Search result for sequence:
TACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCCGGCAGGCCGGGGGTCGAAGCGGGGGGCTCAACCCCCCGAAGCCCCCGGAACCTCCGCGGCTTGGGTCCGGTAGGGGAGGGTGGAACACCCGG
common ontology terms
term enrichment score
TermScore
homo sapiens0.614090
feces0.541086
adult0.345946
child0.253958
united states of america0.242744
obsolete_juvenile stage0.138211
china0.135613
control0.124175
infant0.119726
india0.097691
rural community0.096746
city0.090473
jiangsu province0.079365
state of colorado0.069364
monkey0.065574
colombia0.063420
italy0.059490
homosexual0.054545
msm0.054545
age 5-13 years0.054299
zoological garden0.052632
LOWER IN crohn's disease0.045249
zambia0.045045
africa0.045045
chuquisaca department0.045045
sus scrofa0.044793
pig0.044793
state of tennessee0.044543
age < 3 years0.044053
kingdom of spain0.043732
age0.043290
female0.043165
bolivia0.043103
skin0.039422
small village0.036810
hunter gatherer0.036810
wild0.036765
gay0.036697
biopsy0.036585
thailand0.036364
age 130.036364
denver0.036364
age 30-500.036364
age 8-120.036364
high bmi0.035928
rectum0.035714
juvenile organism0.035088
canis lupus familiaris0.034483
caecum0.033149
male0.027907
metabolic syndrome0.027714
nigeria0.027714
papio ursinus0.027523
sudan0.027523
karen0.027523
myanmar0.027523
papio kindae0.027523
age 2-4 years0.027523
bangladesh0.027523
glasgow0.027523
age 13-140.027523
age 3-60.027523
biopsy site0.027523
madagascar0.027523
antananarivo0.027523
age 60-790.027523
wastewater treatment plant0.027523
age < 1 year0.027335
cat0.027335
kingdom of denmark0.027149
duodenum0.027149
finland0.026966
felis catus0.026966
LOWER IN mouth0.026966
russia0.026786
kingdom of norway0.026786
united kingdom0.026608
dog0.026258
river0.026087
australia0.025586
colon0.024948
LOWER IN control0.023881
canada0.018692
LOWER IN diabetes mellitus0.018605
age > 1 year0.018605
state of oklahoma0.018605
heterosexual0.018605
msw0.018605
amerindian0.018605
venezuela0.018605
state of texas0.018605
daycare0.018519
age 1-5 years0.018519
grayfoot chacma baboon0.018519
kinda baboon0.018519
toronto0.018519
metabolic syndrome x0.018519
estonia0.018519
LOWER IN age < 1 year0.018519
gallbladder0.018519
Fraction of dbbact annotations with this term covered by the query
TermScore
male1.000000
canada1.000000
india0.833333
colombia0.800000
homosexual0.750000
msm0.750000
small village0.750000
hunter gatherer0.750000
rural community0.714286
LOWER IN diabetes mellitus0.666667
gay0.666667
metabolic syndrome0.666667
age > 1 year0.666667
state of oklahoma0.666667
nigeria0.666667
age 5-13 years0.666667
heterosexual0.666667
msw0.666667
amerindian0.666667
venezuela0.666667
state of texas0.666667
biopsy0.600000
LOWER IN crohn's disease0.555556
child0.550000
vellore district0.500000
daycare0.500000
age 1-5 years0.500000
trichuriasis0.500000
zambia0.500000
papio ursinus0.500000
grayfoot chacma baboon0.500000
LOWER IN age 1-3 years0.500000
obsolete_juvenile stage0.500000
sudan0.500000
LOWER IN type i diabetes mellitus0.500000
thailand0.500000
karen0.500000
myanmar0.500000
papio kindae0.500000
kinda baboon0.500000
age 2-4 years0.500000
bangladesh0.500000
age 130.500000
age one week0.500000
denver0.500000
toronto0.500000
glasgow0.500000
metabolic syndrome x0.500000
estonia0.500000
age 30-500.500000
age 8-120.500000
age 13-140.500000
age 3-60.500000
endospore enriched fraction0.500000
lysis0.500000
new york county0.500000
LOWER IN chronic fatigue syndrome0.500000
LOWER IN age < 1 year0.500000
biopsy site0.500000
gallbladder0.500000
bile0.500000
hmong 2nd generation0.500000
hmong0.500000
LOWER IN cron diet0.500000
schizophrenia0.500000
native american0.500000
arapaho0.500000
cheyenne0.500000
jordan0.500000
africa0.500000
madagascar0.500000
antananarivo0.500000
commonwealth of pennsylvania0.500000
age 17-290.500000
central african republic0.500000
bangui0.500000
quito0.500000
city of melbourne0.500000
nanchang city prefecture0.500000
age 30 days0.500000
dairy0.500000
azerbaijan0.500000
age 19-240.500000
rectal swab0.500000
LOWER IN central african republic0.500000
LOWER IN bangui0.500000
LOWER IN inflammatory bowel disease0.500000
lima0.500000
shantytown0.500000
age 60-790.500000
chuquisaca department0.500000
left colon0.500000
age >940.500000
forearm0.500000
oslo0.500000
age 30-400.500000
