Search result for sequence:
TACGTAGGGGGCAAGCGTTGTCCGGAATCATTGGGCGTAAAGAGCGTGTAGGCGGCTCGGTAAGTCCGCTCTGAAAGCCCGGGGCTCAACCCCGGGAGGCGGGCGGATACTGTCGGGCTAGAGTCCGGAAGAGGCGAGTGGAATTCCTGG
common ontology terms
term enrichment score
TermScore
soil0.394161
rhizosphere0.259696
minas gerais state0.181818
campos rupestres0.181818
topsoil0.177778
brazil0.147783
depth (soil) 0-20cm0.145577
citrus0.137931
wheat0.137931
cultivated environment0.136364
zhejiang province0.133333
depth (soil) 0-10cm0.131148
china0.130447
bulk soil0.119522
forest ecosystem0.114943
triticum aestivum0.114286
coarse-loamy soil0.100000
mature barley plants0.100000
days 1800.100000
quzhou county0.100000
ph 4-50.095694
paddy field soil0.095238
depth (soil) 0-5cm0.095238
hordeum vulgare0.095238
root0.091324
depth (soil) 15cm0.090909
woodland area0.085106
farm0.084567
ph 60.083333
park0.078431
non-fertilized soil0.078431
soybean0.078431
north china plain0.076923
red soil0.076923
yellow brown soil0.076923
vellozia epidendroides0.076923
barbacenia macrantha0.076923
day 820.076923
ph 50.075472
cambisol0.074074
sugarcane0.074074
saccharum0.074074
glycine max0.072727
orchard0.071429
nanjing city prefecture0.071429
biochar0.071429
guangzhou city prefecture0.068966
state of new york0.064516
hunan province0.064516
zea mays0.058824
agricultural feature0.052632
arachis hypogaea0.052632
peanut0.052632
moist tropical forest0.052632
copper0.052632
fragaria x ananassa0.052632
strawberry0.052632
mesocosm0.052632
restored prairie0.052632
kellogg biological station0.052632
mesic type hapludalf0.052632
kalamazoo loam0.052632
acute oak decline0.052632
oak0.052632
alabama0.052632
upland soil0.052632
ultisol0.052632
LOWER IN fertilized soil0.051948
depth (soil) 10-25cm0.051282
ph 6.70.051282
quercus0.051282
depth (soil) 25-50cm0.051282
auburn0.051282
ph<50.050000
greenhouse soil0.050000
depth (soil) 0-30 cm0.050000
plant disease0.050000
age 1 year0.048780
state of florida0.047619
winter0.046512
LOWER IN root0.045977
state of georgia0.045455
state of michigan0.043478
agricultural field0.041667
ph 5-60.037736
leaf0.035088
LOWER IN rhizosphere0.033613
united kingdom0.033333
united states of america0.027491
banana0.027397
musa acuminata0.027397
anxi county0.027397
cinnamomum camphora0.027397
vero beach, fl0.027027
quincy, fl0.027027
ft. pierce, fl0.027027
central park0.027027
ph 6-6.50.027027
myrtillocactus geometrizans0.027027
opuntia robusta0.027027
Fraction of dbbact annotations with this term covered by the query
TermScore
banana1.000000
musa acuminata1.000000
anxi county1.000000
cinnamomum camphora1.000000
park0.666667
non-fertilized soil0.666667
soybean0.666667
vero beach, fl0.500000
quincy, fl0.500000
ft. pierce, fl0.500000
central park0.500000
ph 6-6.50.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
root zone soil0.500000
kakadu national park0.500000
uranium0.500000
high uranium0.500000
bon portage island0.500000
burrow0.500000
LOWER IN seabird0.500000
LOWER IN oceanodroma leucorhoa0.500000
arachis hypogaea0.500000
peanut0.500000
north china plain0.500000
ph>7, ph<80.500000
ph>5, ph<60.500000
ph>4, ph<50.500000
ph 5.40.500000
moist tropical forest0.500000
ph<4.50.500000
LOWER IN ph&gt;4.50.500000
savanna0.500000
subtropical broadleaf forest biome0.500000
red soil0.500000
reunion island0.500000
copper0.500000
fragaria x ananassa0.500000
strawberry0.500000
yellow brown soil0.500000
LOWER IN age 10 years0.500000
LOWER IN continuous cropping0.500000
boreal wetland0.500000
seasonal frozen marsh0.500000
minas gerais state0.500000
campos rupestres0.500000
ph 3.50.500000
vellozia epidendroides0.500000
barbacenia macrantha0.500000
coarse-loamy soil0.500000
day 820.500000
stover ammendment soil0.500000
day 10.500000
LOWER IN day 120.500000
LOWER IN stover amended0.500000
mature barley plants0.500000
days 1800.500000
quzhou county0.500000
LOWER IN cherokia georgiana georgiana0.500000
LOWER IN millipede0.500000
mesocosm0.500000
restored prairie0.500000
kellogg biological station0.500000
mesic type hapludalf0.500000
kalamazoo loam0.500000
miscanthus0.500000
panicum virgatum0.500000
acute oak decline0.500000
