Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTTTTGCAAGTCTGAAGTGAAAGCCCGGGGCTTAACCCCGGGACTGCTTTGGAAACTGTAGGACTAGAGTGCAGGAGAGGTAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.607184
feces0.570306
adult0.485363
child0.187526
control0.172122
united states of america0.168542
china0.151376
rural community0.135660
female0.115559
kingdom of spain0.105016
city0.088350
pig0.080699
sus scrofa0.080699
obsolete_juvenile stage0.076789
obesity0.072426
taiwan0.052174
infant0.048780
monkey0.047619
caecum0.045758
small village0.044944
germany0.044776
tanzania0.044280
macaca mulatta0.043321
pregnancy0.042403
south korea0.042105
jiangsu province0.039088
male0.038186
msm0.037523
homosexual0.037523
age 5-13 years0.037523
LOWER IN infant0.037313
pemba island0.037175
india0.037175
LOWER IN crohn's disease0.037037
high bmi0.035629
israel0.034803
united kingdom0.034602
sweden0.034305
research facility0.033729
italy0.032895
canada0.032103
gay0.030265
republic of china0.030189
estonia0.030189
colombia0.030189
age 30-500.030189
msw0.030113
heterosexual0.030113
nigeria0.029963
himalayas0.029963
ascending colon0.029963
province of alberta0.029963
chuquisaca department0.029963
age 10-15 years0.029963
rhesus macaque0.029963
rectal swab0.029740
nepal0.029520
czech republic0.029304
duodenum0.029233
africa0.029091
bolivia0.029091
age 6 weeks0.028674
age0.028571
zoological garden0.027682
state of california0.027491
male organism0.027491
captive0.024465
hunter gatherer0.022814
nanchang city prefecture0.022770
taoyuan city0.022642
age 60-65 years0.022642
age 1-3 years0.022642
taipei city0.022642
peru0.022642
obese body mass index status0.022642
age 60-790.022642
LOWER IN age < 1 year0.022642
chimpanzee0.022642
right colon0.022514
jejunum0.022514
rheumatoid arthritis0.022388
cameroon0.022388
slovak republic0.022388
egypt0.022388
formula fed0.022388
hispanic or latin american0.022388
poland0.022388
LOWER IN united states of america0.022305
age 2 years0.022140
LOWER IN child0.022140
amsterdam0.022140
ethiopia0.022140
state of colorado0.022018
hiv infection0.021898
state of new york0.021898
kingdom of the netherlands0.021661
thailand0.021661
brazil0.020870
farm0.019262
overweight body mass index status0.015267
Fraction of dbbact annotations with this term covered by the query
TermScore
rural community0.900000
taiwan0.750000
small village0.750000
gay0.750000
hunter gatherer0.750000
republic of china0.666667
estonia0.666667
colombia0.666667
overweight body mass index status0.666667
athlete0.666667
age 19-240.666667
state of oklahoma0.666667
msm0.666667
homosexual0.666667
age 5-13 years0.666667
age 30-500.666667
metabolic syndrome0.666667
nanchang city prefecture0.666667
amerindian0.666667
venezuela0.666667
village0.666667
msw0.600000
heterosexual0.600000
obesity0.583333
LOWER IN infant0.555556
LOWER IN osteoarthritis0.500000
nigeria0.500000
LOWER IN graves' disease0.500000
taoyuan city0.500000
yaounde0.500000
LOWER IN active disease0.500000
azerbaijan0.500000
age 60-65 years0.500000
normal exercise0.500000
gestational age 8-12 weeks0.500000
chengdu city prefecture0.500000
municipality of reus0.500000
tanzania0.500000
pemba island0.500000
age 1-3 years0.500000
santa catarina state0.500000
zhengzhou city prefecture0.500000
LOWER IN clostridium difficile intestinal infectious disease0.500000
taipei city0.500000
LOWER IN pregnancy trimester 20.500000
LOWER IN pregnancy0.500000
non-pregnant0.500000
ismailia0.500000
plant diet0.500000
age 6-14 years0.500000
hangzhou city prefecture0.500000
LOWER IN endospore enriched fraction0.500000
LOWER IN lysis0.500000
india0.500000
bihar state0.500000
daycare0.500000
age 1-5 years0.500000
short beaked common dolphin0.500000
breast fed0.500000
iga igg negative fraction0.500000
peru0.500000
teenager0.500000
age 9-17 years0.500000
age 50-70 years0.500000
obese body mass index status0.500000
vegetarian diet0.500000
native american0.500000
arapaho0.500000
cheyenne0.500000
jordan0.500000
age 1-18 years0.500000
sri lanka0.500000
antananarivo0.500000
himalayas0.500000
tharu0.500000
agrarian0.500000
antiretroviral therapy0.500000
human immunodeficiency virus infectious disease0.500000
municipality of logrono0.500000
raute0.500000
common bottlenose dolphin0.500000
bangui0.500000
sesame allergy0.500000
age 4-10 years0.500000
quito0.500000
novosibirsk0.500000
denver0.500000
age 200.500000
raji0.500000
metabolic syndrome x0.500000
LOWER IN salmonella enterica subsp. enterica serovar typhimurium0.500000
ascending colon0.500000
province of alberta0.500000
caribbean latino0.500000
milk allergy0.500000
chepang0.500000
LOWER IN central african republic0.500000
LOWER IN bangui0.500000
third trimester0.500000
age 8-120.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.907336
homo sapiens0.853282
adult0.525097
united states of america0.200772
control0.169884
china0.162162
child0.123552
female0.077220
rural community0.073359
kingdom of spain0.061776
city0.050193
pig0.046332
sus scrofa0.046332
obsolete_juvenile stage0.042471
research facility0.042471
