Search result for sequence:
TACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCCGGCAGGCCGGGGGTCGAAGCGGGGGGCTCAACCCCCCGAAGCCCCCGGAACCTCCGCGGCTTGGGTCCGGTAGGGGAGGGTGGAACACCCGG
common ontology terms
term enrichment score
TermScore
homo sapiens0.615436
feces0.609428
adult0.432561
united states of america0.233945
child0.202080
infant0.153667
control0.127119
china0.111752
female0.104511
germany0.085189
monkey0.082759
obsolete_juvenile stage0.080189
obesity0.076660
rural community0.073394
macaca mulatta0.071429
zoological garden0.070175
kingdom of spain0.069307
india0.063830
msm0.059347
homosexual0.059347
italy0.057026
city0.056795
israel0.052402
male0.050000
sweden0.047671
formula fed0.047619
captive0.044776
taiwan0.044776
pregnancy0.043732
high bmi0.043541
jiangsu province0.042553
research facility0.041487
gay0.039933
republic of china0.039801
cat0.039604
municipality of yogyakarta0.039409
indonesia0.039409
felis catus0.039216
russia0.038898
state of colorado0.038647
pig0.038499
sus scrofa0.038499
msw0.035110
heterosexual0.035110
colombia0.034956
age 30-500.034956
indian rhesus macaque0.034653
cayo santiago0.034653
rhesus macaque0.034653
age < 1 year0.034454
state of new york0.033871
age 3 months0.033776
puerto rico0.033493
caecum0.031146
estonia0.030075
age 5-13 years0.030075
breast fed0.029851
rectal swab0.029630
wild0.029536
hiv infection0.029268
amsterdam0.028986
south korea0.028846
kingdom of the netherlands0.028169
nigeria0.025210
age 2-4 years0.025157
zambia0.025000
age 4-10 years0.025000
chuquisaca department0.025000
LOWER IN crohn&#39;s disease0.024938
age 1 month0.024845
state of tennessee0.024845
age < 3 years0.024691
food allergy0.024691
age 2 years0.024390
africa0.024390
bolivia0.024390
age0.024331
canis lupus familiaris0.023669
canada0.023529
state of california0.023256
skin0.022472
LOWER IN control0.021429
small village0.020236
age > 1 year0.020236
hunter gatherer0.020236
overweight body mass index status0.020202
age 130.020101
denver0.020101
age 8-120.020101
tanzania0.020101
biopsy0.020033
age 50-80 years0.020000
kingdom of denmark0.019967
rectum0.019835
male organism0.019704
age 1 year0.019512
thailand0.019324
juvenile organism0.019324
dog0.019078
metabolic syndrome0.015209
Fraction of dbbact annotations with this term covered by the query
TermScore
msm0.833333
homosexual0.833333
msw0.800000
heterosexual0.800000
rural community0.800000
gay0.750000
india0.750000
small village0.750000
taiwan0.750000
nigeria0.750000
age > 1 year0.750000
hunter gatherer0.750000
colombia0.666667
LOWER IN diabetes mellitus0.666667
age 2-4 years0.666667
estonia0.666667
republic of china0.666667
age 30-500.666667
metabolic syndrome0.666667
overweight body mass index status0.666667
age 19-240.666667
state of oklahoma0.666667
age 5-13 years0.666667
village0.666667
amerindian0.666667
venezuela0.666667
LOWER IN pan troglodytes troglodytes0.666667
parkinson's disease0.600000
obesity0.583333
cat0.571429
bifidobacterium longum probiotic0.500000
novosibirsk0.500000
vellore district0.500000
daycare0.500000
age 1-5 years0.500000
trichuriasis0.500000
zambia0.500000
papio ursinus0.500000
grayfoot chacma baboon0.500000
obsolete_juvenile stage0.500000
sudan0.500000
karen0.500000
myanmar0.500000
indian rhesus macaque0.500000
macaca mulatta0.500000
cayo santiago0.500000
municipality of yogyakarta0.500000
indonesia0.500000
breast fed0.500000
papio kindae0.500000
kinda baboon0.500000
age 1-18 years0.500000
sri lanka0.500000
bihar state0.500000
LOWER IN visceral leishmaniasis0.500000
bangladesh0.500000
gestational age 8-12 weeks0.500000
chengdu city prefecture0.500000
santa catarina state0.500000
age 130.500000
age one week0.500000
denver0.500000
age 0-6 months0.500000
age 7 months0.500000
omnivore diet0.500000
before hsct0.500000
systemic lupus erythematosus0.500000
glasgow0.500000
metabolic syndrome x0.500000
age 9-17 years0.500000
teenager0.500000
peru0.500000
ibadan0.500000
coronary heart disease0.500000
midwest region0.500000
third trimester0.500000
gaz:000521000.500000
LOWER IN weight loss0.500000
LOWER IN weight loss diet0.500000
breast milk material0.500000
graves' disease0.500000
taoyuan city0.500000
cornell university0.500000
age 8-120.500000
acute severe colitis0.500000
milk allergy0.500000
age 4-10 years0.500000
age 13-140.500000
age 3-60.500000
sesame allergy0.500000
endospore enriched fraction0.500000
lysis0.500000
new york county0.500000
LOWER IN chronic fatigue syndrome0.500000
biopsy site0.500000
gallbladder0.500000
bile0.500000
hmong 2nd generation0.500000
hmong0.500000
autoimmune hepatitis0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.894872
homo sapiens0.805128
adult0.415385
united states of america0.261538
child0.130769
china0.107692
control0.100000
infant0.092308
female0.069231
germany0.056410
monkey0.046154
obsolete_juvenile stage0.043590
obesity0.041026