cron diet0.500000
kebbi state0.500000
age 10-15 years0.500000
urinary schistosomiasis0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.853774
homo sapiens0.820755
united states of america0.311321
adult0.301887
child0.165094
china0.146226
control0.108491
obsolete_juvenile stage0.080189
infant0.070755
city0.051887
india0.051887
rural community0.051887
jiangsu province0.047170
monkey0.037736
state of colorado0.037736
colombia0.033019
italy0.033019
female0.028302
homosexual0.028302
msm0.028302
age 5-13 years0.028302
zoological garden0.028302
zambia0.023585
wild0.023585
age0.023585
age < 3 years0.023585
kingdom of spain0.023585
africa0.023585
LOWER IN crohn's disease0.023585
bolivia0.023585
chuquisaca department0.023585
skin0.023585
state of tennessee0.023585
sus scrofa0.023585
pig0.023585
LOWER IN control0.018868
thailand0.018868
age 130.018868
juvenile organism0.018868
denver0.018868
gay0.018868
canis lupus familiaris0.018868
high bmi0.018868
small village0.018868
age 30-500.018868
age 8-120.018868
biopsy0.018868
caecum0.018868
rectum0.018868
hunter gatherer0.018868
papio ursinus0.014151
age < 1 year0.014151
sudan0.014151
karen0.014151
myanmar0.014151
papio kindae0.014151
age 2-4 years0.014151
bangladesh0.014151
finland0.014151
kingdom of denmark0.014151
dog0.014151
glasgow0.014151
russia0.014151
metabolic syndrome0.014151
felis catus0.014151
cat0.014151
age 13-140.014151
age 3-60.014151
biopsy site0.014151
LOWER IN mouth0.014151
nigeria0.014151
madagascar0.014151
antananarivo0.014151
australia0.014151
colon0.014151
male0.014151
duodenum0.014151
age 60-790.014151
kingdom of norway0.014151
united kingdom0.014151
river0.014151
wastewater treatment plant0.014151
medellin metropolitan area0.009434
daycare0.009434
age 1-5 years0.009434
grayfoot chacma baboon0.009434
LOWER IN diabetes mellitus0.009434
kinda baboon0.009434
egypt0.009434
obesity0.009434
czech republic0.009434
toronto0.009434
germany0.009434
metabolic syndrome x0.009434
estonia0.009434
LOWER IN low bmi0.009434
age > 1 year0.009434
LOWER IN age < 1 year0.009434
gallbladder0.009434
bile0.009434
Exp. ID User ID Description Date Region Flag Sequences
332amnonhigher in infants treated with Lactobacillus rhamnosus GG probiotics compared to non-treated ( high in probiotics compared to control in homo sapiens infant vellore district city age 2 months india )2018-05-14v4No1 / 5
482amnonhigher in kids with parasitic worms compared to non-infected kids ( high in trichuriasis compared to control in homo sapiens feces colombia medellin metropolitan area child daycare age 1-5 years )2019-02-12v4No1 / 6
411amnonhighfreq zambia, feces, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 10
241amnonhigher in babies age <1 year compared to age 1-3 years ( high in age < 1 year age compared to age 1-3 years in homo sapiens feces infant )2017-11-13v4No1 / 13
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces child obsolete_juvenile stage sudan 2018-08-30v4No1 / 14
400amnonhigh freq. in karen (burma) females from thailand (highfreq homo sapiens, feces, adult, female, thailand, karen, myanmar)2018-11-18v4No1 / 14
339amnonhighfreq homo sapiens, feces, infant, age < 1 year, india2018-05-24v4No1 / 15
411amnonhighfreq zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 16
339amnonhighfreq homo sapiens, feces, adult, india2018-05-24v4No1 / 18
564amnonhighfreq control, feces, italy, age 2-4 years, child, homo sapiens2019-11-18v3No1 / 18
62amnonhighfreq homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 19
121amnonhighfreq homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 19
339amnoncommon homo sapiens, feces, infant, age < 1 year, india2018-05-24v4No1 / 19
404amnonhighfreq homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 19
197amnonhighfreq feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 20
238amnonhighfreq homo sapiens, feces, colombia2017-11-07v4No1 / 20
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v4No1 / 20
344amnonhigh freq. in feces of homosexual males (highfreq homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 20
399amnonhighfreq feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 20
247amnonhighfreq homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 21
