Search result for sequence:
TACGTAGGGGGCAAGCGTTGTCCGGAATCATTGGGCGTAAAGAGCGTGTAGGCGGCTCGGTAAGTCCGCTGTGAAAGTCCAGGGCTCAACCCTGGAATGCCGGTGGAAACTGTCGAGCTAGAGTCCGGAAGAGGCGAGTGGAATTCCTGG
common ontology terms
term enrichment score
TermScore
soil0.497562
rhizosphere0.228954
cultivated environment0.197368
forest ecosystem0.193548
topsoil0.185471
depth (soil) 0-20cm0.163451
china0.162643
depth (soil) 0-10cm0.152717
paddy field soil0.152249
woodland area0.116711
oryza sativa0.102564
permafrost0.101942
zhejiang province0.098901
peatland0.085714
depth (soil) 15cm0.085714
ph 4-50.080692
brazil0.076677
peat soil0.074257
ph 5-60.074074
park0.073801
farm0.072633
bon portage island0.072464
mature barley plants0.072464
days 1800.072464
quzhou county0.072464
mesocosm0.072464
citrus0.071174
heilongjiang province0.069930
hordeum vulgare0.069930
canada0.068441
kingdom of norway0.067568
state of georgia0.059524
tundra0.059406
oceanodroma leucorhoa0.058824
seabird0.058824
svalbard archipelago0.058824
yellow brown soil0.058824
oak0.058824
cosumnes river preserve0.058824
sacramento0.058824
flood plain0.058824
province of quebec0.057143
quercus0.057143
hunan province0.056338
bulk soil0.056338
nanjing city prefecture0.055556
depth (soil) 0-30 cm0.055556
skin0.054152
leaf0.047059
united states of america0.045340
non-fertilized soil0.045283
yunnan province0.045283
hedera hibernica0.044776
ivy0.044776
burrow0.044776
arachis hypogaea0.044776
peanut0.044776
ph<50.044776
subpolar coniferous forest biome0.044776
boreal forest0.044776
red soil0.044776
fragaria x ananassa0.044776
strawberry0.044776
southern united states0.044776
minas gerais state0.044776
campos rupestres0.044776
epiphytic material0.044776
olympic national park0.044776
canopy soil0.044776
pot expreiment0.044776
acute oak decline0.044776
siberia0.043796
cambisol0.043796
fen0.043796
snake0.043796
sugarcane0.043796
saccharum0.043796
bird0.043478
depth (soil) 20-30cm0.042857
orchard0.042857
greenhouse soil0.042857
biochar0.042857
plant disease0.042857
ph 50.041958
state of washington0.041958
guangzhou city prefecture0.041958
root0.039867
belgium0.039474
zea mays0.037975
triticum aestivum0.037267
united kingdom0.035714
LOWER IN rhizosphere0.034286
state of california0.033898
cinnamomum camphora0.030769
anxi county0.030769
brassica oleracea0.030534
venezuela0.030534
amerindian0.030534
soybean0.030534
moor0.030303
Fraction of dbbact annotations with this term covered by the query
TermScore
cuticle1.000000
chitin-based cuticle1.000000
atlantic rainforest1.000000
parque estadual serra do mar-nĂșcleo picinguaba1.000000
odontomachus hastatus1.000000
sao paulo state1.000000
quaternary laterite soil1.000000
cucurbita moschata1.000000
pumpkin1.000000
LOWER IN qiao nature reserve1.000000
cinnamomum camphora1.000000
anxi county1.000000
peat soil0.750000
permafrost0.750000
brassica oleracea0.666667
venezuela0.666667
amerindian0.666667
park0.666667
non-fertilized soil0.666667
soybean0.666667
paddy field soil0.666667
yunnan province0.666667
cultivated environment0.625000
tundra0.600000
forest ecosystem0.555556
peatland0.500000
temperate grassland biome0.500000
quincy, fl0.500000
ft. pierce, fl0.500000
central park0.500000
hedera hibernica0.500000
ivy0.500000
moor0.500000
scrubland0.500000
ph 6-6.50.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
root zone soil0.500000
depth (soil) 15cm0.500000
pinus sibirica0.500000
pine forest0.500000
lichen0.500000
moss0.500000
kakadu national park0.500000
uranium0.500000
high uranium0.500000
bon portage island0.500000
oceanodroma leucorhoa0.500000
seabird0.500000
brood patch0.500000
burrow0.500000
surface burrow0.500000
LOWER IN deep burrow0.500000
LOWER IN seabird0.500000
LOWER IN oceanodroma leucorhoa0.500000
arachis hypogaea0.500000
peanut0.500000
non-manured soil0.500000
LOWER IN soilwater0.500000
soilwater0.500000
north china plain0.500000
ph>7, ph<80.500000
ph>4, ph<50.500000
svalbard archipelago0.500000
permafrost active layer0.500000
LOWER IN permafrost transition layer0.500000