research facility0.041026
kingdom of spain0.038462
macaca mulatta0.038462
rural community0.038462
zoological garden0.038462
male0.033333
india0.033333
msm0.030769
homosexual0.030769
city0.030769
italy0.030769
israel0.030769
sweden0.028205
formula fed0.025641
jiangsu province0.025641
captive0.025641
high bmi0.023077
pregnancy0.023077
taiwan0.023077
gay0.020513
russia0.020513
municipality of yogyakarta0.020513
indonesia0.020513
state of colorado0.020513
republic of china0.020513
felis catus0.020513
cat0.020513
pig0.020513
sus scrofa0.020513
colombia0.017949
wild0.017949
age < 1 year0.017949
indian rhesus macaque0.017949
cayo santiago0.017949
puerto rico0.017949
age 3 months0.017949
msw0.017949
heterosexual0.017949
age 30-500.017949
state of new york0.017949
rhesus macaque0.017949
caecum0.017949
hiv infection0.015385
LOWER IN control0.015385
rectal swab0.015385
breast fed0.015385
estonia0.015385
amsterdam0.015385
kingdom of the netherlands0.015385
south korea0.015385
age 5-13 years0.015385
zambia0.012821
age0.012821
age 2-4 years0.012821
age 2 years0.012821
age 1 month0.012821
canis lupus familiaris0.012821
age < 3 years0.012821
nigeria0.012821
food allergy0.012821
age 4-10 years0.012821
state of california0.012821
africa0.012821
canada0.012821
LOWER IN crohn&#39;s disease0.012821
bolivia0.012821
chuquisaca department0.012821
skin0.012821
state of tennessee0.012821
age 1 year0.010256
thailand0.010256
age 130.010256
juvenile organism0.010256
kingdom of denmark0.010256
denver0.010256
dog0.010256
small village0.010256
overweight body mass index status0.010256
age 8-120.010256
biopsy0.010256
age > 1 year0.010256
age 50-80 years0.010256
tanzania0.010256
rectum0.010256
male organism0.010256
hunter gatherer0.010256
novosibirsk0.007692
Exp. ID User ID Description Date Region Flag Sequences
578amnon high in hiv infection compared to control in homo sapiens feces adult male msm gay homosexual kingdom of spain sweden 2020-01-14v3No1 / 1
680amnon high in bifidobacterium longum probiotic probiotic compared to control in obesity adult novosibirsk russia feces homo sapiens 2028-03-04v3No1 / 1
332amnonhigher in infants treated with Lactobacillus rhamnosus GG probiotics compared to non-treated ( high in probiotics compared to control in homo sapiens infant vellore district city age 2 months india )2018-05-14v4No1 / 5
482amnonhigher in kids with parasitic worms compared to non-infected kids ( high in trichuriasis compared to control in homo sapiens feces colombia medellin metropolitan area child daycare age 1-5 years )2019-02-12v4No1 / 6
411amnondominant zambia, feces, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 10
797amnon high in formula fed compared to breast fed in age 1 year germany infant feces homo sapiens 2021-06-13v3No1 / 10
669amnoncommon age 2 months, sweden, infant, feces, homo sapiens2020-09-26v4No1 / 12
241amnonhigher in babies age <1 year compared to age 1-3 years ( high in age < 1 year age compared to age 1-3 years in homo sapiens feces infant )2017-11-13v4No1 / 13
669amnondominant age 2 months, sweden, infant, feces, homo sapiens2020-09-26v4No1 / 13
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces child obsolete_juvenile stage sudan 2018-08-30v4No1 / 14
400amnonhigh freq. in karen (burma) females from thailand (dominant homo sapiens, feces, adult, female, thailand, karen, myanmar)2018-11-18v4No1 / 14
339amnondominant homo sapiens, feces, infant, age < 1 year, india2018-05-24v4No1 / 15
770amnondominant age < 1 year, infant, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 15
723amnoncommon municipality of yogyakarta, vagina, adult, female, indonesia, homo sapiens2021-01-02v3No1 / 15
797amnoncommon breast fed, age 3 months, infant, germany, homo sapiens, feces2021-06-13v3No1 / 15
797amnondominant breast fed, age 3 months, infant, germany, homo sapiens, feces2021-06-13v3No1 / 15
411amnondominant zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 16
656amnondominant age 1-18 years, sri lanka, feces, homo sapiens2020-09-13v3No1 / 16
680amnondominant obesity, adult, novosibirsk, russia, feces, homo sapiens2028-03-04v3No1 / 16
723amnondominant feces, municipality of yogyakarta, adult, female, indonesia, homo sapiens2021-01-02v3No1 / 16
570amnon high in control compared to visceral leishmaniasis in homo sapiens feces india bihar state 2019-12-16v3No1 / 17
797amnoncommon formula fed, age 3 months, infant, germany, homo sapiens, feces2021-06-13v3No1 / 17
339amnondominant homo sapiens, feces, adult, india2018-05-24v4No1 / 18
564amnondominant homo sapiens, child, age 2-4 years, italy, feces, control2019-11-18v3No1 / 18
799amnonhigher before ketogenic diet compared to after ketogenic diet in obese participants ( high in control diet compared to ketogenic diet in obesity high bmi adult estonia feces homo sapiens )2021-06-13v3No1 / 18