290amnon high in rural community small village compared to city in homo sapiens feces adult china 2018-02-01v4No1 / 21
409amnonhighfreq homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 21
552amnonhighfreq feces, homo sapiens, czech republic2019-09-05v3No1 / 22
10amnonhighfreq homo sapiens, feces, toronto2016-10-27v4No1 / 23
73amnonhighfreq homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 23
197amnonhighfreq feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 23
241amnonhigh freq. in babies age < 3 years in russia (highfreq homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 23
303amnonhighfreq homo sapiens, feces, germany, adult2018-03-12v4No1 / 23
487amnonhighfreq homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 23
566amnonhighfreq adult, homo sapiens, china, feces2019-11-24v4No1 / 24
239amnonhighfreq homo sapiens, feces, united states of america2017-11-08v4No1 / 24
241amnoncommon in babies age < 3 years in estonia (common homo sapiens, feces, infant, age < 3 years, estonia)2017-11-13v4No1 / 24
365amnonhighfreq homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 24
436amnonhighfreq felis catus, cat, feces, united states of america, state of colorado2018-12-25v4No1 / 25
62amnonhighfreq homo sapiens, feces, obsolete_juvenile stage, child, united states of america2017-02-13v4No1 / 26
438amnonhighfreq feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 26
438amnonhighfreq homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 27
293amnonlower in lean participants in human feces ( high in high bmi compared to low bmi in united states of america feces adult homo sapiens )2018-02-07v4No1 / 29
438amnonhighfreq homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 29
320amnoncommon homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 30
438amnonhighfreq homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 30
45amnoncommon in feces babies age 0-2 in india (common homo sapiens, feces, infant, india)2016-12-19v4No1 / 31
401amnonhigher in endospore enriched (lysis resistant) replicates ( high in endospore enriched fraction lysis compared to control in homo sapiens feces united states of america adult )2018-11-18v4No1 / 31
12amnon high in control compared to chronic fatigue syndrome in homo sapiens feces new york county 2016-11-02v4No1 / 35
233amnon high in age age > 1 year compared to age < 1 year in feces homo sapiens infant united states of america 2017-11-05v4No1 / 37
51amnoncommon homo sapiens, biopsy site, biopsy, united states of america2017-01-19v4No1 / 38
526amnoncommon in bile of healthy controls (common homo sapiens, gallbladder, bile, adult, kingdom of spain, control)2019-07-14v3No1 / 39
400amnonhigher in children of hmong migrands born in the usa compared to non-migrant usa people ( high in hmong 2nd generation hmong compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 41
51amnoncommon feces, homo sapiens, united states of america2017-01-19v4No1 / 42
564amnoncommon autistic disorder, feces, italy, age 2-4 years, child, homo sapiens2019-11-18v3No1 / 42
241amnoncommon in babies age < 3 years in russia (common homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 44
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 44
482amnoncommon homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, age 1-5 years2019-02-12v4No1 / 47
121amnoncommon homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 50
564amnoncommon control, feces, italy, age 2-4 years, child, homo sapiens2019-11-18v3No1 / 50
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
26amnon high in pair of nares mucus compared to saliva mouth in canis lupus familiaris united states of america 2016-12-05v4No1 / 57
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in american diet diet compared to cron diet caloric restriction diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 61
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 63
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 66
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
425amnoncommon homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 73
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 77
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 79
339amnoncommon homo sapiens, feces, adult, india2018-05-24v4No1 / 81
562amnoncommon age 5-13 years, child, ecuador, quito, feces2019-11-05v4No1 / 82
