0.500000
cheyenne0.500000
jordan0.500000
africa0.500000
madagascar0.500000
antananarivo0.500000
himalayas0.500000
tharu0.500000
agrarian0.500000
raute0.500000
central african republic0.500000
bangui0.500000
india0.500000
denver0.500000
age 200.500000
raji0.500000
metabolic syndrome x0.500000
nanchang city prefecture0.500000
chepang0.500000
age 19-240.500000
intestinal contents0.500000
LOWER IN central african republic0.500000
LOWER IN bangui0.500000
age 8-120.500000
age 3-60.500000
lima0.500000
shantytown0.500000
age 60-790.500000
chuquisaca department0.500000
age 5-13 years0.500000
age 30-500.500000
irritable bowel syndrome0.500000
LOWER IN irritable bowel syndrome0.500000
age >940.500000
glasgow0.500000
oslo0.500000
age 30-400.500000
cholelithiasis0.500000
bile0.500000
gallbladder0.500000
myanmar0.500000
thailand0.500000
karen0.500000
cron diet0.500000
age 13-140.500000
age 130.500000
toronto0.500000
physical activity0.500000
LOWER IN little physical activity0.500000
kebbi state0.500000
age 10-15 years0.500000
schistosomiasis0.500000
urinary schistosomiasis0.500000
el salvador0.500000
estonia0.500000
age<17 years0.500000
LOWER IN age 1-3 weeks0.500000
hadza0.500000
low anterior resection0.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
low income0.500000
LOWER IN sewer0.500000
LOWER IN wastewater treatment plant0.500000
spondylitis0.500000
spondyloarthritis0.500000
LOWER IN age >940.500000
atherosclerosis0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
age 1-20.500000
LOWER IN age 0-10.500000
bangladesh0.500000
tunapuco0.500000
LOWER IN pancreatitis0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.895833
feces0.888889
adult0.437500
united states of america0.243056
control0.166667
china0.159722
child0.152778
rural community0.111111
obsolete_juvenile stage0.076389
city0.076389
sus scrofa0.048611
pig0.048611
kingdom of spain0.048611
small village0.041667
jiangsu province0.041667
united kingdom0.034722
infant0.034722
nigeria0.027778
colombia0.027778
africa0.027778
nepal0.027778
himalayas0.027778
india0.027778
female0.027778
caecum0.027778
chuquisaca department0.027778
bolivia0.027778
age 5-13 years0.027778
LOWER IN crohn's disease0.027778
age0.027778
czech republic0.020833
taipei city0.020833
taiwan0.020833
state of colorado0.020833
right colon0.020833
age 60-790.020833
age 30-500.020833
hunter gatherer0.020833
thailand0.020833
LOWER IN united states of america0.020833
farm0.020833
monkey0.020833
ethiopia0.020833
azerbaijan0.013889
LOWER IN city0.013889
diet0.013889
state of oklahoma0.013889
madagascar0.013889
antananarivo0.013889
state of california0.013889
homosexual0.013889
gay0.013889
msm0.013889
metabolic syndrome0.013889
nanchang city prefecture0.013889
biopsy0.013889
duodenum0.013889
state of michigan0.013889
amerindian0.013889
venezuela0.013889
glasgow0.013889
LOWER IN child0.013889
kingdom of norway0.013889
oslo0.013889
age 30-400.013889
LOWER IN control0.013889
cholelithiasis0.013889
bile0.013889
gallbladder0.013889
myanmar0.013889
karen0.013889
cron diet0.013889
caloric restriction diet0.013889
age 130.013889
juvenile organism0.013889
finland0.013889
egypt0.013889
LOWER IN infant0.013889
kebbi state0.013889
age 10-15 years0.013889
el salvador0.013889
LOWER IN ulcerative colitis0.013889
LOWER IN age < 1 year0.013889
south america0.013889
rectum0.013889
age 50-60 years0.013889
nanning city prefecture0.013889
peru0.013889
tunapuco0.013889
corn and soybean diet0.013889
age 4-7 weeks0.013889
weaned0.013889
jiangxi province0.013889
water0.013889
bilbao0.013889
estuary0.013889
estuary water0.013889
fresh water0.013889
salinity <5 ppt0.013889
kingdom of denmark0.013889
Exp. ID User ID Description Date Region Flag Sequences
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces child obsolete_juvenile stage nigeria 2018-08-30v4No1 / 12
365amnonhighfreq homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 16
532amnonhighfreq control, adult, czech republic, feces, homo sapiens2019-07-21v1No1 / 16
290amnon high in rural community small village compared to city in homo sapiens feces china adult 2018-02-01v4No1 / 21
390amnonlower in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in non c. diff diarrhea compared to clostridium difficile intestinal infectious disease in homo sapiens feces australia hospital diarrhea )2018-11-04v4No1 / 23
529amnonhighfreq control, adult, taipei city, taiwan, feces, homo sapiens2019-07-18v3No1 / 27
74amnonHigher in plant diet compared to animal product diet ( high in diet plant diet compared to animal product diet in homo sapiens feces united states of america )2017-02-27v4No1 / 39
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in homo sapiens feces united states of america adult )2018-11-18v4No1 / 41
36amnoncommon homo sapiens, feces, sichuan province2016-12-06v4No1 / 44
482amnoncommon homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, age 1-5 years2019-02-12v4No1 / 47
292amnoncommon homo sapiens, china, adult, feces, crohn's disease2018-02-05v4No1 / 55
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 66
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
425amnoncommon homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 73
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
74amnoncommon united states of america, feces, homo sapiens2017-02-27v4No1 / 76
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v4No1 / 76