799amnondominant in obese participant fecal samples before ketogenic diet (dominant obesity, high bmi, adult, estonia, feces, homo sapiens)2021-06-13v3No1 / 18
831amnondominant israel, adult, feces, homo sapiens, control2021-09-11v3No1 / 18
62amnondominant homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 19
121amnondominant homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 19
339amnoncommon homo sapiens, feces, infant, age < 1 year, india2018-05-24v4No1 / 19
404amnondominant homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 19
574amnondominant feces, homo sapiens, russia, adult2020-01-05v3No1 / 19
637amnondominant gestational age 8-12 weeks, chengdu city prefecture, china, adult, pregnancy, female, feces, homo sapiens2020-08-18v3No1 / 19
757amnondominant feces, adult, santa catarina state, brazil, homo sapiens2021-03-28v3No1 / 19
797amnondominant breast fed, age 2 years, child, germany, homo sapiens, feces2021-06-13v3No1 / 19
797amnondominant formula fed, age 1 month, infant, germany, homo sapiens, feces2021-06-13v3No1 / 19
197amnondominant feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 20
238amnondominant homo sapiens, feces, colombia2017-11-07v4No1 / 20
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v4No1 / 20
344amnonhigh freq. in feces of homosexual males (dominant homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 20
399amnondominant feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 20
629amnondominant amsterdam, kingdom of the netherlands, adult, homosexual, msm, feces, homo sapiens2020-05-31v4No1 / 20
629amnondominant msw, heterosexual, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 20
723amnoncommon infant, homo sapiens, indonesia, municipality of yogyakarta, feces, child, age 0-6 months2021-01-02v3No1 / 20
797amnondominant age 7 months, formula fed, infant, germany, homo sapiens, feces2021-06-13v3No1 / 20
797amnondominant formula fed, age 3 months, infant, germany, homo sapiens, feces2021-06-13v3No1 / 20
797amnondominant breast fed, age 1 month, infant, germany, homo sapiens, feces2021-06-13v3No1 / 20
247amnondominant homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 21
290amnon high in rural community small village compared to city in homo sapiens feces adult china 2018-02-01v4No1 / 21
409amnondominant homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 21
734amnondominant omnivore diet, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 21
629amnondominant female, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 22
552amnondominant feces, homo sapiens, czech republic2019-09-05v3No1 / 22
655amnondominant in patients before hematopoietic stem cell transplant (dominant before hsct, italy, feces, homo sapiens)2020-09-13v3No1 / 22
707amnondominant systemic lupus erythematosus, guangzhou city prefecture, age 30-50, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 22
797amnondominant age 2 years, child, formula fed, germany, homo sapiens, feces2021-06-13v3No1 / 22
10amnondominant homo sapiens, feces, toronto2016-10-27v4No1 / 23
73amnondominant homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 23
197amnondominant feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 23
241amnonhigh freq. in babies age < 3 years in russia (dominant homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 23
303amnondominant homo sapiens, feces, germany, adult2018-03-12v4No1 / 23
487amnondominant homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 23
669amnondominant age 1 year, sweden, infant, feces, homo sapiens2020-09-26v4No1 / 23
830amnondominant homo sapiens, feces, age 9-17 years, teenager, peru2021-09-10v4No1 / 23
832amnondominant homo sapiens, feces, adult, ibadan, nigeria2021-09-11v4No1 / 23
734amnondominant coronary heart disease, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 23
797amnoncommon age 7 months, formula fed, infant, germany, homo sapiens, feces2021-06-13v3No1 / 23
239amnondominant homo sapiens, feces, united states of america2017-11-08v4No1 / 24
241amnoncommon in babies age < 3 years in estonia (common homo sapiens, feces, infant, age < 3 years, estonia)2017-11-13v4No1 / 24
365amnondominant homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 24
566amnondominant feces, china, homo sapiens, adult2019-11-24v4No1 / 24
580amnondominant homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v4No1 / 24
643amnondominant adult, south korea, feces, homo sapiens2020-08-30v4No1 / 24
702amnondominant felis catus, cat, state of north carolina, united states of america, feces2028-04-02v4No1 / 24
723amnondominant age 2-4 years, homo sapiens, indonesia, municipality of yogyakarta, feces, child2021-01-02v3No1 / 24
745amnondominant adult, midwest region, united states of america, feces, homo sapiens2021-02-25v3No1 / 24
436amnondominant felis catus, cat, feces, united states of america, state of colorado2018-12-25v4No1 / 25
