Search result for sequence:
TACGTAGGGGGCAAGCGTTGTCCGGAGTTACTGGGCGTAAAGGGCCTGTAGGCGGTGCTTTCAGTTCCTGCTGACAGTCCTCAGCTTACCTGAGGAAGGTGTAGGAAGACGGGAGCACTTGAGGGCGGCAGAGGGAGACGGAATTCCGGG
common ontology terms
term enrichment score
TermScore
minas gerais state0.666667
campos rupestres0.666667
barbacenia macrantha0.666667
root endosphere0.333333
leaf surface0.285714
root0.117647
brazil0.100000
leaf0.086957
Fraction of dbbact annotations with this term covered by the query
TermScore
minas gerais state0.500000
campos rupestres0.500000
barbacenia macrantha0.500000
root endosphere0.250000
leaf surface0.200000
root0.066667
brazil0.052632
leaf0.047619
Fraction of annotations for the query sequences containing the term
TermScore
minas gerais state1.000000
campos rupestres1.000000
brazil1.000000
barbacenia macrantha1.000000
root endosphere0.500000
root0.500000
leaf0.500000
leaf surface0.500000

Problems / suggestions? Please email info AT dbbact DOT org