Search result for sequence:
TACGTAGGGGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGAGCGTGTAGGCGGTTTGGTAGGTCCGTTGTGAAAACTCGAGGCTCAACCTCGAGACGCCGATGGAAACCATCAGACTAGAGTCCGGAAGAGGAGAGTGGAATTCCTGG
common ontology terms
term enrichment score
TermScore
soil0.302816
rhizosphere0.253237
bulk soil0.244068
wheat0.223602
pot expreiment0.216216
dekalb county0.216216
illinois0.216216
mollisol0.179104
north china plain0.171429
lettuce0.171429
park0.152672
zhejiang province0.146341
agricultural feature0.140351
state of illinois0.131148
mature barley plants0.121212
days 1800.121212
quzhou county0.121212
oak0.121212
mineral fertilization0.121212
thyrow0.121212
albic luvisol0.121212
hapludalf0.121212
alfisol0.121212
triticum aestivum0.116959
hordeum vulgare0.114286
quercus0.114286
npk fertilization0.114286
sandy loam0.114286
sandy loam soil0.114286
china0.113864
zea mays0.112150
glycine max0.111111
depth (soil) 0-20cm0.110325
depth (soil) 15cm0.108108
depth (soil) 0-30 cm0.108108
silt loam0.097561
ph<60.096000
minas gerais state0.093750
campos rupestres0.093750
maize field0.093750
ph 50.091603
haplic luvisol0.089552
switzerland0.083916
germany0.077922
ph 4-50.072727
winter0.069767
LOWER IN ph&gt;60.065574
barbacenia macrantha0.064516
acute oak decline0.064516
lower saxony0.064516
sandy soil0.064516
ph 6.40.064516
therwil0.064516
depth 12-44cm0.064516
panax notoginseng0.064516
sanqi plants0.064516
xundian county0.064516
soybean0.062500
heilongjiang province0.062500
black soil0.062500
yunnan province0.062500
npk fertilizer0.060606
plant disease0.060606
ph 60.057143
depth (soil) 0-10cm0.056338
root0.054795
biochar0.054054
brazil0.052174
united kingdom0.051948
ph 5-60.043478
LOWER IN rhizosphere0.038095
field soil0.033333
central park0.033333
ph 6-6.50.033333
myrtillocactus geometrizans0.033333
opuntia robusta0.033333
root zone soil0.033333
arachis hypogaea0.033333
peanut0.033333
ph>80.033333
ph>7, ph<80.033333
ph>6, ph<70.033333
ph>5, ph<60.033333
ph>4, ph<50.033333
substraat arabidopsis0.033333
lentse potgrond0.033333
lu'an city prefecture0.033333
flowerpot0.033333
dendrobium officinale0.033333
restored prairie0.033333
miscanthus0.033333
panicum virgatum0.033333
kellogg biological station0.033333
mesic type hapludalf0.033333
kalamazoo loam0.033333
depth (sediment) 0cm0.033333
taihu lake0.033333
taihu national park0.033333
elevation 2000-3000m0.033333
siliceous parent material0.033333
Fraction of dbbact annotations with this term covered by the query
TermScore
park0.666667
ph<60.666667
LOWER IN ph&gt;60.666667
mollisol0.666667
bulk soil0.571429
field soil0.500000
central park0.500000
ph 6-6.50.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
root zone soil0.500000
arachis hypogaea0.500000
peanut0.500000
north china plain0.500000
ph>80.500000
ph>7, ph<80.500000
ph>6, ph<70.500000
ph>5, ph<60.500000
ph>4, ph<50.500000
minas gerais state0.500000
campos rupestres0.500000
barbacenia macrantha0.500000
mature barley plants0.500000
days 1800.500000
quzhou county0.500000
substraat arabidopsis0.500000
lentse potgrond0.500000
lu'an city prefecture0.500000
flowerpot0.500000
dendrobium officinale0.500000
restored prairie0.500000
miscanthus0.500000
panicum virgatum0.500000
kellogg biological station0.500000
mesic type hapludalf0.500000
kalamazoo loam0.500000
depth (sediment) 0cm0.500000
taihu lake0.500000
taihu national park0.500000
elevation 2000-3000m0.500000
siliceous parent material0.500000
ph 4.5-70.500000
canton of graubunden0.500000
oak0.500000
acute oak decline0.500000
bacillus amyloliquefaciens sqr90.500000
lower saxony0.500000
sandy soil0.500000
maize field0.500000
mineral fertilization0.500000
thyrow0.500000
albic luvisol0.500000
ph 6.40.500000
lettuce0.500000
pot expreiment0.500000
organic fertilization0.500000
therwil0.500000
LOWER IN organic fertilization0.500000
LOWER IN bio-dynamic fertilizer0.500000