580amnondominant homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v4No1 / 25
721amnondominant obesity, overweight body mass index status, adult, scotland, gaz:00052100, feces, homo sapiens2028-05-23v4No1 / 25
721amnon high in high fiber fiber diet compared to high protein diet weight loss weight loss diet in obesity overweight body mass index status adult scotland gaz:00052100 feces homo sapiens 2028-05-23v4No1 / 25
723amnoncommon adult, female, breast milk material, breast milk, homo sapiens, indonesia, municipality of yogyakarta2021-01-02v3No1 / 25
796amnondominant graves' disease, taoyuan city, republic of china, taiwan, adult, feces, homo sapiens2021-06-10v3No1 / 25
797amnondominant formula fed, age 1 year, infant, germany, homo sapiens, feces2021-06-13v3No1 / 25
62amnondominant homo sapiens, feces, obsolete_juvenile stage, child, united states of america2017-02-13v4No1 / 26
438amnondominant feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 26
802amnondominant feces, cornell university, state of new york, united states of america, adult, homo sapiens2021-06-16v4No1 / 26
578amnondominant homo sapiens, feces, adult, male, kingdom of spain, sweden, control, msw, heterosexual2020-01-14v3No1 / 26
723amnondominant infant, homo sapiens, indonesia, municipality of yogyakarta, feces, child, age 0-6 months2021-01-02v3No1 / 26
438amnondominant homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 27
659amnoncommon ulcerative colitis, acute severe colitis, homo sapiens, child, feces2020-09-19v4No1 / 27
695amnondominant milk allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v4No1 / 27
797amnon high in age 3 months compared to age 1 month in breast fed germany infant homo sapiens feces 2021-06-13v3No1 / 27
293amnonlower in lean participants in human feces ( high in high bmi compared to low bmi in united states of america feces adult homo sapiens )2018-02-07v4No1 / 29
438amnondominant homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 29
668amnondominant new zealand, research facility, feces, felis catus, cat2020-09-26v3No1 / 29
320amnoncommon homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 30
438amnondominant homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 30
695amnondominant sesame allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v4No1 / 30
723amnoncommon age 2-4 years, homo sapiens, indonesia, municipality of yogyakarta, feces, child2021-01-02v3No1 / 30
45amnoncommon in feces babies age 0-2 in india (common homo sapiens, feces, infant, india)2016-12-19v4No1 / 31
401amnonhigher in endospore enriched (lysis resistant) replicates ( high in endospore enriched fraction lysis compared to control in homo sapiens feces united states of america adult )2018-11-18v4No1 / 31
681amnondominant seoul, south korea, adult, homo sapiens, feces2028-03-04v3No1 / 31
12amnon high in control compared to chronic fatigue syndrome in homo sapiens feces new york county 2016-11-02v4No1 / 35
669amnoncommon age 1 year, sweden, infant, feces, homo sapiens2020-09-26v4No1 / 35
51amnoncommon homo sapiens, biopsy site, biopsy, united states of america2017-01-19v4No1 / 36
233amnon high in age age > 1 year compared to age < 1 year in feces homo sapiens infant united states of america 2017-11-05v4No1 / 37
681amnoncommon seoul, south korea, adult, homo sapiens, feces2028-03-04v3No1 / 37
526amnoncommon in bile of healthy controls (common homo sapiens, gallbladder, bile, adult, kingdom of spain, control)2019-07-14v3No1 / 39
835amnoncommon adult, japan, homo sapiens, feces2021-09-11v3No1 / 40
51amnoncommon feces, homo sapiens, united states of america2017-01-19v4No1 / 41
400amnonhigher in children of hmong migrands born in the usa compared to non-migrant usa people ( high in hmong 2nd generation hmong compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 41
564amnoncommon homo sapiens, child, age 2-4 years, italy, feces, autistic disorder2019-11-18v3No1 / 42
831amnoncommon pancreatic cancer, homo sapiens, feces, adult, israel2021-09-11v3No1 / 43
241amnoncommon in babies age < 3 years in russia (common homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 44
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 44
570amnoncommon homo sapiens, feces, india, bihar state2019-12-16v3No1 / 46
597amnoncommon homo sapiens, feces, adult, zhejiang province, china, control2020-03-23v3No1 / 46
797amnoncommon age 2 years, child, formula fed, germany, homo sapiens, feces2021-06-13v3No1 / 46
482amnoncommon homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, age 1-5 years2019-02-12v4No1 / 47
591amnoncommon homo sapiens, feces, adult, age 50-80 years, united states of america, parkinson's disease2020-02-17v4No1 / 47
830amnoncommon peru, teenager, age 9-17 years, feces, homo sapiens2021-09-10v4No1 / 47