LOWER IN depth 100-150cm0.500000
LOWER IN depth 150-200cm0.500000
ph 5.40.500000
moist tropical forest0.500000
temperate woodland biome0.500000
temperate deciduos forest0.500000
ph<50.500000
LOWER IN ph&gt;50.500000
subpolar coniferous forest biome0.500000
boreal forest0.500000
ph<30.500000
LOWER IN ph&gt;30.500000
southern temperate forest0.500000
temperate broadleaf and mixed forest biome0.500000
montane forest0.500000
mediterranean forest biome0.500000
savanna0.500000
subtropical broadleaf forest biome0.500000
red soil0.500000
reunion island0.500000
copper0.500000
mature soil0.500000
fragaria x ananassa0.500000
strawberry0.500000
yellow brown soil0.500000
LOWER IN age 10 years0.500000
LOWER IN continuous cropping0.500000
continuous cropping0.500000
age 10 years0.500000
populus0.500000
boreal wetland0.500000
seasonal frozen marsh0.500000
lapland0.500000
LOWER IN depth (soil) 60cm0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.734375
china0.390625
rhizosphere0.195312
united states of america0.140625
depth (soil) 0-20cm0.140625
forest ecosystem0.117188
topsoil0.117188
cultivated environment0.117188
depth (soil) 0-10cm0.101562
woodland area0.085938
paddy field soil0.085938
canada0.070312
zhejiang province0.070312
oryza sativa0.062500
permafrost0.054688
farm0.054688
ph 4-50.054688
peatland0.046875
depth (soil) 15cm0.046875
brazil0.046875
research facility0.046875
ph 5-60.046875
skin0.039062
peat soil0.039062
citrus0.039062
park0.039062
bon portage island0.039062
kingdom of norway0.039062
heilongjiang province0.039062
mature barley plants0.039062
days 1800.039062
hordeum vulgare0.039062
quzhou county0.039062
mesocosm0.039062
state of georgia0.039062
leaf0.031250
tundra0.031250
bird0.031250
oceanodroma leucorhoa0.031250
seabird0.031250
province of quebec0.031250
svalbard archipelago0.031250
hunan province0.031250
yellow brown soil0.031250
nanjing city prefecture0.031250
bulk soil0.031250
depth (soil) 0-30 cm0.031250
united kingdom0.031250
oak0.031250
quercus0.031250
cosumnes river preserve0.031250
sacramento0.031250
state of california0.031250
flood plain0.031250
root0.023438
hedera hibernica0.023438
belgium0.023438
ivy0.023438
siberia0.023438
LOWER IN control0.023438
burrow0.023438
ph 50.023438
arachis hypogaea0.023438
peanut0.023438
non-fertilized soil0.023438
LOWER IN rhizosphere0.023438
depth (soil) 20-30cm0.023438
ph<50.023438
subpolar coniferous forest biome0.023438
boreal forest0.023438
red soil0.023438
cambisol0.023438
zea mays0.023438
triticum aestivum0.023438
orchard0.023438
yunnan province0.023438
fragaria x ananassa0.023438
strawberry0.023438
greenhouse soil0.023438
fen0.023438
snake0.023438
southern united states0.023438
minas gerais state0.023438
campos rupestres0.023438
biochar0.023438
epiphytic material0.023438
state of washington0.023438
olympic national park0.023438
canopy soil0.023438
sugarcane0.023438
saccharum0.023438
guangzhou city prefecture0.023438
pot expreiment0.023438
disease0.023438
plant disease0.023438
acute oak decline0.023438
brassica oleracea0.015625
homo sapiens0.015625
venezuela0.015625
amerindian0.015625
Exp. ID User ID Description Date Region Flag Sequences
357amnondominant soil, topsoil, depth (soil) 0-10cm, subpolar coniferous forest biome, boreal forest, woodland area, forest ecosystem2018-08-19v4No1 / 8
527amnondominant soil, antarctica, east antarctica, nunatak, depth (soil) 2cm, vassdalen2019-07-14v4No1 / 14
147amnondominant peatland, soil, siberia, ph 4.5, lichen, moss2017-04-20v4No1 / 18
237amnoncommon canada, bon portage island, bird, oceanodroma leucorhoa, seabird, brood patch2017-11-07v4No1 / 57
237amnoncommon bird, oceanodroma leucorhoa, seabird, canada, bon portage island, uropygial gland2017-11-07v4No1 / 58
512amnon high in depth (soil) 10 cm depth (soil) 0-20cm compared to depth (soil) 60cm in fen peatland peat soil soil china 2019-03-22v4No1 / 77
426amnoncommon soil, tundra, permafrost, russia, nenets autonomous okrug2018-12-08v4No1 / 81
527amnoncommon soil, antarctica, east antarctica, nunatak, depth (soil) 2cm, vassdalen2019-07-14v4No1 / 106