bretagne region0.500000
depth 0-27cm0.500000
dekalb county0.500000
illinois0.500000
depth 27-56cm0.500000
depth 56-116cm0.500000
depth 116-140cm0.500000
depth 12-44cm0.500000
hapludalf0.500000
alfisol0.500000
depth 44-108cm0.500000
depth 108-140cm0.500000
LOWER IN depth 0-12cm0.500000
depth 15-30cm0.500000
old growth forest0.500000
luvisol0.500000
grand river watershed0.500000
rare charitable research reserve0.500000
quercus velutina0.500000
quercus alba0.500000
quercus rubra0.500000
acer saccharum0.500000
acer saccharum subsp. nigrum0.500000
fagus grandifolia0.500000
forest0.500000
king george island0.500000
antarctic pearlwort0.500000
colobanthus quitensis0.500000
panax notoginseng0.500000
sanqi plants0.500000
xundian county0.500000
wheat0.400000
ph 50.400000
nicotiana tabacum0.333333
cactus0.333333
semi-arid0.333333
LOWER IN soybean0.333333
soybean0.333333
heilongjiang province0.333333
black soil0.333333
paddy field soil0.333333
Fraction of annotations for the query sequences containing the term
TermScore
soil0.775862
china0.465517
rhizosphere0.275862
depth (soil) 0-20cm0.224138
wheat0.155172
bulk soil0.155172
united states of america0.155172
agricultural feature0.137931
pot expreiment0.137931
dekalb county0.137931
illinois0.137931
state of illinois0.137931
north china plain0.103448
winter0.103448
mollisol0.103448
zhejiang province0.103448
germany0.103448
lettuce0.103448
park0.086207
triticum aestivum0.086207
glycine max0.068966
zea mays0.068966
mature barley plants0.068966
days 1800.068966
hordeum vulgare0.068966
ph 4-50.068966
depth (soil) 15cm0.068966
quzhou county0.068966
depth (soil) 0-30 cm0.068966
united kingdom0.068966
oak0.068966
quercus0.068966
mineral fertilization0.068966
npk fertilization0.068966
thyrow0.068966
albic luvisol0.068966
silt loam0.068966
sandy loam0.068966
sandy loam soil0.068966
hapludalf0.068966
alfisol0.068966
ph<60.051724
ph 50.051724
minas gerais state0.051724
campos rupestres0.051724
brazil0.051724
switzerland0.051724
maize field0.051724
haplic luvisol0.051724
LOWER IN ph&gt;60.034483
root0.034483
LOWER IN rhizosphere0.034483
soybean0.034483
heilongjiang province0.034483
black soil0.034483
npk fertilizer0.034483
barbacenia macrantha0.034483
biochar0.034483
depth (soil) 0-10cm0.034483
ph 5-60.034483
disease0.034483
plant disease0.034483
acute oak decline0.034483
lower saxony0.034483
sandy soil0.034483
ph 6.40.034483
therwil0.034483
depth 12-44cm0.034483
panax notoginseng0.034483
sanqi plants0.034483
ph 60.034483
xundian county0.034483
yunnan province0.034483
field soil0.017241
nicotiana tabacum0.017241
urban biome0.017241
new york city0.017241
central park0.017241
ph0.017241
ph 6-6.50.017241
mexico0.017241
myrtillocactus geometrizans0.017241
opuntia robusta0.017241
cactus0.017241
semi-arid0.017241
root zone soil0.017241
arachis hypogaea0.017241
peanut0.017241
LOWER IN glycine max0.017241
LOWER IN soybean0.017241
LOWER IN root structure0.017241
LOWER IN root0.017241
depth 5cm0.017241
ph>80.017241
ph>7, ph<80.017241
ph>6, ph<70.017241
ph>5, ph<60.017241
ph>4, ph<50.017241
paddy field soil0.017241
rock0.017241
Exp. ID User ID Description Date Region Flag Sequences
698amnon high in ph 5-6 plant disease disease acute oak decline compared to ph 6-7 control in depth (soil) 0-30 cm depth (soil) 0-20cm park united kingdom oak quercus rhizosphere 2028-04-01v3No1 / 266
752sheryoHigher in treatments without biochar compared to treatments with biochar in soil planted with Panax notoginseng amended with 2% biochar ( high in without biochar compared to biochar in panax notoginseng sanqi plants ph 6 xundian county yunnan province china pot expreiment soil )2021-03-11v3No1 / 273
882amnoncommon king george island, antarctic pearlwort, colobanthus quitensis, antarctica, rhizosphere2022-03-20v3No1 / 325
