Search result for sequence:
TACGTAGGGGGCAAGCGTTGTCCGGATTCACTGGGCGTAAAGCGCGCGCAGGCGGTGATGTAAGTCTGAGGTGAAAACCCGAAGCTCAACTTCGGGACTGCCTTGGATACTGCGTCACTTGAGGATAGGAGAGGCAAGGGGAATTCCACG
common ontology terms
term enrichment score
TermScore
skin0.283019
cat0.157895
costa rica0.154506
mississippi river0.141414
felis catus0.136364
river0.110236
amphibia0.105263
aquatic biome0.105263
fresh water0.088328
ant0.086022
upstream0.086022
LOWER IN downstream0.086022
united states of america0.083414
free floating0.082474
frog0.079208
air0.079208
forest ecosystem0.077670
french republic0.074766
particles0.067039
heliconius erato0.065934
tropical and subtropical moist broadleaf forest biome0.065934
liolaemus ruibali0.065934
svalbard archipelago0.065934
milk0.065934
cow milk (fluid)0.065934
cow milk (raw)0.065934
leaf0.064000
butterfly0.063830
seed0.063830
argentina0.061856
permafrost0.061856
panama0.060000
stomach0.055046
kingdom of norway0.055046
whole body0.053571
city0.052863
body proper0.050847
australia0.050847
larval stage0.047244
venezuela0.045455
amerindian0.045455
tissue0.044944
diploastrea heliopora0.044944
lower back0.044944
rhaebo haematiticus0.044944
truando toad0.044944
interdigital region0.044944
balaenoptera physalus0.044944
fin whale0.044944
groin0.044944
balaenoptera borealis0.044944
sei whale0.044944
depth 150-200cm0.044944
campinas0.044944
brassicaceae0.044944
boechera stricta0.044944
depth 100-150cm0.044944
hunter gatherer0.044944
lowland pasture0.044944
lowland farm0.044944
LOWER IN lower mississippi river0.044944
pupa0.043956
conjunctiva0.043956
toad0.043956
crematogaster0.043956
diabetes mellitus0.043956
foot0.043956
delphinus delphis0.043956
whole plant0.043956
toronto0.043956
brassica oleracea0.043956
hong kong0.043956
saccharum0.043956
sugarcane0.043956
state of idaho0.043956
upper mississippi river0.043956
depth 1m0.043956
homo sapiens0.043682
italy0.043165
inguinal region0.043011
external acoustic meatus0.043011
ear canal0.043011
third decade human stage0.043011
greenhouse0.043011
coral0.042105
axilla0.042105
hawaii0.042105
dermal layer of tongue0.042105
LOWER IN root0.041667
small intestine0.041237
new york city0.040404
LOWER IN saliva0.039604
tongue0.039604
plant0.039604
LOWER IN stomach0.038835
LOWER IN feces0.037736
ocean0.034188
brazil0.032520
farm0.031579
canada0.031496
Fraction of dbbact annotations with this term covered by the query
TermScore
venezuela0.666667
amerindian0.666667
particles0.666667
heliconius erato0.500000
tropical and subtropical moist broadleaf forest biome0.500000
LOWER IN atopic dermatitis0.500000
LOWER IN allergy0.500000
teneral adult0.500000
tissue0.500000
diploastrea heliopora0.500000
lower back0.500000
amphibia0.500000
rhaebo haematiticus0.500000
truando toad0.500000
ant0.500000
rana luteiventris0.500000
columbia spotted frog0.500000
skin under eye0.500000
LOWER IN conjunctiva0.500000
human0.500000
interdigital region0.500000
balaenoptera physalus0.500000
fin whale0.500000
groin0.500000
balaenoptera borealis0.500000
sei whale0.500000
carcharhinus plumbeus0.500000
snadbar shark0.500000
skin of face0.500000
skin under eyes0.500000
premature birth0.500000
balaenoptera acutorostrata0.500000
minke whale0.500000
phocoena phocoena0.500000
harbor porpoise0.500000
liolaemus ruibali0.500000
hypopharynx0.500000
steno bredanensis0.500000
rough-toothed dolphin0.500000
lagenorhynchus acutus0.500000
organic material0.500000
forest biome0.500000
pseudomyrmex flavicornis0.500000
junco hyemalis0.500000
songbird0.500000
oophaga pumilio0.500000
strawberry poison frog0.500000