387amnon high in summer compared to winter in ursus arctos brown bear feces sweden wild 2018-11-03v4No1 / 110
536amnoncommon snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 110
421amnonhigher in paddy field soil incubated with copper compared to controls ( high in copper compared to control in soil research facility zhejiang province paddy field soil china )2018-12-02v4No1 / 141
357amnoncommon in moist tropical forest topsoil around the world (common soil, topsoil, depth (soil) 0-10cm, moist tropical forest, woodland area, forest ecosystem)2018-08-18v4No1 / 171
536amnoncommon snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 184
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 190
786sheryoHigher at 133-166cm depth compared to 60-100cm depth in flood plain soil near cosumnes river, california ( high in depth 133-166cm compared to depth 60-100cm in flood plain soil united states of america state of california sacramento cosumnes river preserve )2021-09-14v3No1 / 191
786sheryoHigher at 166-200cm depth compared to 400-700cm depth in flood plain soil near cosumnes river, california ( high in depth 166-200cm compared to depth 400-700cm in flood plain soil united states of america state of california sacramento cosumnes river preserve )2021-09-13v3No1 / 206
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 213
265amnoncommon in tree leaves (common canada, province of quebec, tree, leaf)2017-12-11v4No1 / 226
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 236
788amnoncommon plant litter, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 259
698amnon high in ph 5-6 plant disease disease acute oak decline compared to ph 6-7 control in depth (soil) 0-30 cm depth (soil) 0-20cm park united kingdom oak quercus rhizosphere 2028-04-01v3No1 / 266
357amnon high in ph<3 compared to ph>3 in soil topsoil depth (soil) 0-10cm subpolar coniferous forest biome boreal forest woodland area forest ecosystem 2018-08-19v4No1 / 297
628sheryoHigher in bulk soil with barley plants after 180 days in treatments unamended with biochar ( high in unamended with biochar compared to biochar in bulk soil china zhejiang province quzhou county soil depth (soil) 15cm ph 4-5 hordeum vulgare days 180 mature barley plants )2020-05-18v4No1 / 327
512amnoncommon fen, peatland, peat soil, soil, hani peatland, baekdudaegan, ph 5-6, china2019-03-22v4No1 / 329
932amnon high in cuticle chitin-based cuticle compared to stomach gaster in atlantic rainforest parque estadual serra do mar-nĂșcleo picinguaba odontomachus hastatus sao paulo state ant brazil tropical moist broadleaf forest biome 2022-08-30v4No1 / 334
426amnon high in mature soil compared to sand in soil tundra permafrost russia nenets autonomous okrug 2018-12-08v4No1 / 377
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
813amnonhigher in epiphytic materiall attached to intact branch compared to severed suspended branch ( high in intact branch compared to severed branch in epiphytic material united states of america state of washington olympic national park canopy soil soil )2021-06-22v4No1 / 390
147amnoncommon soil, siberia, peatland, ph 4.5, lichen, moss2017-04-20v4No1 / 396
259amnonlower in manured soil compared to non-manured ( high in non-manured soil compared to manured soil in soil rhizosphere ph 5 arachis hypogaea peanut fertilized soil china )2017-12-02v4No1 / 397
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 5-6, disease, plant disease, acute oak decline, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No2 / 848
347amnoncommon depth (soil) 0-20cm, kingdom of norway, svalbard archipelago, permafrost, soil, permafrost active layer2018-07-15v4No1 / 405
147amnoncommon pinus sibirica, tundra, soil, pine forest, ph 4, siberia, forest ecosystem2017-04-20v4No1 / 416
412amnonlower in pig manured soil with wheat-maize rotation compared to non-manured soil ( high in non-manured soil compared to manured soil in soil hunan province red soil cambisol zea mays triticum aestivum china )2018-11-26v4No1 / 437