oak0.500000
lower saxony0.500000
sandy soil0.500000
alabama0.500000
upland soil0.500000
ultisol0.500000
LOWER IN depth 50-70cm0.500000
nanning city prefecture0.500000
topsoil0.444444
bulk soil0.428571
citrus0.400000
wheat0.400000
ph 50.400000
LOWER IN fertilized soil0.400000
cultivated environment0.375000
arm0.333333
venezuela0.333333
amerindian0.333333
ph<60.333333
LOWER IN ph&gt;60.333333
cactus0.333333
semi-arid0.333333
ph 5.60.333333
LOWER IN soybean0.333333
hokkaido0.333333
forest ecosystem0.333333
cambisol0.333333
paddy field soil0.333333
ph 4-60.333333
pasture0.333333
northeast china0.333333
depth (soil) 0-5cm0.333333
Fraction of annotations for the query sequences containing the term
TermScore
soil0.750000
china0.472222
rhizosphere0.291667
depth (soil) 0-20cm0.180556
brazil0.138889
united states of america0.125000
topsoil0.111111
zhejiang province0.111111
minas gerais state0.111111
campos rupestres0.111111
citrus0.083333
triticum aestivum0.083333
wheat0.083333
depth (soil) 0-10cm0.083333
cultivated environment0.083333
root0.069444
bulk soil0.069444
forest ecosystem0.069444
farm0.069444
ph 4-50.069444
woodland area0.055556
paddy field soil0.055556
depth (soil) 0-5cm0.055556
state of new york0.055556
coarse-loamy soil0.055556
ph 60.055556
mature barley plants0.055556
days 1800.055556
hordeum vulgare0.055556
depth (soil) 15cm0.055556
quzhou county0.055556
state of florida0.041667
park0.041667
LOWER IN control0.041667
ph 50.041667
non-fertilized soil0.041667
glycine max0.041667
soybean0.041667
north china plain0.041667
agricultural feature0.041667
winter0.041667
hunan province0.041667
red soil0.041667
cambisol0.041667
zea mays0.041667
orchard0.041667
research facility0.041667
yellow brown soil0.041667
nanjing city prefecture0.041667
vellozia epidendroides0.041667
barbacenia macrantha0.041667
biochar0.041667
day 820.041667
sugarcane0.041667
saccharum0.041667
guangzhou city prefecture0.041667
LOWER IN root0.027778
arachis hypogaea0.027778
peanut0.027778
LOWER IN fertilized soil0.027778
LOWER IN rhizosphere0.027778
moist tropical forest0.027778
ph<50.027778
copper0.027778
fragaria x ananassa0.027778
strawberry0.027778
greenhouse soil0.027778
age 1 year0.027778
leaf0.027778
mesocosm0.027778
state of georgia0.027778
depth (soil) 10-25cm0.027778
restored prairie0.027778
state of michigan0.027778
kellogg biological station0.027778
mesic type hapludalf0.027778
kalamazoo loam0.027778
ph 6.70.027778
depth (soil) 0-30 cm0.027778
ph 5-60.027778
disease0.027778
plant disease0.027778
acute oak decline0.027778
united kingdom0.027778
oak0.027778
quercus0.027778
depth (soil) 25-50cm0.027778
alabama0.027778
auburn0.027778
upland soil0.027778
ultisol0.027778
agricultural field0.027778
homo sapiens0.013889
skin0.013889
arm0.013889
venezuela0.013889
amerindian0.013889
hunter gatherer0.013889
vero beach, fl0.013889
quincy, fl0.013889
Exp. ID User ID Description Date Region Flag Sequences
421amnonhigher in paddy field soil incubated with copper compared to controls ( high in copper compared to control in soil research facility zhejiang province paddy field soil china )2018-12-02v4No1 / 141
823sheryoHigher in 25-50cm depth compared to 50-70cm depth in ultisol soil in auburn, alabama ( high in depth (soil) 25-50cm compared to depth 50-70cm in alabama auburn upland soil ultisol agricultural field soil )2021-08-07v3No1 / 161
357amnoncommon in moist tropical forest topsoil around the world (common soil, topsoil, depth (soil) 0-10cm, moist tropical forest, woodland area, forest ecosystem)2018-08-18v4No1 / 171
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 190
698amnon high in ph 5-6 plant disease disease acute oak decline compared to ph 6-7 control in depth (soil) 0-30 cm depth (soil) 0-20cm park united kingdom oak quercus rhizosphere 2028-04-01v3No1 / 266
412amnonlower in pig manured soil with wheat-maize rotation compared to non-manured soil ( high in non-manured soil compared to manured soil in soil hunan province red soil cambisol zea mays triticum aestivum china )2018-11-26v4No1 / 437
989amnon high in soil compared to rhizosphere in china farm ph 4-5 anxi county cinnamomum camphora depth (soil) 0-20cm 2022-12-26v3No1 / 448