720amnoncommon autoimmune hepatitis, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 48
651amnoncommon parkinson's disease, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 49
770amnon high in age < 1 year infant compared to age 10-15 years adult organism in mouth mucosa oral cavity indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v4No1 / 49
736amnoncommon age 1-3 years, child, tanzania, pemba island, feces, homo sapiens2021-01-25v3No1 / 49
121amnoncommon homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 50
564amnoncommon homo sapiens, child, age 2-4 years, italy, feces, control2019-11-18v3No1 / 50
797amnoncommon breast fed, age 2 years, child, germany, homo sapiens, feces2021-06-13v3No1 / 50
702amnoncommon felis catus, cat, state of north carolina, united states of america, feces2028-04-02v4No1 / 51
796amnoncommon control, taoyuan city, republic of china, taiwan, adult, feces, homo sapiens2021-06-10v3No1 / 51
650amnoncommon african american, state of new york, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 52
694amnoncommon china, shanghai district, obesity, adult, female, feces, homo sapiens2028-03-17v3No1 / 52
796amnoncommon graves' disease, taoyuan city, republic of china, taiwan, adult, feces, homo sapiens2021-06-10v3No1 / 52
578amnoncommon homo sapiens, feces, adult, male, kingdom of spain, sweden, msw, heterosexual, hiv infection2020-01-14v3No1 / 53
814amnoncommon high bmi, age 50-70 years, adult, obese body mass index status, overweight body mass index status, obesity, female, germany, homo sapiens, feces2021-06-30v4No1 / 55
578amnon high in sweden compared to kingdom of spain in homo sapiens feces hiv infection adult male msm gay homosexual 2020-01-14v3No1 / 55
707amnoncommon systemic lupus erythematosus, guangzhou city prefecture, age 30-50, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 55
745amnoncommon adult, midwest region, united states of america, feces, homo sapiens2021-02-25v3No1 / 55
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
591amnoncommon homo sapiens, feces, adult, age 50-80 years, united states of america, control2020-02-17v4No1 / 56
650amnoncommon state of new york, european, caucasian, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 56
26amnon high in pair of nares mucus compared to saliva mouth in canis lupus familiaris united states of america 2016-12-05v4No1 / 57
651amnoncommon control, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 58
666amnoncommon homo sapiens, italy, feces2020-09-25v3No1 / 58
734amnoncommon vegetarian diet, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 60
831amnoncommon control, homo sapiens, feces, adult, israel2021-09-11v3No1 / 60
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in american diet diet compared to cron diet caloric restriction diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 61
627amnoncommon feces, pregnancy, adult, female, china2020-05-16v3No1 / 61
637amnoncommon gestational age 8-12 weeks, chengdu city prefecture, china, adult, pregnancy, female, feces, homo sapiens2020-08-18v3No1 / 61
593amnoncommon homo sapiens, feces, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 62
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 63
575amnoncommon in professional martial arts athletes (common homo sapiens, feces, athlete, high physical activity, adult, china, age 19-24)2020-01-05v3No1 / 63
726amnoncommon tongue, dermal layer of tongue, adult, milan, italy, homo sapiens2021-01-03v3No1 / 63
671amnon high in age 1 month compared to age 3 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 64
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 66
650amnoncommon asian, state of new york, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 66
734amnoncommon coronary heart disease, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 66
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
757amnoncommon feces, adult, santa catarina state, brazil, homo sapiens2021-03-28v3No1 / 67
574amnoncommon feces, homo sapiens, russia, adult2020-01-05v3No1 / 68
593amnoncommon homo sapiens, feces, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
734amnoncommon omnivore diet, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 68
723amnoncommon feces, municipality of yogyakarta, adult, female, indonesia, homo sapiens2021-01-02v3No1 / 69
803amnoncommon type 2 diabetes mellitus, commonwealth of massachusetts, age 50-80 years, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v4No1 / 70
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
644amnoncommon adult, united states of america, hispanic or latin american, feces, homo sapiens2020-08-31v4No1 / 71
663amnoncommon obese body mass index status, obesity, switzerland, adult, feces, homo sapiens2020-09-22v4No1 / 71
656amnoncommon age 1-18 years, sri lanka, feces, homo sapiens2020-09-13v3No1 / 71