135amnoncommon soil, tundra, alaska, permafrost, depth (soil) 15cm2017-04-17v4No1 / 438
989amnon high in soil compared to rhizosphere in china farm ph 4-5 anxi county cinnamomum camphora depth (soil) 0-20cm 2022-12-26v3No1 / 448
357amnoncommon soil, topsoil, depth (soil) 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 474
813amnoncommon intact branch, epiphytic material, united states of america, state of washington, olympic national park, canopy soil, soil2021-06-22v4No1 / 475
259amnonlower in fertilized soil (npk) compared to non-fertilized ( high in non-fertilized soil compared to fertilized soil in soil rhizosphere ph 5 arachis hypogaea peanut china )2017-12-02v4No1 / 483
512amnoncommon fen, peatland, peat soil, soil, ph 5.5-6.5, tibetan plateau, riganqiao peatland, china2019-03-22v4No1 / 483
357amnoncommon soil, topsoil, depth (soil) 0-10cm, southern temperate forest, temperate broadleaf and mixed forest biome, woodland area, forest ecosystem2018-08-19v4No1 / 499
616amnon high in ph 6.7 non-fertilized soil compared to ph 5.5-6 fertilized soil in depth (soil) 0-20cm sugarcane saccharum soil topsoil china guangzhou city prefecture 2020-04-27v3No1 / 504
128amnonhigher in ivy leaves from moor and forest compared to city ( high in moor forest ecosystem compared to city dense settlement biome in hedera hibernica belgium ivy leaf )2017-04-14v4No1 / 525
357amnoncommon soil, topsoil, depth (soil) 0-10cm, subpolar coniferous forest biome, boreal forest, woodland area, forest ecosystem2018-08-19v4No1 / 538
357amnoncommon soil, topsoil, depth (soil) 0-10cm, mediterranean forest biome, forest ecosystem, woodland area2018-08-19v4No1 / 564
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
762sheryoHigh in bulk soil compared to rhizosphere of a pot experiment with lettuce planted in albic luvisol Germany ( high in bulk soil compared to rhizosphere in thyrow albic luvisol germany haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 578
357amnoncommon soil, topsoil, depth (soil) 0-10cm, montane forest, woodland area, forest ecosystem2018-08-19v4No1 / 592
788amnoncommon cherokia georgiana georgiana, millipede, feces, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 607
357amnoncommon soil, topsoil, depth (soil) 0-10cm, savanna, forest ecosystem, woodland area2018-08-19v4No1 / 614
128amnoncommon hedera hibernica, belgium, ivy, leaf, moor, scrubland2017-04-14v4No1 / 623
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 4-4.5, park, london, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 623
813amnoncommon severed branch, epiphytic material, united states of america, state of washington, olympic national park, canopy soil, soil2021-06-22v4No1 / 633
237amnoncommon in burrow soil of seabird (common bird, oceanodroma leucorhoa, seabird, canada, bon portage island, burrow, soil)2017-11-07v4No1 / 638
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 6-7, cultivated environment, china2018-12-04v4No1 / 682
506amnoncommon soil, boreal wetland, seasonal frozen marsh, depth (soil) 0-10cm, peat soil, northeast china, china, wetland area2019-03-16v4No1 / 690
128amnoncommon hedera hibernica, belgium, ivy, leaf, forest ecosystem2017-04-14v4No1 / 693
347amnoncommon kingdom of norway, svalbard archipelago, permafrost, soil, depth (soil) 20-30cm2018-07-15v4No1 / 698
412amnon high in ph<5 compared to ph>5 in soil hunan province red soil cambisol zea mays triticum aestivum china 2018-11-26v4No1 / 706
809amnoncommon lu'an city prefecture, flowerpot, research facility, greenhouse, dendrobium officinale, rhizosphere, china2021-06-20v4No1 / 715
415amnoncommon rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 721
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 5-6, cultivated environment, china2018-12-04v4No1 / 726
821sheryoComoon in soil of miscanthus field at 50-100cm depth, Michigan USA (common depth 50-100m, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 726