obesity0.038610
male0.030888
caecum0.030888
taiwan0.027027
germany0.027027
infant0.027027
monkey0.027027
south korea0.023166
pregnancy0.023166
tanzania0.023166
small village0.023166
jiangsu province0.023166
macaca mulatta0.023166
high bmi0.019305
pemba island0.019305
italy0.019305
india0.019305
sweden0.019305
israel0.019305
msm0.019305
homosexual0.019305
age 5-13 years0.019305
canada0.019305
united kingdom0.019305
LOWER IN crohn's disease0.019305
LOWER IN infant0.019305
nigeria0.015444
republic of china0.015444
czech republic0.015444
estonia0.015444
colombia0.015444
rectal swab0.015444
msw0.015444
heterosexual0.015444
africa0.015444
nepal0.015444
himalayas0.015444
gay0.015444
age 30-500.015444
state of california0.015444
ascending colon0.015444
age 6 weeks0.015444
male organism0.015444
province of alberta0.015444
duodenum0.015444
bolivia0.015444
chuquisaca department0.015444
age 10-15 years0.015444
age0.015444
rhesus macaque0.015444
captive0.015444
zoological garden0.015444
rheumatoid arthritis0.011583
taoyuan city0.011583
cameroon0.011583
age 60-65 years0.011583
slovak republic0.011583
age 1-3 years0.011583
brazil0.011583
taipei city0.011583
egypt0.011583
age 2 years0.011583
formula fed0.011583
peru0.011583
hiv infection0.011583
obese body mass index status0.011583
state of new york0.011583
hispanic or latin american0.011583
LOWER IN child0.011583
state of colorado0.011583
amsterdam0.011583
kingdom of the netherlands0.011583
nanchang city prefecture0.011583
right colon0.011583
poland0.011583
age 60-790.011583
hunter gatherer0.011583
thailand0.011583
LOWER IN united states of america0.011583
jejunum0.011583
farm0.011583
LOWER IN age < 1 year0.011583
chimpanzee0.011583
ethiopia0.011583
yaounde0.007722
Exp. ID User ID Description Date Region Flag Sequences
593amnon high in rheumatoid arthritis compared to osteoarthritis in homo sapiens feces adult south korea 2020-03-08v3No1 / 4
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces child obsolete_juvenile stage nigeria 2018-08-30v4No1 / 12
796amnon high in control compared to graves' disease in taoyuan city republic of china taiwan adult feces homo sapiens 2021-06-10v3No1 / 12
594amnondominant adult, cameroon, feces, homo sapiens, city, yaounde2020-03-12v4No1 / 13
713amnon high in remission compared to active disease in crohn's disease feces homo sapiens 2028-05-21v3No1 / 13
365amnondominant homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 16
532amnondominant homo sapiens, feces, czech republic, adult, control2019-07-21v1No1 / 16
627amnondominant feces, pregnancy, adult, female, china2020-05-16v3No1 / 18
799amnondominant in obese participant fecal samples after 1 month ketogenic diet (dominant ketogenic diet, obesity, high bmi, adult, estonia, feces, homo sapiens)2021-06-13v3No1 / 18
833amnondominant homo sapiens, feces, age 60-65 years, slovak republic, adult, normal exercise2021-09-11v1No1 / 18
637amnondominant gestational age 8-12 weeks, chengdu city prefecture, china, adult, pregnancy, female, feces, homo sapiens2020-08-18v3No1 / 19
732amnondominant municipality of reus, kingdom of spain, adult, feces, homo sapiens2021-01-11v3No1 / 19
736amnondominant tanzania, pemba island, adult, female, feces, homo sapiens2021-01-25v3No1 / 19
736amnondominant age 1-3 years, child, tanzania, pemba island, feces, homo sapiens2021-01-25v3No1 / 19
757amnondominant feces, adult, santa catarina state, brazil, homo sapiens2021-03-28v3No1 / 19
796amnondominant control, taoyuan city, republic of china, taiwan, adult, feces, homo sapiens2021-06-10v3No1 / 19
290amnon high in rural community small village compared to city in homo sapiens feces adult china 2018-02-01v4No1 / 21
593amnondominant homo sapiens, feces, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 21
720amnondominant control, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 21
390amnonlower in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in non c. diff diarrhea compared to clostridium difficile intestinal infectious disease in homo sapiens feces australia hospital diarrhea )2018-11-04v4No1 / 23
666amnondominant homo sapiens, italy, feces2020-09-25v3No1 / 23
529amnondominant homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v3No1 / 27
724amnon high in non-pregnant compared to pregnancy trimester 2 pregnancy in age 25-45 years ismailia egypt adult female vagina homo sapiens 2021-01-03v3No1 / 29
74amnonHigher in plant diet compared to animal product diet ( high in diet plant diet compared to animal product diet in homo sapiens feces united states of america )2017-02-27v4No1 / 39
825amnoncommon control, age 6-14 years, hangzhou city prefecture, china, child, homo sapiens, feces2021-08-12v3No1 / 40
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in homo sapiens feces united states of america adult )2018-11-18v4No1 / 41
36amnoncommon homo sapiens, feces, sichuan province2016-12-06v4No1 / 44
570amnoncommon homo sapiens, feces, india, bihar state2019-12-16v3No1 / 46
597amnoncommon homo sapiens, feces, adult, zhejiang province, china, control2020-03-23v3No1 / 46
