Search result for sequence:
TACGTAGGGGGCAAGCGTTGTCCGGAATAATTGGGCGTAAAGGGCGCGTAGGCGGCTCGGTAAGTCTGGAGTGAAAGTCCTGCTTTTAAGGTGGGAATTGCTTTGGATACTGTCGGGCTTGAGTGCAGGAGAGGTTAGTGGAATTCCCAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.520808
feces0.440766
adult0.309036
child0.177388
rural community0.155039
united states of america0.138135
control0.136693
china0.108761
city0.099792
LOWER IN crohn's disease0.096774
monkey0.091603
obsolete_juvenile stage0.088889
jiangsu province0.086331
infant0.084507
colombia0.081081
zoological garden0.081081
small village0.066482
india0.066116
rectum0.062992
age0.059701
female0.054422
hunter gatherer0.050420
cron diet0.049587
toronto0.049587
low bmi0.049587
age 50-60 years0.049587
nanning city prefecture0.049587
age 130.049587
chuquisaca department0.049587
age 5-13 years0.049587
LOWER IN high bmi0.049180
LOWER IN ulcerative colitis0.049180
caloric restriction diet0.048387
finland0.047809
kingdom of norway0.047244
juvenile organism0.047244
ethiopia0.047244
bolivia0.047244
kingdom of spain0.046154
united kingdom0.042254
colon0.042254
metabolic syndrome0.033898
amerindian0.033898
venezuela0.033898
thailand0.033613
himalayas0.033613
atherosclerosis0.033613
lima0.033613
shantytown0.033613
age 60-790.033613
age 30-500.033613
age >940.033613
glasgow0.033613
oslo0.033613
age 30-400.033613
kebbi state0.033613
age 10-15 years0.033613
LOWER IN age < 1 year0.033613
tunapuco0.033613
papio anubis0.033613
bilbao0.033613
estuary0.033613
estuary water0.033613
salinity <5 ppt0.033613
mongolian sheep0.033613
africa0.033613
wastewater treatment plant0.033613
chlorocebus aethiops0.033613
LOWER IN mouth mucosa0.033613
LOWER IN hiv infection0.033333
body mass index0.033333
LOWER IN infant0.033333
nepal0.033058
LOWER IN child0.033058
nigeria0.033058
age < 3 years0.033058
peru0.033058
kingdom of denmark0.033058
water0.032877
south korea0.032520
LOWER IN finland0.032520
autumn0.032520
state of tennessee0.032000
ovis aries0.031496
LOWER IN mouth0.031008
ileum0.030534
state of california0.029851
caecum0.029412
germany0.029197
diet0.028986
brazil0.027972
canada0.027972
fresh water0.026846
LOWER IN schizophrenia0.017094
high filber0.017094
LOWER IN low fiber0.017094
new york county0.017094
LOWER IN chronic fatigue syndrome0.017094
plant diet0.017094
raute0.017094
Fraction of dbbact annotations with this term covered by the query
TermScore
hunter gatherer0.750000
small village0.750000
rural community0.714286
metabolic syndrome0.666667
LOWER IN crohn's disease0.666667
amerindian0.666667
venezuela0.666667
india0.666667
colombia0.600000
zoological garden0.600000
LOWER IN schizophrenia0.500000
cron diet0.500000
high filber0.500000
LOWER IN low fiber0.500000
toronto0.500000
new york county0.500000
LOWER IN chronic fatigue syndrome0.500000
plant diet0.500000
thailand0.500000
low bmi0.500000
himalayas0.500000
raute0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
LOWER IN nephrolithiasis0.500000
raji0.500000
metabolic syndrome x0.500000
azerbaijan0.500000
atherosclerosis0.500000
age 19-240.500000
age 8-120.500000
commonwealth of pennsylvania0.500000
LOWER IN inflammatory bowel disease0.500000
age 3-60.500000
lima0.500000
shantytown0.500000
age 60-790.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
age 30-500.500000
age >940.500000
glasgow0.500000
oslo0.500000
age 30-400.500000
myanmar0.500000
karen0.500000
age 13-140.500000
age 130.500000
LOWER IN india0.500000
physical activity0.500000
LOWER IN little physical activity0.500000
kebbi state0.500000
age 10-15 years0.500000
schistosomiasis0.500000
urinary schistosomiasis0.500000
el salvador0.500000
estonia0.500000
hadza0.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
LOWER IN el salado0.500000
nephrolithiasis0.500000
gorilla0.500000
age 1-20.500000
LOWER IN age 0-10.500000
tunapuco0.500000
nanchang city prefecture0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
papio anubis0.500000
olive baboon0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
bilbao0.500000
estuary0.500000