752sheryoCommon in soil planted with Panax notoginseng (common panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 730
989amnoncommon depth (soil) 0-20cm, cinnamomum camphora, anxi county, ph 4-5, farm, china, soil2022-12-26v3No1 / 738
421amnoncommon in paddy field soil incubated with copper (common soil, research facility, zhejiang province, paddy field soil, copper, china)2018-12-02v4No1 / 740
752sheryoCommon in soil planted with Panax notoginseng amended with2% biochar (common biochar, panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 783
347amnon high in depth (soil) 20-30cm compared to depth (soil) 0-20cm permafrost transition layer in kingdom of norway svalbard archipelago permafrost soil 2018-07-15v4No1 / 788
422amnoncommon soil, paddy field soil, oryza sativa, yunnan province, china, cultivated environment2018-12-02v4No1 / 821
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph<5, china2018-11-26v4No1 / 823
421amnoncommon in paddy field soil incubated without copper (common research facility, soil, paddy field soil, zhejiang province, china)2018-12-02v4No1 / 824
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 830
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, continuous cropping, age 5 years, age 10 years, china, cultivated environment2019-01-07v4No1 / 833
356amnoncommon in deciduous broad leaved forest top soil in japan (common soil, depth (soil) 0-10cm, hokkaido, topsoil, ph 5.4, japan, forest ecosystem)2018-08-15v4No1 / 834
265amnoncommon canada, province of quebec, soilwater, water2017-12-11v4No1 / 841
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil2017-04-15v4No1 / 884
788amnoncommon soil, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 897
786sheryoCommon in flood plain soil near cosumnes river, california, at 133-166cm depth (common depth (soil) 133-166cm, cosumnes river preserve, sacramento, state of california, united states of america, soil, flood plain)2021-05-18v3No1 / 898
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
359amnoncommon soil, topsoil, depth (soil) 0-10cm, guangdong province, subtropical broadleaf forest biome, china, forest ecosystem, woodland area2018-08-19v4No1 / 935
786sheryoCommon in flood plain soil near cosumnes river, california, at 166-200cm depth (common depth (soil) 166-200cm, flood plain, soil, united states of america, state of california, sacramento, cosumnes river preserve)2021-05-18v3No1 / 936
444amnoncommon in uncultivated soil plot (common yellow brown soil, nanjing city prefecture, soil, china)2019-01-07v4No1 / 946
98amnoncommon citrus, rhizosphere, quincy, fl, root, state of florida2017-04-01v4No1 / 950
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, root zone soil2017-04-15v4No1 / 968
480amnoncommon soil, pasture, farm, new zealand2019-02-05v4No1 / 970
474amnoncommon soil, farm, glycine max, soybean, ph 4-6, brazil, cultivated environment2019-01-16v4No1 / 974
809amnoncommon dendrobium moniliforme, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1002
933amnoncommon guangxi zhuang autonomous region, ph 5.5, quaternary laterite soil, research facility, china, cucurbita moschata, pumpkin, rhizosphere2022-09-11v3No1 / 1002
628sheryocommon in bulk soil with barley plants after 180 days in treatments amended with biochar (common biochar, bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1023
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, china, cultivated environment2018-12-02v4No1 / 1049
917amnon high in futian national nature reserve compared to qiao nature reserve in depth (soil) 0-20cm china marsh mangrove mangrove biome soil saline marsh 2022-07-08v3No1 / 1071
154amnon high in uranium high uranium compared to control in soil australia kakadu national park sediment 2017-06-29v4No1 / 1080
347amnon high in depth (soil) 20-30cm compared to depth 100-150cm depth 150-200cm in kingdom of norway svalbard archipelago permafrost soil 2018-07-15v4No1 / 1080
265amnoncommon canada, province of quebec, soil2017-12-11v4No1 / 1090
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