810amnoncommon in sea turtle feces from sea turtle rescue center (common adriatic sea coastal waters of italy, feces, mediterranean sea, research facility, italy, loggerhead sea turtle, caretta caretta)2021-06-22v3No1 / 72
425amnoncommon homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 73
832amnoncommon nigeria, ibadan, adult, feces, homo sapiens2021-09-11v4No1 / 74
578amnoncommon homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, hiv infection2020-01-14v3No1 / 74
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
794amnoncommon antiretroviral therapy, human immunodeficiency virus infectious disease, hiv infection, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v4No1 / 75
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 77
799amnoncommon in obese participant fecal samples before ketogenic diet (common obesity, high bmi, adult, estonia, feces, homo sapiens)2021-06-13v3No1 / 77
630amnoncommon madrid, kingdom of spain, feces, adult, homo sapiens2020-06-01v3No1 / 78
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 79
671amnon high in age 6 months age 3 months compared to age 8 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 79
732amnoncommon municipality of reus, kingdom of spain, adult, feces, homo sapiens2021-01-11v3No1 / 79
695amnoncommon sesame allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v4No1 / 80
339amnoncommon homo sapiens, feces, adult, india2018-05-24v4No1 / 81
643amnoncommon adult, south korea, feces, homo sapiens2020-08-30v4No1 / 81
671amnoncommon age 1 month, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 81
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
562amnoncommon feces, quito, ecuador, child, age 5-13 years2019-11-05v4No1 / 82
707amnoncommon guangzhou city prefecture, age 30-50, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 82
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 85
601amnoncommon homo sapiens, feces, china, adult, type 2 diabetes mellitus2020-03-30v4No1 / 85
663amnoncommon low bmi, switzerland, adult, feces, homo sapiens2020-09-22v4No1 / 85
668amnoncommon new zealand, research facility, feces, felis catus, cat2020-09-26v3No1 / 85
680amnoncommon obesity, adult, novosibirsk, russia, feces, homo sapiens2028-03-04v3No1 / 85
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
340amnoncommon feces, felis catus, cat, city of melbourne, australia2018-05-27v4No1 / 87
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
660amnonhigher in the cross cutcu population (more modern) comparen to upano valley (less modern) ( high in cross-cutucu compared to upano valley in shuar population village rural community ecuador feces homo sapiens )2020-09-20v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
629amnoncommon female, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 89
803amnoncommon control, commonwealth of massachusetts, age 50-80 years, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v4No1 / 89
666amnoncommon wild cat, felis silvestris, italy, feces2020-09-25v3No1 / 91
578amnoncommon homo sapiens, feces, adult, male, kingdom of spain, sweden, control, msw, heterosexual2020-01-14v3No1 / 92
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
601amnoncommon homo sapiens, feces, china, adult, control2020-03-30v4No1 / 93
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common ketogenic diet, high bmi, estonia, adult, obesity, homo sapiens, feces)2021-06-13v3No1 / 93
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 94
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
695amnoncommon milk allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v4No1 / 94
759amnoncommon state of new york, new york city, wild, feces, united states of america, rattus norvegicus, rat2021-04-06v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
736amnoncommon tanzania, pemba island, adult, female, feces, homo sapiens2021-01-25v3No1 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
759amnon high in wild new york city state of new york compared to research facility city of boston commonwealth of massachusetts in feces united states of america rattus norvegicus rat 2021-04-06v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
629amnoncommon msw, heterosexual, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 97
663amnoncommon poland, low bmi, adult, feces, homo sapiens2020-09-22v4No1 / 98
673amnoncommon caecum, ascending colon, salmonellosis, salmonella enterica subsp. enterica serovar typhimurium, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 99
702amnon high in felis catus cat compared to canis lupus familiaris dog in state of north carolina united states of america feces 2028-04-02v4No1 / 100
363amnon high in caecum colon rectum compared to rumen ruminant reticulum omasum in ovis aries age 30 days obsolete_juvenile stage italy dairy 2018-08-29v4No1 / 101