svalbard archipelago0.500000
depth 150-200cm0.500000
craugastor fitzingeri0.500000
common rain frog0.500000
milk0.500000
cow milk (fluid)0.500000
cow milk (raw)0.500000
alpine pasture0.500000
upper stem0.500000
LOWER IN leaf endosphere0.500000
campinas0.500000
brassicaceae0.500000
boechera stricta0.500000
subway0.500000
pseudomyrmex spinicola0.500000
craugastor bransfordii0.500000
bransford’s litter frog0.500000
depth 100-150cm0.500000
hunter gatherer0.500000
LOWER IN venezuela0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN depth (soil) 20-30cm0.500000
hirundo rustica0.500000
barn swallow0.500000
upstream0.500000
LOWER IN downstream0.500000
aquatic biome0.500000
mississippi river0.500000
lowland pasture0.500000
lowland farm0.500000
cloud0.500000
marine biome0.500000
kelp forest0.500000
LOWER IN lower mississippi river0.500000
LOWER IN achatinella mustelina0.500000
LOWER IN alpine0.500000
LOWER IN alpine pasture0.500000
size < 10um0.500000
clear day0.500000
LOWER IN endosphere0.500000
pupa0.333333
butterfly0.333333
conjunctiva0.333333
toad0.333333
crematogaster0.333333
state of montana0.333333
diabetes mellitus0.333333
foot0.333333
seed0.333333
1-month-old human stage0.333333
delphinus delphis0.333333
whole plant0.333333
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.505882
skin0.294118
felis catus0.176471
cat0.176471
homo sapiens0.117647
costa rica0.105882
river0.082353
fresh water0.082353
mississippi river0.082353
amphibia0.058824
aquatic biome0.058824
forest ecosystem0.047059
ant0.047059
frog0.047059
french republic0.047059
leaf0.047059
air0.047059
upstream0.047059
LOWER IN downstream0.047059
free floating0.047059
body proper0.035294
panama0.035294
butterfly0.035294
heliconius erato0.035294
whole body0.035294
tropical and subtropical moist broadleaf forest biome0.035294
stomach0.035294
australia0.035294
larval stage0.035294
seed0.035294
research facility0.035294
argentina0.035294
liolaemus ruibali0.035294
permafrost0.035294
soil0.035294
kingdom of norway0.035294
svalbard archipelago0.035294
farm0.035294
milk0.035294
italy0.035294
cow milk (fluid)0.035294
cow milk (raw)0.035294
city0.035294
particles0.035294
pupa0.023529
conjunctiva0.023529
ocean0.023529
tissue0.023529
coral0.023529
diploastrea heliopora0.023529
lower back0.023529
rhaebo haematiticus0.023529
truando toad0.023529
toad0.023529
crematogaster0.023529
new york city0.023529
interdigital region0.023529
balaenoptera physalus0.023529
fin whale0.023529
inguinal region0.023529
groin0.023529
axilla0.023529
external acoustic meatus0.023529
ear canal0.023529
diabetes mellitus0.023529
LOWER IN control0.023529
foot0.023529
balaenoptera borealis0.023529
sei whale0.023529
LOWER IN saliva0.023529
small intestine0.023529
delphinus delphis0.023529
hawaii0.023529
whole plant0.023529
LOWER IN stomach0.023529
LOWER IN feces0.023529
tongue0.023529
dermal layer of tongue0.023529
adult0.023529
toronto0.023529
canada0.023529
third decade human stage0.023529
depth 150-200cm0.023529
brassica oleracea0.023529
hong kong0.023529
brazil0.023529
greenhouse0.023529
campinas0.023529
saccharum0.023529
sugarcane0.023529
state of idaho0.023529
plant0.023529
brassicaceae0.023529
boechera stricta0.023529
depth 100-150cm0.023529
venezuela0.023529
amerindian0.023529
hunter gatherer0.023529
lowland pasture0.023529
lowland farm0.023529
Exp. ID User ID Description Date Region Flag Sequences
118amnoncommon pupa, body proper, panama, butterfly, heliconius erato, whole body, tropical and subtropical moist broadleaf forest biome, forest ecosystem2017-04-11v4No1 / 4
