Search result for sequence:
TACGTAGGGGGCGAGCGTTGTCCGGAATCACTGGGCGTAAAGAGCGTGTAGGCGGCCCGGTAAGTCTGCTGTGAAAACCCGGGGCTCAACCCCGGGCGTGCAGTGGAAACTGCCGGGCTAGAGGGCGGCAGAGGCGAGTGGAATTCCCGG
common ontology terms
term enrichment score
TermScore
beetle0.454545
poland0.432432
detritivorous beetle0.400000
bulgaria0.400000
balkan mountains0.363636
carnivorous beetle0.322581
raba river0.275862
whole body0.270270
nida basin0.222222
herbivorous beetle0.222222
hefei city prefecture0.160000
baijiu0.160000
days 0-900.160000
mud0.148148
fermentation pit mud0.148148
plant0.133333
river0.123457
argoptochus quadrisignatus0.086957
paederidus rubrothoracicus0.086957
aphthona venustula0.086957
LOWER IN days 180-2700.086957
centricnemus leucogrammus0.086957
onthophagus similis0.086957
state of rhode island0.086957
scallion0.086957
aphodius depressus0.086957
aphodius sphacelatus0.086957
bembidion modestum0.086957
aphodius haemorrhoidalis0.086957
LOWER IN leaf endosphere0.086957
upper stem0.086957
campinas0.086957
onthophagus ruficapillus0.086957
mine tailing0.086957
alkaline mine tailing0.086957
guangxi zhuang autonomous region0.086957
zone 10.086957
LOWER IN zone 2,30.086957
bembidion decorum0.086957
bembidion varicolor0.086957
suckling0.086957
preweaned0.086957
age 2-4 weeks0.086957
LOWER IN weaned0.086957
LOWER IN corn and soybean diet0.086957
LOWER IN age 4-7 weeks0.086957
aphodius pusillus0.086957
carabidae0.086957
LOWER IN staphylinidae0.086957
LOWER IN herbivorous beetle0.086957
LOWER IN poland0.086957
stem endosphere0.083333
endosphere0.083333
saccharum0.083333
sugarcane0.083333
greenhouse0.083333
jiangxi province0.083333
foodon product type0.076923
LOWER IN leaf0.071429
stem0.071429
pig0.066667
sus scrofa0.066667
brazil0.055556
china0.049281
sediment0.045455
farm0.040816
soil0.023810
feces0.017094
united states of america0.009050
Fraction of dbbact annotations with this term covered by the query
TermScore
poland0.500000
nida basin0.500000
herbivorous beetle0.500000
argoptochus quadrisignatus0.500000
paederidus rubrothoracicus0.500000
carnivorous beetle0.500000
raba river0.500000
aphthona venustula0.500000
hefei city prefecture0.500000
baijiu0.500000
days 0-900.500000
LOWER IN days 180-2700.500000
centricnemus leucogrammus0.500000
detritivorous beetle0.500000
bulgaria0.500000
balkan mountains0.500000
onthophagus similis0.500000
state of rhode island0.500000
scallion0.500000
aphodius depressus0.500000
aphodius sphacelatus0.500000
bembidion modestum0.500000
aphodius haemorrhoidalis0.500000
LOWER IN leaf endosphere0.500000
upper stem0.500000
campinas0.500000
onthophagus ruficapillus0.500000
mine tailing0.500000
alkaline mine tailing0.500000
guangxi zhuang autonomous region0.500000
zone 10.500000
LOWER IN zone 2,30.500000
bembidion decorum0.500000
bembidion varicolor0.500000
suckling0.500000
preweaned0.500000
age 2-4 weeks0.500000
LOWER IN weaned0.500000
LOWER IN corn and soybean diet0.500000
LOWER IN age 4-7 weeks0.500000
aphodius pusillus0.500000
carabidae0.500000
LOWER IN staphylinidae0.500000
LOWER IN herbivorous beetle0.500000
LOWER IN poland0.500000
beetle0.333333
mud0.333333
fermentation pit mud0.333333
stem endosphere0.333333
endosphere0.333333
saccharum0.333333
sugarcane0.333333
greenhouse0.333333
jiangxi province0.333333
foodon product type0.200000
whole body0.166667
LOWER IN leaf0.142857
stem0.142857
plant0.125000
pig0.111111
sus scrofa0.111111
river0.083333
brazil0.066667
sediment0.043478
farm0.035714
china0.028302
soil0.015873
feces0.008772
united states of america0.005000
Fraction of annotations for the query sequences containing the term
TermScore
whole body0.714286
beetle0.714286
poland0.380952
detritivorous beetle0.333333
feces0.333333
bulgaria0.333333
balkan mountains0.285714
carnivorous beetle0.238095
river0.238095