259amnonlower in fertilized soil (npk) compared to non-fertilized ( high in non-fertilized soil compared to fertilized soil in soil rhizosphere ph 5 arachis hypogaea peanut china )2017-12-02v4No1 / 483
616amnon high in ph 6.7 non-fertilized soil compared to ph 5.5-6 fertilized soil in depth (soil) 0-20cm sugarcane saccharum soil topsoil china guangzhou city prefecture 2020-04-27v3No1 / 504
942amnoncommon banana, rhizosphere, nanning city prefecture, china, musa acuminata2022-11-25v3No1 / 505
98amnoncommon citrus, rhizosphere, vero beach, fl, root, state of florida2017-04-01v4No1 / 544
548amnoncommon on leaf surface (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, leaf)2019-08-17v4No1 / 548
548amnoncommon in leaf surface of barbacenia macrantha (common minas gerais state, campos rupestres, brazil, barbacenia macrantha, leaf, leaf surface)2019-08-17v4No1 / 550
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
357amnoncommon soil, topsoil, depth (soil) 0-10cm, savanna, forest ecosystem, woodland area2018-08-19v4No1 / 614
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
823sheryoCommon at 25-50cm depth in ultisol soil in auburn, alabama (common depth (soil) 25-50cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 652
506amnoncommon soil, boreal wetland, seasonal frozen marsh, depth (soil) 0-10cm, peat soil, northeast china, china, wetland area2019-03-16v4No1 / 690
412amnon high in ph<5 compared to ph>5 in soil hunan province red soil cambisol zea mays triticum aestivum china 2018-11-26v4No1 / 706
415amnoncommon rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 721
421amnoncommon in paddy field soil incubated with copper (common soil, research facility, zhejiang province, paddy field soil, copper, china)2018-12-02v4No1 / 740
600sheryoDecreases after 12 days of stover ammendment in soil ( high in day 1 compared to day 12 in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 stover ammendment soil )2020-03-27v4No1 / 747
548amnoncommon in endopytic roots of Vellozia epidendroides (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, plant, root)2019-08-15v4No1 / 800
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph<5, china2018-11-26v4No1 / 823
421amnoncommon in paddy field soil incubated without copper (common research facility, soil, paddy field soil, zhejiang province, china)2018-12-02v4No1 / 824
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 830
356amnoncommon in deciduous broad leaved forest top soil in japan (common soil, depth (soil) 0-10cm, hokkaido, topsoil, ph 5.4, japan, forest ecosystem)2018-08-15v4No1 / 834
761sheryoCommon in bulk sandy soil maize field in Germany (common ph 5, lower saxony, sandy soil, germany, maize field, bulk soil)2021-04-06v3No1 / 835
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 5-6, disease, plant disease, acute oak decline, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 848
788amnoncommon soil, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 897
357amnon high in ph<4.5 compared to ph>4.5 in soil topsoil depth (soil) 0-10cm moist tropical forest woodland area forest ecosystem 2018-08-18v4No1 / 915
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
359amnoncommon soil, topsoil, depth (soil) 0-10cm, guangdong province, subtropical broadleaf forest biome, china, forest ecosystem, woodland area2018-08-19v4No1 / 935
444amnoncommon in uncultivated soil plot (common yellow brown soil, nanjing city prefecture, soil, china)2019-01-07v4No1 / 946
98amnoncommon citrus, rhizosphere, quincy, fl, root, state of florida2017-04-01v4No1 / 950
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, root zone soil2017-04-15v4No1 / 968
480amnoncommon soil, pasture, farm, new zealand2019-02-05v4No1 / 970
474amnoncommon soil, farm, glycine max, soybean, ph 4-6, brazil, cultivated environment2019-01-16v4No1 / 974
628sheryocommon in bulk soil with barley plants after 180 days in treatments amended with biochar (common biochar, bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1023