158amnoncommon united states of america, conjunctiva, felis catus, cat2017-07-06v4No1 / 4
158amnonhigh in skin of healthy cats compared to cats with skin allergy ( high in control compared to atopic dermatitis allergy in united states of america skin felis catus cat )2017-07-05v4No1 / 5
118amnoncommon in captive raised teneral adult butterfly (common body proper, panama, butterfly, heliconius erato, whole body, tropical and subtropical moist broadleaf forest biome, teneral adult, forest ecosystem)2017-04-11v4No1 / 6
118amnondominant pupa, body proper, panama, butterfly, heliconius erato, whole body, tropical and subtropical moist broadleaf forest biome, forest ecosystem2017-04-11v4No1 / 6
418amnoncommon ocean, tissue, coral, diploastrea heliopora2018-12-02v4No1 / 12
158amnondominant united states of america, lower back, felis catus, cat2017-07-06v4No1 / 13
374amnondominant skin, costa rica, amphibia, rhaebo haematiticus, truando toad, toad2018-09-09v4No1 / 13
408amnondominant united states of america, stomach, costa rica, crematogaster, ant2018-11-22v4No1 / 13
647amnoncommon in skin of columbia spotted frog (common united states of america, lake, skin, frog, state of montana, rana luteiventris, columbia spotted frog)2020-09-06v4No1 / 13
58amnon high in skin skin under eye compared to conjunctiva in new york city human 2017-02-02v4No1 / 14
158amnondominant united states of america, conjunctiva, felis catus, cat2017-07-06v4No1 / 14
158amnondominant united states of america, interdigital region, felis catus, cat2017-07-06v4No1 / 15
158amnoncommon united states of america, lower back, felis catus, cat2017-07-06v4No1 / 15
79amnondominant united states of america, skin, balaenoptera physalus, fin whale2017-03-03v4No1 / 15
158amnondominant united states of america, inguinal region, felis catus, cat, groin2017-07-06v4No1 / 16
158amnondominant united states of america, axilla, felis catus, cat2017-07-06v4No1 / 17
158amnondominant united states of america, external acoustic meatus, felis catus, cat, ear canal2017-07-06v4No1 / 18
232amnonhigher in diabetec patient foot skin compared to healthy controls ( high in diabetes mellitus compared to control in homo sapiens skin foot australia )2017-11-05v4No1 / 19
408amnoncommon united states of america, larval stage, costa rica, crematogaster, ant2018-11-22v4No1 / 19
79amnondominant united states of america, skin, balaenoptera borealis, sei whale2017-03-03v4No1 / 20
592amnoncommon digestive system, united states of america, state of florida, carcharhinus plumbeus, snadbar shark2020-02-18v1No1 / 20
58amnoncommon homo sapiens, skin of face, new york city, skin under eyes2017-02-02v4No1 / 21
158amnoncommon united states of america, external acoustic meatus, felis catus, cat, ear canal2017-07-06v4No1 / 22
191amnonhigher in preterm birth vaginal samples ( high in premature birth compared to control in homo sapiens united states of america female pregnancy vagina )2017-09-05v4No1 / 22
79amnoncommon united states of america, skin, balaenoptera acutorostrata, minke whale2017-03-03v4No1 / 23
158amnoncommon united states of america, pair of nares, felis catus, cat2017-07-06v4No1 / 25
29amnoncommon in various plant seeds ( high in compared to in french republic seed )2016-12-05v4No1 / 26
158amnonhigher in skin sites compared to mouth in cats ( high in skin compared to saliva mouth in united states of america felis catus cat )2017-07-06v4No1 / 26
158amnoncommon united states of america, inguinal region, felis catus, cat, groin2017-07-06v4No1 / 27