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 79
529amnoncommon control, adult, taipei city, taiwan, feces, homo sapiens2019-07-18v3No1 / 79
292amnoncommon homo sapiens, china, adult, feces, control2018-02-05v4No1 / 81
339amnoncommon homo sapiens, feces, india, adult2018-05-24v4No1 / 81
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
247amnoncommon homo sapiens, italy, feces, obesity, high bmi2017-11-21v4No1 / 85
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
428amnoncommon homo sapiens, adult, feces, china, nanchang city prefecture, control2018-12-09v4No1 / 93
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 97
532amnoncommon control, adult, czech republic, feces, homo sapiens2019-07-21v1No1 / 98
438amnoncommon homo sapiens, feces, china, age 19-242018-12-30v4No1 / 101
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in sus scrofa pig united kingdom caecum )2017-11-26v4No1 / 103
425amnon high in antananarivo madagascar compared to central african republic bangui in homo sapiens africa child duodenum 2018-12-08v4No1 / 103
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 8-122018-12-30v4No1 / 106
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 3-62018-12-30v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
438amnoncommon feces, homo sapiens, china, age 60-79, adult, jiangsu province2018-12-30v4No1 / 111
517amnoncommon chuquisaca department, rural community, bolivia, age 5-13 years, child, homo sapiens, feces2019-05-29v4No1 / 113
438amnoncommon feces, homo sapiens, china, jiangsu province, age 30-50, adult2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
294amnon high in control compared to irritable bowel syndrome in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 121
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
438amnoncommon feces, homo sapiens, china, age >94, jiangsu province, adult2018-12-30v4No1 / 121
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to crohn's disease obsolete_juvenile stage child in glasgow feces homo sapiens )2017-02-26v4No1 / 125
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
526amnon high in cholelithiasis compared to control in kingdom of spain adult bile gallbladder homo sapiens 2019-07-14v3No1 / 131
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, china, jiangsu province, age 13-142018-12-30v4No1 / 134
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in homo sapiens feces united states of america )2017-12-04v4No1 / 140
62amnon high in egypt compared to united states of america in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 144
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, schistosomiasis, urinary schistosomiasis2019-03-18v4No1 / 146
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common cholelithiasis, kingdom of spain, adult, bile, gallbladder, homo sapiens)2019-07-14v3No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens china adult feces 2018-02-05v4No1 / 161
290amnoncommon homo sapiens, feces, china, adult, city2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common low anterior resection, adult, taipei city, taiwan, feces, homo sapiens)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 188
312amnoncommon feces, homo sapiens, french republic, adult, spondylitis, spondyloarthritis2018-04-09v4No1 / 197
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, china, adult, small village, rural community2018-02-01v4No1 / 218
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, nephrolithiasis)2018-01-27v4No1 / 239
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces india infant )2016-12-19v4No1 / 253
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, control)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces china nanchang city prefecture 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common corn and soybean diet, age 4-7 weeks, weaned, jiangxi province, farm, china, feces, sus scrofa, pig)2019-07-02v3No1 / 288
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
510amnoncommon kingdom of spain, water, bilbao, estuary, estuary water, fresh water, salinity <5 ppt2019-03-20v4No1 / 317
299amnon high in cancer mouth neoplasm compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
532amnon high in control compared to short bowel syndrome in adult czech republic feces homo sapiens 2019-07-21v1No1 / 334
175amnonhigher in winter compared to summer in heavy metal contaminated soils in china ( high in winter compared to summer in china soil heavy metal )2017-07-29v4No1 / 337
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
256amnoncommon sus scrofa, pig, united kingdom, duodenum, jejunum, ileum2017-11-26v4No1 / 380
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
256amnoncommon sus scrofa, pig, united kingdom, caecum, right colon, left colon2017-11-26v4No1 / 490
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water bilbao estuary estuary water 2019-03-20v4No1 / 592
517amnon high in feces compared to forearm arm skin in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 606
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in corn and soybean diet age 4-7 weeks weaned compared to age 2-4 weeks suckling preweaned in jiangxi province farm china feces sus scrofa pig )2019-07-02v3No1 / 681
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 752
517amnon high in forearm arm skin compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org