762sheryoHigher in bulk soil of a pot experiment with lettuce planted in npk fertilized compared to organic fertilized haplic luvisol Switzerland ( high in npk fertilization mineral fertilization compared to organic fertilization bio-dynamic fertilizer manure fertilization manured soil in therwil switzerland haplic luvisol soil bulk soil lettuce pot expreiment )2021-04-07v3No1 / 347
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized albic luvisol Germany (common pot expreiment, lettuce, soil, rhizosphere, germany, thyrow, albic luvisol, mineral fertilization, npk fertilization)2021-04-08v3No1 / 353
583amnoncommon soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, ph 4.5-7, canton of graubunden2020-01-27v3No1 / 359
829sheryoCommon in soil depth of 56-116cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 56-116cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 491
842sheryoCommon in soil depth of 15-30cm in an old growth forest in Ontario, Canada (common depth 15-30cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 507
829sheryoCommon in soil depth of 116-140cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 116-140cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 516
762sheryocommin in bulk soil of a pot experiment with lettuce planted in npk fertilzed albic luvisol from Germany (common mineral fertilization, npk fertilization, germany, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v3No1 / 531
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
762sheryoHigh in bulk soil compared to rhizosphere of a pot experiment with lettuce planted in albic luvisol Germany ( high in bulk soil compared to rhizosphere in thyrow albic luvisol germany haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 578
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 4-4.5, park, london, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 623
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (common npk fertilization, mineral fertilization, ph 5.6, therwil, switzerland, haplic luvisol, soil, bulk soil, lettuce, pot expreiment)2021-04-07v3No1 / 648
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
829sheryohigher soil depth of 12-44cm compared to 0-12cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 12-44cm compared to depth 0-12cm in sandy loam sandy loam soil hapludalf alfisol united states of america soil state of illinois illinois dekalb county )2021-08-26v3No1 / 692
754sheryoCommon in soil planted with cucmber, fertilized with bioorganic fertilizer (Bacillus amyloliquefaciens SQR 9) and infected with Fusarium oxysporum f. sp. cucumerinum (common bacillus amyloliquefaciens sqr9, zhejiang province, cucumber, fusarium oxysporum, bio-organic fertilizer, soil, china)2021-03-15v3No1 / 701
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol from Germany (common manured soil, manure fertilization, germany, organic fertilization, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v3No1 / 704
809amnoncommon lu'an city prefecture, flowerpot, research facility, greenhouse, dendrobium officinale, rhizosphere, china2021-06-20v4No1 / 715
829sheryoCommon in soil depth of 12-44m in Alfisol soil, Dekalb, Illinois, united states of america (common depth 12-44cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 721
752sheryoCommon in soil planted with Panax notoginseng (common panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 730
761sheryoCommon in maize rhizosphere sandy soil maize field in Germany (common zea mays, rhizosphere, ph 5, lower saxony, sandy soil, germany, maize field)2021-04-06v3No1 / 742
829sheryoCommon in soil depth of 44-108cm in Alfisol soil, Dekalb, Illinois, united states of america (common depth 44-108cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 751
709sheryoCommon in potting mix soil from the Netherlands, substraat arabidopsis, Lentse Potgrond (common substraat arabidopsis, lentse potgrond, soil, potting mix, kingdom of the netherlands)2028-05-16v4No1 / 752