79amnoncommon united states of america, skin, phocoena phocoena, harbor porpoise2017-03-03v4No1 / 31
71amnoncommon research facility, small intestine, argentina, liolaemus ruibali2017-02-25v4No1 / 33
48amnonlower in 3 months compared to 1 week in infant hypopharynx ( high in age age 1 week 1-month-old human stage compared to 3-month-old human stage in homo sapiens hypopharynx infant kingdom of denmark )2017-01-19v4No1 / 35
79amnoncommon united states of america, skin, steno bredanensis, rough-toothed dolphin2017-03-03v4No1 / 35
79amnondominant united states of america, skin, delphinus delphis2017-03-03v4No1 / 36
158amnoncommon united states of america, axilla, felis catus, cat2017-07-06v4No1 / 37
232amnoncommon in foot of diabetic patients (common homo sapiens, skin, foot, australia, diabetes mellitus)2017-11-05v4No1 / 37
79amnoncommon united states of america, skin, lagenorhynchus acutus2017-03-03v4No1 / 40
28amnoncommon in various trees in hawaii (common organic material, forest biome, leaf, hawaii, whole plant, forest ecosystem)2016-12-05v4No1 / 41
158amnoncommon united states of america, interdigital region, felis catus, cat2017-07-06v4No1 / 42
418amnon high in tissue compared to mucus in ocean coral diploastrea heliopora 2018-12-02v4No1 / 44
408amnon high in larval stage compared to stomach in united states of america costa rica ant pseudomyrmex flavicornis 2018-11-22v4No1 / 47
89amnoncommon cloaca, commonwealth of virginia, junco hyemalis, songbird2017-03-08v4No1 / 48
374amnoncommon skin, costa rica, frog, amphibia, oophaga pumilio, strawberry poison frog2018-09-09v4No1 / 61
71amnon high in stomach small intestine compared to feces hindgut colon in research facility argentina liolaemus ruibali 2017-02-25v4No1 / 67
653amnon high in tongue dermal layer of tongue compared to saliva in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 72
71amnoncommon research facility, stomach, argentina, liolaemus ruibali2017-02-25v4No1 / 88
79amnoncommon united states of america, skin, balaenoptera borealis, sei whale2017-03-03v4No1 / 90
79amnoncommon united states of america, skin, balaenoptera physalus, fin whale2017-03-03v4No1 / 105
377amnoncommon skin, germany, salamandra salamandra, salamander2018-09-12v4No1 / 106
79amnoncommon united states of america, skin, delphinus delphis2017-03-03v4No1 / 113
374amnoncommon skin, costa rica, amphibia, rhaebo haematiticus, truando toad, toad2018-09-09v4No1 / 121
347amnoncommon permafrost, soil, kingdom of norway, svalbard archipelago, depth 150-200cm2018-07-15v4No1 / 126
374amnoncommon skin, costa rica, frog, amphibia, craugastor fitzingeri, common rain frog2018-09-09v4No1 / 136
617amnoncommon farm, milk, italy, cow milk (fluid), cow milk (raw), alpine, alpine pasture2020-05-03v3No1 / 137
29amnoncommon brassica oleracea, french republic, seed2016-12-05v4No1 / 146
475amnoncommon in air next to subway stations in hong kong (common city, air, hong kong)2019-01-20v4No1 / 147
615amnon high in stem stem endosphere upper stem compared to leaf leaf endosphere in brazil endosphere greenhouse campinas saccharum sugarcane 2020-04-27v4No1 / 153
266amnoncommon on perennial plant leaves (common united states of america, leaf, state of idaho, plant, brassicaceae, boechera stricta)2017-12-19v4No1 / 156
475amnoncommon in air in subway train in hong kong (common city, air, hong kong, subway)2019-01-20v4No1 / 161
408amnon high in larval stage compared to stomach in united states of america costa rica ant pseudomyrmex spinicola 2018-11-22v4No1 / 165