438amnoncommon homo sapiens, feces, age 19-24, china2018-12-30v4No1 / 101
425amnon high in antananarivo madagascar compared to central african republic bangui in homo sapiens africa child duodenum 2018-12-08v4No1 / 103
563amnoncommon homo sapiens, feces, rectal swab, united states of america, male, msm, homosexual, control2019-11-18v4No1 / 103
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v4No1 / 103
683amnoncommon state of california, united states of america, adult, feces, homo sapiens2028-03-04v4No1 / 105
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
695amnon high in milk allergy compared to sesame allergy in food allergy age 4-10 years child israel feces homo sapiens 2028-03-27v4No1 / 107
399amnoncommon feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 108
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
436amnoncommon felis catus, cat, feces, united states of america, state of colorado2018-12-25v4No1 / 108
802amnoncommon feces, cornell university, state of new york, united states of america, adult, homo sapiens2021-06-16v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
770amnoncommon male organism, penis, age > 1 year, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 110
438amnoncommon feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 111
563amnoncommon homo sapiens, feces, rectal swab, united states of america, male, msm, homosexual, hiv infection2019-11-18v4No1 / 111
770amnon high in age < 1 year infant compared to age 10-15 years adult organism in rectal swab feces indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v4No1 / 111
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v4No1 / 112
663amnoncommon poland, obese body mass index status, obesity, adult, feces, homo sapiens2020-09-22v4No1 / 112
517amnoncommon feces, homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department2019-05-29v4No1 / 113
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 121
660amnoncommon shuar population, village, rural community, ecuador, feces, homo sapiens2020-09-20v4No1 / 123
344amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to heterosexual msw in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 124
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 125
607amnoncommon germany, homo sapiens, feces, parkinson's disease2020-04-19v4No1 / 125
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to biopsy rectum biopsy site in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 126
607amnoncommon germany, homo sapiens, feces, control2020-04-19v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
721amnoncommon obesity, overweight body mass index status, adult, scotland, gaz:00052100, feces, homo sapiens2028-05-23v4No1 / 131
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
625amnoncommon emperor tamarin, saguinus imperator, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 132
578amnoncommon homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, control2020-01-14v3No1 / 132
794amnoncommon control, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v4No1 / 133
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
607amnoncommon germany, homo sapiens, feces, rem sleep behavior disorder2020-04-19v4No1 / 134
644amnonlower in individuals born in mexico compared to cuba ( high in cuba compared to mexico in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 134
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
594amnoncommon adult, cameroon, feces, homo sapiens, ngoantet, rural community2020-03-12v4No1 / 136
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens united states of america feces )2017-04-11v4No1 / 139
797amnon high in child age 2 years compared to infant age 1 year in formula fed germany homo sapiens feces 2021-06-13v3No1 / 139
629amnoncommon amsterdam, kingdom of the netherlands, adult, homosexual, msm, feces, homo sapiens2020-05-31v4No1 / 141
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 146
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 147
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
759amnon high in canis lupus familiaris dog compared to canis lupus wolf wildlife sactuary in state of minnesota united states of america feces 2021-04-06v4No1 / 148
411amnon high in wild papio kindae papio ursinus compared to zoological garden papio anubis in zambia feces monkey baboon papio 2018-11-23v4No1 / 151
594amnoncommon adult, cameroon, feces, homo sapiens, city, yaounde2020-03-12v4No1 / 154
673amnoncommon caecum, control, ascending colon, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 154
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
273amnon high in age age one month compared to age one year in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 168
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