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 85
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
340amnoncommon feces, felis catus, cat, city of melbourne, australia2018-05-27v4No1 / 87
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 94
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
363amnon high in caecum colon rectum compared to rumen ruminant reticulum omasum in ovis aries age 30 days obsolete_juvenile stage italy dairy 2018-08-29v4No1 / 101
438amnoncommon homo sapiens, feces, age 19-24, china2018-12-30v4No1 / 101
563amnoncommon control, homosexual, msm, male, united states of america, rectal swab, feces, homo sapiens2019-11-18v4No1 / 103
425amnon high in antananarivo madagascar compared to central african republic bangui in homo sapiens africa child duodenum 2018-12-08v4No1 / 103
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
399amnoncommon feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 108
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
436amnoncommon felis catus, cat, feces, united states of america, state of colorado2018-12-25v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
563amnoncommon hiv infection, homosexual, msm, male, united states of america, rectal swab, feces, homo sapiens2019-11-18v4No1 / 111
438amnoncommon feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 111
517amnoncommon feces, homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department2019-05-29v4No1 / 113
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 121
344amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to heterosexual msw in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 124
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 125
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to biopsy rectum biopsy site in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 126
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens united states of america feces )2017-04-11v4No1 / 139
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 146
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
411amnon high in wild papio kindae papio ursinus compared to zoological garden papio anubis in zambia feces monkey baboon papio 2018-11-23v4No1 / 151
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
273amnon high in age age one month compared to age one year in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 168
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
411amnoncommon zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 200
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
150amnoncommon canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon adult, homo sapiens, china, feces2019-11-24v4No1 / 221
411amnoncommon zambia, feces, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 224
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 237
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 279
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
208amnoncommon mus musculus, mouse, feces, united states of america, state of texas, balb/c2017-10-06v4No1 / 316
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
175amnonhigher in winter compared to summer in heavy metal contaminated soils in china ( high in winter compared to summer in soil heavy metal china )2017-07-29v4No1 / 337
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
565amnoncommon african lion safari, captive, zoological garden, red kangaroo, macropus rufus, canada, skin2019-11-21v3No1 / 360
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
424amnoncommon sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 452
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
160amnoncommon in wastewater treatment plant effluent in autumn in china (common autumn, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 469
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
160amnoncommon in wastewater treatment plant effluent in spring in china (common wastewater treatment plant, effluent, spring, china)2017-07-12v4No1 / 573
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin australia foot )2017-11-05v4No1 / 708
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181

Problems / suggestions? Please email info AT dbbact DOT org