raba river0.190476
china0.190476
plant0.142857
nida basin0.142857
herbivorous beetle0.142857
mud0.095238
hefei city prefecture0.095238
baijiu0.095238
fermentation pit mud0.095238
days 0-900.095238
argoptochus quadrisignatus0.047619
paederidus rubrothoracicus0.047619
aphthona venustula0.047619
LOWER IN days 180-2700.047619
centricnemus leucogrammus0.047619
onthophagus similis0.047619
united states of america0.047619
state of rhode island0.047619
scallion0.047619
foodon product type0.047619
aphodius depressus0.047619
aphodius sphacelatus0.047619
bembidion modestum0.047619
aphodius haemorrhoidalis0.047619
LOWER IN leaf endosphere0.047619
LOWER IN leaf0.047619
stem endosphere0.047619
upper stem0.047619
stem0.047619
endosphere0.047619
saccharum0.047619
sugarcane0.047619
campinas0.047619
brazil0.047619
greenhouse0.047619
onthophagus ruficapillus0.047619
sediment0.047619
soil0.047619
mine tailing0.047619
alkaline mine tailing0.047619
guangxi zhuang autonomous region0.047619
zone 10.047619
LOWER IN zone 2,30.047619
bembidion decorum0.047619
bembidion varicolor0.047619
pig0.047619
sus scrofa0.047619
farm0.047619
jiangxi province0.047619
suckling0.047619
preweaned0.047619
age 2-4 weeks0.047619
LOWER IN weaned0.047619
LOWER IN corn and soybean diet0.047619
LOWER IN age 4-7 weeks0.047619
aphodius pusillus0.047619
carabidae0.047619
LOWER IN staphylinidae0.047619
LOWER IN herbivorous beetle0.047619
LOWER IN poland0.047619
Exp. ID User ID Description Date Region Flag Sequences
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, argoptochus quadrisignatus2019-04-18v4No1 / 22
515amnoncommon poland, whole body, beetle, paederidus rubrothoracicus, carnivorous beetle, river, raba river2019-04-18v4No1 / 25
515amnoncommon poland, whole body, beetle, aphthona venustula, plant, nida basin, herbivorous beetle2019-04-18v4No1 / 54
603amnonhigher in inital batches of baijiu fermentation pit mud ( high in days 0-90 compared to days 180-270 in mud hefei city prefecture china baijiu fermentation pit mud )2020-04-05v3No1 / 74
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus similis2019-04-18v4No1 / 104
311amnoncommon united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 121
515amnoncommon whole body, beetle, aphodius depressus, detritivorous beetle, feces, bulgaria, balkan mountains2019-04-18v4No1 / 121
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius sphacelatus2019-04-18v4No1 / 127
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion modestum2019-04-18v4No1 / 131
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius haemorrhoidalis2019-04-18v4No1 / 147
615amnon high in stem endosphere upper stem stem compared to leaf endosphere leaf in endosphere saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 153
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus ruficapillus2019-04-18v4No1 / 178
402amnon high in zone 1 compared to zone 2,3 in sediment soil mine tailing alkaline mine tailing guangxi zhuang autonomous region china 2018-11-18v4No1 / 189
515amnoncommon bembidion decorum, carnivorous beetle, river, poland, raba river, whole body, beetle2019-04-18v4No1 / 198
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion varicolor2019-04-18v4No1 / 308
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 347
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius pusillus2019-04-18v4No1 / 421
603amnoncommon in baijiu fermentation pit mud in first 2 batches (common mud, fermentation pit mud, baijiu, china, hefei city prefecture, days 0-90)2020-04-05v3No1 / 542
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130
515amnon high in detritivorous beetle bulgaria compared to herbivorous beetle poland in whole body beetle 2019-04-19v4No1 / 1543

Problems / suggestions? Please email info AT dbbact DOT org