84amnoncommon soil, peatland, peat soil, sphagnum bog, temperate grassland biome, depth 5cm, wetland area2017-03-06v4No1 / 1103
357amnon high in ph<5 compared to ph>5 in soil topsoil depth (soil) 0-10cm temperate woodland biome temperate deciduos forest woodland area forest ecosystem 2018-08-18v4No1 / 1104
628sheryocommon in bulk soil with barley plants after 180 days in treatments unamended with biochar (common bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1136
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 7-8, cultivated environment, china2018-12-04v4No1 / 1169
628sheryocommon in rhizosphere of barley roots after 180 days in treatments amended with biochar (common mature barley plants, days 180, rhizosphere, hordeum vulgare, biochar, ph 4-5, depth (soil) 15cm, china, quzhou county, zhejiang province, soil)2020-05-18v4No1 / 1192
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
917amnoncommon ph 7-8, futian national nature reserve, depth (soil) 0-20cm, kandelia candel, china, marsh, mangrove, soil2022-07-08v3No1 / 1197
628sheryocommon in rhizosphere of barley roots after 180 days in treatments unamended with biochar (common china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, rhizosphere, days 180, mature barley plants)2020-05-18v4No1 / 1209
444amnonlower in continuously cropped strawberry soil ( high in age 1 year compared to age 5 years age 10 years continuous cropping in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture china cultivated environment )2019-01-07v4No1 / 1221
237amnonlower deep in burrow compared to burrow entrance ( high in surface burrow compared to deep burrow in bird oceanodroma leucorhoa seabird canada bon portage island burrow soil )2017-11-07v4No1 / 1247
616amnoncommon in topsoil of non-fertilized sugarcane field (common depth (soil) 0-20cm, ph 6.7, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture, non-fertilized soil)2020-04-27v3No1 / 1277
788amnon high in soil compared to plant litter in mesocosm state of georgia united states of america 2021-05-31v4No1 / 1280
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
98amnoncommon citrus, rhizosphere, ft. pierce, fl, root, state of florida2017-04-01v4No1 / 1340
788amnon high in soil compared to cherokia georgiana georgiana millipede feces in mesocosm state of georgia united states of america 2021-05-31v4No1 / 1395
422amnoncommon soil, paddy field soil, oryza sativa, hunan province, hubei province, china, cultivated environment2018-12-02v4No1 / 1399
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v4No1 / 1439
145amnoncommon soil, rhizosphere, oryza sativa, rice, united states of america, ph 5.62017-04-19v4No1 / 1515
422amnon high in ph 5-6 compared to ph 7-8 in soil paddy field soil oryza sativa heilongjiang province cultivated environment china 2018-12-04v4No1 / 1634
616amnoncommon in topsoil of PK/NP/NPK/NK fertilized sugarcane field (common depth (soil) 0-20cm, fertilized soil, ph 5.5-6, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture)2020-04-27v3No1 / 1710
156amnoncommon soil, rhizosphere, brassica, brassica oleracea, china2017-07-27v4No1 / 1885
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>4, ph<5, china2018-02-11v4No1 / 1886
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>7, ph<8, china2018-02-11v4No1 / 2160
265amnon high in soil compared to soilwater water in canada province of quebec 2017-12-11v4No1 / 2715
271amnoncommon depth (soil) 0-20cm, soil, china2018-01-09v4No1 / 2856
237amnonhigher in burrow soil compared to bird ( high in soil burrow compared to bird seabird oceanodroma leucorhoa in canada bon portage island )2017-11-07v4No1 / 3656
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
271amnon high in soil compared to rhizosphere glycine max soybean in depth (soil) 0-20cm china 2018-01-09v4No1 / 4853
100amnon high in ph ph<6 compared to ph>6 in soil urban biome park new york city central park 2017-04-03v4No1 / 5770
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org