548amnoncommon minas gerais state, campos rupestres, brazil, rhizosphere, vellozia epidendroides2019-08-15v4No1 / 1040
154amnon high in uranium high uranium compared to control in soil australia kakadu national park sediment 2017-06-29v4No1 / 1080
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
628sheryocommon in bulk soil with barley plants after 180 days in treatments unamended with biochar (common bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1136
628sheryocommon in rhizosphere of barley roots after 180 days in treatments amended with biochar (common mature barley plants, days 180, rhizosphere, hordeum vulgare, biochar, ph 4-5, depth (soil) 15cm, china, quzhou county, zhejiang province, soil)2020-05-18v4No1 / 1192
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
628sheryocommon in rhizosphere of barley roots after 180 days in treatments unamended with biochar (common china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, rhizosphere, days 180, mature barley plants)2020-05-18v4No1 / 1209
444amnonlower in continuously cropped strawberry soil ( high in age 1 year compared to age 5 years age 10 years continuous cropping in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture china cultivated environment )2019-01-07v4No1 / 1221
821sheryoCommon in soil of restored prairie at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1241
616amnoncommon in topsoil of non-fertilized sugarcane field (common depth (soil) 0-20cm, ph 6.7, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture, non-fertilized soil)2020-04-27v3No1 / 1277
600sheryoCommon in biochar ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, biochar, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1326
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
98amnoncommon citrus, rhizosphere, ft. pierce, fl, root, state of florida2017-04-01v4No1 / 1340
600sheryoCommon in unammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1395
788amnon high in soil compared to cherokia georgiana georgiana millipede feces in mesocosm state of georgia united states of america 2021-05-31v4No1 / 1395
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v4No1 / 1439
271amnoncommon depth (soil) 0-20cm, rhizosphere, glycine max, soybean, china2018-01-09v4No1 / 1459
548amnoncommon in phosphorus impoverished soil (common soil, minas gerais state, campos rupestres, brazil, ph 3.5)2019-08-15v4No1 / 1483
145amnoncommon soil, rhizosphere, oryza sativa, rice, united states of america, ph 5.62017-04-19v4No1 / 1515
600sheryolower in stover ammendment soil ( high in unamended soil compared to stover amended in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 day 82 )2020-03-27v4No1 / 1612
821sheryoHigher at 10-25cm depth compared to 25-50cm depth in soil in Michigan USA ( high in depth (soil) 10-25cm compared to depth (soil) 25-50cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 1704
616amnoncommon in topsoil of PK/NP/NPK/NK fertilized sugarcane field (common depth (soil) 0-20cm, fertilized soil, ph 5.5-6, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture)2020-04-27v3No1 / 1710
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>4, ph<5, china2018-02-11v4No1 / 1886
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>7, ph<8, china2018-02-11v4No1 / 2160
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
271amnoncommon depth (soil) 0-20cm, soil, china2018-01-09v4No1 / 2856
155amnonlower in tightly bound root soil compared to loose soil and bulk soil ( high in bulk soil compared to root in triticum aestivum wheat soil china )2017-07-02v4No1 / 2933
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>5, ph<6, china2018-02-11v4No1 / 3508
237amnonhigher in burrow soil compared to bird ( high in soil burrow compared to bird seabird oceanodroma leucorhoa in canada bon portage island )2017-11-07v4No1 / 3656
271amnon high in soil compared to rhizosphere glycine max soybean in depth (soil) 0-20cm china 2018-01-09v4No1 / 4853
100amnon high in ph ph<6 compared to ph>6 in soil urban biome park new york city central park 2017-04-03v4No1 / 5770
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org