797amnoncommon age 2 years, child, formula fed, germany, homo sapiens, feces2021-06-13v3No1 / 46
482amnoncommon homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, age 1-5 years2019-02-12v4No1 / 47
666amnoncommon short beaked common dolphin, delphinus delphis, rectal swab, feces, italy2020-09-25v3No1 / 48
736amnoncommon age 1-3 years, child, tanzania, pemba island, feces, homo sapiens2021-01-25v3No1 / 49
797amnoncommon breast fed, age 2 years, child, germany, homo sapiens, feces2021-06-13v3No1 / 50
834amnoncommon adult, japan, feces, homo sapiens2021-09-11v1No1 / 50
796amnoncommon control, taoyuan city, republic of china, taiwan, adult, feces, homo sapiens2021-06-10v3No1 / 51
830amnon high in iga igg negative fraction iga negative fraction compared to iga positive fraction in peru teenager age 9-17 years feces homo sapiens 2021-09-10v4No1 / 52
694amnoncommon china, shanghai district, obesity, adult, female, feces, homo sapiens2028-03-17v3No1 / 52
578amnoncommon homo sapiens, feces, adult, male, kingdom of spain, sweden, msw, heterosexual, hiv infection2020-01-14v3No1 / 53
292amnoncommon homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 55
814amnoncommon high bmi, age 50-70 years, adult, obese body mass index status, overweight body mass index status, obesity, female, germany, homo sapiens, feces2021-06-30v4No1 / 55
720amnoncommon control, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 56
666amnoncommon homo sapiens, italy, feces2020-09-25v3No1 / 58
734amnoncommon vegetarian diet, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 60
831amnoncommon control, homo sapiens, feces, adult, israel2021-09-11v3No1 / 60
627amnoncommon feces, pregnancy, adult, female, china2020-05-16v3No1 / 61
637amnoncommon gestational age 8-12 weeks, chengdu city prefecture, china, adult, pregnancy, female, feces, homo sapiens2020-08-18v3No1 / 61
593amnoncommon homo sapiens, feces, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 62
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
575amnoncommon in professional martial arts athletes (common homo sapiens, feces, athlete, high physical activity, adult, china, age 19-24)2020-01-05v3No1 / 63
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 66
650amnoncommon asian, state of new york, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 66
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
757amnoncommon feces, adult, santa catarina state, brazil, homo sapiens2021-03-28v3No1 / 67
593amnoncommon homo sapiens, feces, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
644amnoncommon adult, united states of america, hispanic or latin american, feces, homo sapiens2020-08-31v4No1 / 71
663amnoncommon obese body mass index status, obesity, switzerland, adult, feces, homo sapiens2020-09-22v4No1 / 71
656amnoncommon age 1-18 years, sri lanka, feces, homo sapiens2020-09-13v3No1 / 71
425amnoncommon homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 73
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
578amnoncommon homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, hiv infection2020-01-14v3No1 / 74
794amnoncommon antiretroviral therapy, human immunodeficiency virus infectious disease, hiv infection, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v4No1 / 75
74amnoncommon united states of america, feces, homo sapiens2017-02-27v4No1 / 76
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v4No1 / 76
666amnoncommon common bottlenose dolphin, rectal swab, tursiops truncatus, italy, feces2020-09-25v3No1 / 76
799amnoncommon in obese participant fecal samples before ketogenic diet (common obesity, high bmi, adult, estonia, feces, homo sapiens)2021-06-13v3No1 / 77
556amnoncommon homo sapiens, feces, united states of america, adult2019-09-14v1No1 / 77
630amnoncommon madrid, kingdom of spain, feces, adult, homo sapiens2020-06-01v3No1 / 78
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 79
529amnoncommon homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v3No1 / 79
732amnoncommon municipality of reus, kingdom of spain, adult, feces, homo sapiens2021-01-11v3No1 / 79
736amnon high in adult female compared to age 1-3 years child in tanzania pemba island feces homo sapiens 2021-01-25v3No1 / 79
695amnoncommon sesame allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v4No1 / 80
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v4No1 / 81
339amnoncommon homo sapiens, feces, adult, india2018-05-24v4No1 / 81
643amnoncommon adult, south korea, feces, homo sapiens2020-08-30v4No1 / 81
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
562amnoncommon feces, quito, ecuador, child, age 5-13 years2019-11-05v4No1 / 82
707amnoncommon guangzhou city prefecture, age 30-50, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 82
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 85
601amnoncommon homo sapiens, feces, china, adult, type 2 diabetes mellitus2020-03-30v4No1 / 85
663amnoncommon low bmi, switzerland, adult, feces, homo sapiens2020-09-22v4No1 / 85