estuary water0.500000
salinity <5 ppt0.500000
mongolian sheep0.500000
cecum0.500000
sea urchin0.500000
artificial seawater0.500000
zambia0.500000
baboon0.500000
papio0.500000
LOWER IN papio kindae0.500000
LOWER IN papio ursinus0.500000
macaque0.500000
pan troglodytes0.500000
chimpanzee0.500000
africa0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
wastewater treatment plant0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
chlorocebus aethiops0.500000
grivet monkey0.500000
vervet monkey0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.895652
homo sapiens0.860870
adult0.321739
united states of america0.226087
china0.156522
control0.147826
child0.113043
rural community0.086957
city0.069565
obsolete_juvenile stage0.052174
jiangsu province0.052174
LOWER IN crohn's disease0.052174
infant0.052174
monkey0.052174
colombia0.043478
zoological garden0.043478
female0.034783
small village0.034783
india0.034783
age0.034783
rectum0.034783
cron diet0.026087
caloric restriction diet0.026087
united kingdom0.026087
toronto0.026087
low bmi0.026087
LOWER IN high bmi0.026087
age 50-60 years0.026087
nanning city prefecture0.026087
LOWER IN ulcerative colitis0.026087
hunter gatherer0.026087
kingdom of norway0.026087
age 130.026087
juvenile organism0.026087
finland0.026087
kingdom of spain0.026087
water0.026087
colon0.026087
ethiopia0.026087
chuquisaca department0.026087
bolivia0.026087
age 5-13 years0.026087
brazil0.017391
germany0.017391
diet0.017391
south korea0.017391
LOWER IN hiv infection0.017391
thailand0.017391
himalayas0.017391
nepal0.017391
state of california0.017391
metabolic syndrome0.017391
canada0.017391
atherosclerosis0.017391
LOWER IN child0.017391
lima0.017391
shantytown0.017391
age 60-790.017391
age 30-500.017391
amerindian0.017391
venezuela0.017391
age >940.017391
glasgow0.017391
oslo0.017391
age 30-400.017391
body mass index0.017391
LOWER IN infant0.017391
nigeria0.017391
kebbi state0.017391
age 10-15 years0.017391
age < 3 years0.017391
LOWER IN finland0.017391
LOWER IN age < 1 year0.017391
peru0.017391
tunapuco0.017391
papio anubis0.017391
bilbao0.017391
estuary0.017391
estuary water0.017391
fresh water0.017391
salinity <5 ppt0.017391
kingdom of denmark0.017391
mongolian sheep0.017391
ovis aries0.017391
ileum0.017391
autumn0.017391
state of tennessee0.017391
africa0.017391
wastewater treatment plant0.017391
chlorocebus aethiops0.017391
caecum0.017391
LOWER IN mouth mucosa0.017391
LOWER IN mouth0.017391
LOWER IN schizophrenia0.008696
plant fiber cell0.008696
high filber0.008696
LOWER IN low fiber0.008696
new york county0.008696
LOWER IN chronic fatigue syndrome0.008696
plant diet0.008696
Exp. ID User ID Description Date Region Flag Sequences
502amnon high in control compared to schizophrenia in homo sapiens feces adult united states of america 2019-03-12v4No1 / 14
293amnonhighfreq homo sapiens, feces, adult, united states of america, cron diet, caloric restriction diet2018-02-07v4No1 / 18
404amnonhighfreq homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 19
122amnonhighfreq homo sapiens, feces, united kingdom2017-04-13v4No1 / 21
120amnonhighfreq homo sapiens, feces, brazil2017-04-12v4No1 / 22
404amnonpositively correlated with fiber intake ( high in plant fiber cell high filber compared to low fiber in homo sapiens feces adult colombia city )2018-11-20v4No1 / 22
10amnonhighfreq homo sapiens, feces, toronto2016-10-27v4No1 / 23
303amnonhighfreq homo sapiens, feces, germany, adult2018-03-12v4No1 / 23
12amnon high in control compared to chronic fatigue syndrome in homo sapiens feces new york county 2016-11-02v4No1 / 35
74amnonHigher in plant diet compared to animal product diet ( high in diet plant diet compared to animal product diet in homo sapiens feces united states of america )2017-02-27v4No1 / 39
131amnon high in female compared to male in homo sapiens feces south korea 2017-04-16v4No1 / 55
51amnon high in control compared to hiv infection in homo sapiens feces united states of america 2017-01-19v4No1 / 69