770amnoncommon vagina, female organism, age > 1 year, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
671amnoncommon age 3 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
620amnoncommon village, rural community, homo sapiens, nouabale-ndoki national park, republic of congo, feces2020-05-06v4No1 / 197
411amnoncommon zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 200
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
150amnoncommon canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
671amnon high in state of california compared to state of oregon in age 1 month united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 217
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, china, homo sapiens, adult2019-11-24v4No1 / 221
411amnoncommon zambia, feces, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 224
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
673amnon high in caecum ascending colon compared to ileum in control research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 228
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 236
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 279
770amnoncommon age < 1 year, infant, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 280
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
816amnon high in late pregnancy compared to early pregnancy in commonwealth of pennsylvania pregnancy feces adult organism research facility united states of america female organism sus scrofa pig 2021-07-04v4No1 / 312
208amnoncommon mus musculus, mouse, feces, united states of america, state of texas, balb/c2017-10-06v4No1 / 316
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
175amnonhigher in winter compared to summer in heavy metal contaminated soils in china ( high in winter compared to summer in soil heavy metal china )2017-07-29v4No1 / 337
729amnon high in europe captive zoological garden eastern chimpanzee pan troglodytes verus compared to cameroon pan troglodytes troglodytes central chimpanzee in feces monkey 2021-01-05v3No1 / 337
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
729amnoncommon western chimpanzee, pan troglodytes verus, europe, zoological garden, feces, monkey2021-01-05v3No1 / 343
671amnon high in state of california compared to state of oregon in female adult united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 355
620amnoncommon lincoln park zoo, chicago, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 358
565amnoncommon skin, canada, macropus rufus, red kangaroo, zoological garden, captive, african lion safari2019-11-21v3No1 / 360
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
620amnoncommon lincoln park zoo, united states of america, chicago, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 384
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
770amnoncommon age 10-15 years, adult organism, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 396
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
625amnoncommon pongo abelii, sumatran orangutan, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 414
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
424amnoncommon sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 452
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
160amnoncommon in wastewater treatment plant effluent in autumn in china (common autumn, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 469
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
160amnoncommon in wastewater treatment plant effluent in spring in china (common spring, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 573
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
827sheryoCommon in soil at 230cm depth in clayey till loam soil, Lund Denmark (common depth 200-260cm, loam soil, late weichselian glaciation, clayey till, agricultural field, kingdom of denmark, lund)2021-08-24v3No1 / 644
729amnon high in captive zoological garden europe compared to wild cameroon in gorilla gorilla monkey feces 2021-01-05v3No1 / 656
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin australia foot )2017-11-05v4No1 / 708
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
671amnon high in female adult compared to age 8 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 947
620amnon high in united states of america zoological garden pan troglodytes compared to nouabale-ndoki national park republic of congo wild pan troglodytes troglodytes in chimpanzee feces 2020-05-06v4No1 / 964
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
620amnon high in united states of america zoological garden compared to nouabale-ndoki national park wild republic of congo in gorilla gorilla gorilla feces 2020-05-06v4No1 / 1019
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181

Problems / suggestions? Please email info AT dbbact DOT org