680amnoncommon obesity, adult, novosibirsk, russia, feces, homo sapiens2028-03-04v3No1 / 85
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
673amnon high in control compared to salmonellosis salmonella enterica subsp. enterica serovar typhimurium in caecum ascending colon research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
629amnoncommon female, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 89
803amnoncommon control, commonwealth of massachusetts, age 50-80 years, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v4No1 / 89
578amnoncommon homo sapiens, feces, adult, male, kingdom of spain, sweden, control, msw, heterosexual2020-01-14v3No1 / 92
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
601amnoncommon homo sapiens, feces, china, adult, control2020-03-30v4No1 / 93
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common ketogenic diet, high bmi, estonia, adult, obesity, homo sapiens, feces)2021-06-13v3No1 / 93
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
695amnoncommon milk allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
736amnoncommon tanzania, pemba island, adult, female, feces, homo sapiens2021-01-25v3No1 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 97
629amnoncommon msw, heterosexual, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 97
663amnoncommon poland, low bmi, adult, feces, homo sapiens2020-09-22v4No1 / 98
532amnoncommon homo sapiens, feces, czech republic, adult, control2019-07-21v1No1 / 98
438amnoncommon homo sapiens, feces, age 19-24, china2018-12-30v4No1 / 101
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in sus scrofa pig caecum united kingdom )2017-11-26v4No1 / 103
425amnon high in antananarivo madagascar compared to central african republic bangui in homo sapiens africa child duodenum 2018-12-08v4No1 / 103
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v4No1 / 103
673amnon high in control compared to salmonellosis salmonella enterica subsp. enterica serovar typhimurium in caecum ascending colon research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 104
693amnoncommon graz city district, austria, adult, feces, homo sapiens, female2028-03-16v1No1 / 104
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
683amnoncommon state of california, united states of america, adult, feces, homo sapiens2028-03-04v4No1 / 105
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
797amnon high in age 1 year compared to age 7 months in formula fed germany infant homo sapiens feces 2021-06-13v3No1 / 106
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
644amnonhigher in individuals born in latin america compared to indivuals born in usa ( high in non usa born compared to usa born in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
802amnoncommon feces, cornell university, state of new york, united states of america, adult, homo sapiens2021-06-16v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
438amnoncommon feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 111
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v4No1 / 112
663amnoncommon poland, obese body mass index status, obesity, adult, feces, homo sapiens2020-09-22v4No1 / 112
517amnoncommon feces, homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department2019-05-29v4No1 / 113
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
294amnon high in control compared to irritable bowel syndrome in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 121
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
660amnoncommon shuar population, village, rural community, ecuador, feces, homo sapiens2020-09-20v4No1 / 123
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 125
607amnoncommon germany, homo sapiens, feces, parkinson's disease2020-04-19v4No1 / 125
779amnon high in control compared to crohn's disease in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v4No1 / 127
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
607amnoncommon germany, homo sapiens, feces, control2020-04-19v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
721amnoncommon obesity, overweight body mass index status, adult, scotland, gaz:00052100, feces, homo sapiens2028-05-23v4No1 / 131
526amnon high in cholelithiasis compared to control in homo sapiens gallbladder bile adult kingdom of spain 2019-07-14v3No1 / 131
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
578amnoncommon homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, control2020-01-14v3No1 / 132
794amnoncommon control, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v4No1 / 133
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
594amnoncommon adult, cameroon, feces, homo sapiens, ngoantet, rural community2020-03-12v4No1 / 136
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
797amnon high in child age 2 years compared to infant age 1 year in formula fed germany homo sapiens feces 2021-06-13v3No1 / 139
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in homo sapiens feces united states of america )2017-12-04v4No1 / 140