374amnoncommon skin, costa rica, frog, amphibia, craugastor bransfordii, bransford’s litter frog2018-09-09v4No1 / 171
347amnoncommon permafrost, soil, kingdom of norway, svalbard archipelago, depth 100-150cm2018-07-15v4No1 / 173
75amnoncommon homo sapiens, arm, skin, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 190
371amnoncommon homo sapiens, skin, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 195
371amnonlower in skin of amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in homo sapiens skin )2018-09-06v4No1 / 195
347amnon high in depth 100-150cm depth 150-200cm compared to depth (soil) 20-30cm in permafrost soil kingdom of norway svalbard archipelago 2018-07-15v4No1 / 221
161amnoncommon in barn swallows in colorado (common feces, united states of america, state of colorado, hirundo rustica, barn swallow)2017-07-12v4No1 / 245
103amnon high in upstream compared to downstream in united states of america river aquatic biome fresh water mississippi river particles 2017-04-05v4No1 / 256
103amnon high in upstream compared to downstream in united states of america river aquatic biome fresh water mississippi river free floating 2017-04-05v4No1 / 257
617amnoncommon farm, milk, italy, cow milk (fluid), cow milk (raw), lowland pasture, lowland farm2020-05-03v3No1 / 257
253amnoncommon in clouds in puy de dome mountain in france (common air, french republic, autumn, cloud)2017-11-22v4No1 / 267
77amnon high in winter compared to summer in marine biome kelp forest australia algae 2017-02-28v4No1 / 303
653amnon high in tongue dermal layer of tongue compared to dentition supragingival plaque supragingival dental plaque in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 306
443amnonlower in lower mississippi river (downstream) compared to upper mississippi river ( high in upstream upper mississippi river compared to downstream lower mississippi river in united states of america river water fresh water mississippi river free floating depth 1m filtered 0.2um )2019-01-07v4No1 / 335
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
443amnonlower in lower mississippi river (downstream) compared to upper mississippi river ( high in upstream upper mississippi river compared to downstream lower mississippi river in united states of america river water fresh water mississippi river particles depth 1m filtered 2.7um )2019-01-07v4No1 / 425
28amnon high in leaf whole plant compared to feces achatinella mustelina in hawaii 2016-12-05v4No1 / 471
617amnonlower in cow milk of cows in alpine pasture compared to lowland farm ( high in lowland pasture lowland farm compared to alpine alpine pasture in farm milk italy cow milk (fluid) cow milk (raw) )2020-05-03v3No1 / 484
103amnonlower in particle bound fraction compared to free floating bacteria in mississippi river ( high in free floating compared to particles in united states of america river aquatic biome fresh water mississippi river )2017-04-05v4No1 / 653
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
103amnoncommon united states of america, river, aquatic biome, fresh water, mississippi river, particles2017-04-05v4No1 / 909
103amnoncommon united states of america, river, aquatic biome, fresh water, mississippi river, free floating2017-04-05v4No1 / 909
615amnon high in rhizosphere compared to endosphere root in brazil greenhouse campinas saccharum sugarcane 2020-04-27v4No1 / 913
266amnon high in leaf compared to root in united states of america state of idaho plant brassicaceae boechera stricta 2017-12-19v4No1 / 1175

Problems / suggestions? Please email info AT dbbact DOT org