829sheryoCommon in soil depth of 0-27cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 0-27cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 798
761sheryoCommon in bulk sandy soil maize field in Germany (common ph 5, lower saxony, sandy soil, germany, maize field, bulk soil)2021-04-06v3No1 / 835
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 5-6, disease, plant disease, acute oak decline, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 848
829sheryoCommon in soil depth of 108-140cm in Alfisol soil, Dekalb, Illinois, united states of america (common depth 108-140cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 871
829sheryoCommon in soil depth of 27-56cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 27-56cm, united states of america, soil, silt loam, mollisol, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 906
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
414amnon high in ph<6 npk fertilizer compared to ph>6 in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 963
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, root zone soil2017-04-15v4No1 / 968
628sheryocommon in bulk soil with barley plants after 180 days in treatments amended with biochar (common biochar, bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1023
768sheryoCommon in maize fields in Brittany, France (common zea mays, maize field, cambisol, bretagne region, french republic, soil)2021-04-18v3No1 / 1034
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, npk fertilizer, ph<6, china2018-11-26v4No1 / 1105
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, control, ph 6-7, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 1115
628sheryocommon in bulk soil with barley plants after 180 days in treatments unamended with biochar (common bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1136
628sheryocommon in rhizosphere of barley roots after 180 days in treatments amended with biochar (common mature barley plants, days 180, rhizosphere, hordeum vulgare, biochar, ph 4-5, depth (soil) 15cm, china, quzhou county, zhejiang province, soil)2020-05-18v4No1 / 1192
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
628sheryocommon in rhizosphere of barley roots after 180 days in treatments unamended with biochar (common china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, rhizosphere, days 180, mature barley plants)2020-05-18v4No1 / 1209
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
821sheryoHigher at 0-10cm depth compared to 10-25cm depth in soil in Michigan USA ( high in depth (soil) 0-10cm compared to depth (soil) 10-25cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 1383
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
271amnoncommon depth (soil) 0-20cm, rhizosphere, glycine max, soybean, china2018-01-09v4No1 / 1459
901amnon high in sediment surface depth (sediment) 0cm compared to depth (sediment) 0-20cm in taihu lake depth (water) 20-100cm taihu national park china lake sediment 2022-04-25v4No1 / 1819
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>4, ph<5, china2018-02-11v4No1 / 1886
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>7, ph<8, china2018-02-11v4No1 / 2160
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>6, ph<7, china2018-02-11v4No1 / 2223
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>8, china2018-02-11v4No1 / 2646
271amnoncommon depth (soil) 0-20cm, soil, china2018-01-09v4No1 / 2856
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>5, ph<6, china2018-02-11v4No1 / 3508
271amnon high in soil compared to rhizosphere glycine max soybean in depth (soil) 0-20cm china 2018-01-09v4No1 / 4853
100amnon high in ph ph<6 compared to ph>6 in soil urban biome park new york city central park 2017-04-03v4No1 / 5770
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org