629amnoncommon amsterdam, kingdom of the netherlands, adult, homosexual, msm, feces, homo sapiens2020-05-31v4No1 / 141
62amnon high in egypt compared to united states of america in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 144
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 146
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 147
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
780amnon high in jejunum duodenum small intestine compared to caecum in jinzhou city prefecture china research facility chicken gallus gallus 2021-04-28v3No1 / 153
594amnoncommon adult, cameroon, feces, homo sapiens, city, yaounde2020-03-12v4No1 / 154
673amnoncommon caecum, control, ascending colon, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 154
833amnoncommon normal exercise, adult, slovak republic, age 60-65 years, feces, homo sapiens2021-09-11v1No1 / 154
833amnoncommon homo sapiens, feces, age 60-65 years, slovak republic, adult, athlete, high exercise2021-09-11v1No1 / 154
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens adult feces china 2018-02-05v4No1 / 161
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 187
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
620amnoncommon village, rural community, homo sapiens, nouabale-ndoki national park, republic of congo, feces2020-05-06v4No1 / 197
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
669amnon high in age 1 year compared to age 2 months in sweden infant feces homo sapiens 2020-09-26v4No1 / 212
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, china, homo sapiens, adult2019-11-24v4No1 / 221
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
673amnon high in caecum ascending colon compared to ileum in control research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 228
780amnoncommon jinzhou city prefecture, china, research facility, chicken, gallus gallus, jejunum, duodenum, small intestine2021-04-28v3No1 / 232
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
671amnoncommon age 8 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 252
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
688amnoncommon nanchang city prefecture, feces, age 140 days, research facility, duroc pig, china, pig, sus scrofa2028-03-09v4No1 / 278
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to metronidazole neomycin vancomycin antibiotic in state of california united states of america adult feces homo sapiens )2028-03-04v4No1 / 301
770amnon high in age 10-15 years adult organism compared to age < 1 year infant in rectal swab feces indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v4No1 / 304
723amnon high in age 2-4 years compared to age 0-6 months infant in homo sapiens indonesia municipality of yogyakarta feces child 2021-01-02v3No1 / 305
510amnoncommon kingdom of spain, water, estuary, estuary water, fresh water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
650amnon high in asian compared to caucasian european in feces adult homo sapiens united states of america state of new york 2020-09-12v4No1 / 317
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
532amnon high in control compared to short bowel syndrome in homo sapiens feces czech republic adult 2019-07-21v1No1 / 334
175amnonhigher in winter compared to summer in heavy metal contaminated soils in china ( high in winter compared to summer in soil heavy metal china )2017-07-29v4No1 / 337
671amnoncommon female, adult, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 356
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
770amnoncommon age 10-15 years, adult organism, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 396
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
620amnoncommon saint louis zoo, saint louis, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 433
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
620amnon high in chimpanzee pan troglodytes troglodytes compared to gorilla gorilla in nouabale-ndoki national park republic of congo wild feces 2020-05-06v4No1 / 478
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
620amnoncommon saint louis zoo, saint louis, united states of america, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 530
603amnoncommon in baijiu fermentation pit mud in first 2 batches (common mud, fermentation pit mud, baijiu, china, hefei city prefecture, days 0-90)2020-04-05v3No1 / 542
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
671amnon high in age 3 months compared to age 1 month in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 714
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
671amnon high in age 8 months compared to age 6 months age 3 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 955
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
620amnon high in united states of america zoological garden compared to nouabale-ndoki national park wild republic of congo in gorilla gorilla gorilla feces 2020-05-06v4No1 / 1019

Problems / suggestions? Please email info AT dbbact DOT org