22amnon high in control compared to hiv infection in united states of america feces homo sapiens 2016-11-28v4No1 / 70
400amnonnegatively correlated with bmi ( high in low bmi compared to high bmi in homo sapiens feces thailand adult )2018-11-18v4No1 / 70
74amnoncommon united states of america, feces, homo sapiens2017-02-27v4No1 / 76
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v4No1 / 76
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in homo sapiens feces adult age 50-60 years china nanning city prefecture )2018-01-27v4No1 / 83
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
455amnoncommon homo sapiens, adult, canada, atherosclerosis, saliva2019-01-10v4No1 / 100
438amnoncommon homo sapiens, feces, china, age 19-242018-12-30v4No1 / 101
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 8-122018-12-30v4No1 / 106
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 3-62018-12-30v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
438amnoncommon feces, homo sapiens, china, age 60-79, adult, jiangsu province2018-12-30v4No1 / 111
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, china, jiangsu province, age 30-50, adult2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
438amnoncommon feces, homo sapiens, china, age >94, jiangsu province, adult2018-12-30v4No1 / 121
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 125
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to crohn's disease obsolete_juvenile stage child in glasgow feces homo sapiens )2017-02-26v4No1 / 125
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, china, jiangsu province, age 13-142018-12-30v4No1 / 134
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 138
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in homo sapiens feces united states of america )2017-12-04v4No1 / 140
63amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens united states of america feces )2017-04-12v4No1 / 141
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, schistosomiasis, urinary schistosomiasis2019-03-18v4No1 / 146
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens china adult feces 2018-02-05v4No1 / 161
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, china, adult, small village, rural community2018-02-01v4No1 / 218
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 237
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, nephrolithiasis)2018-01-27v4No1 / 239
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces india infant )2016-12-19v4No1 / 253
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, control)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces china nanchang city prefecture 2018-12-09v4No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
510amnoncommon kingdom of spain, water, bilbao, estuary, estuary water, fresh water, salinity <5 ppt2019-03-20v4No1 / 317
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
111amnoncommon mongolian sheep, china, ovis aries, rectum, ileum, cecum, colon2017-04-09v4No1 / 330
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 345
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, china, water, autumn)2017-07-12v4No1 / 376
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
111amnon high in rectum caecum ileum colon compared to rumen ruminant reticulum omasum in mongolian sheep china ovis aries 2017-04-09v4No1 / 464
160amnoncommon in wastewater treatment plant effluent in autumn in china (common china, autumn, wastewater treatment plant, effluent)2017-07-12v4No1 / 469
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
352amnon high in small intestine duodenum compared to feces in homo sapiens india new delhi 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water bilbao estuary estuary water 2019-03-20v4No1 / 592
517amnon high in feces compared to forearm arm skin in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
517amnon high in feces compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 752
517amnon high in forearm arm skin compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org