Search result for sequence:
TACGTAGGGGGCGAGCGTTGTCCGGAATCACTGGGCGTAAAGAGCGTGTAGGCGGCCCGGTAAGTCTGCTGTGAAAACCCGGGGCTCAACCCCGGGCGTGCAGTGGAAACTGCCGGGCTAGAGGGCGGCAGAGGCGAGTGGAATTCCCGG
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
nida basin0.500000
herbivorous beetle0.500000
argoptochus quadrisignatus0.500000
paederidus rubrothoracicus0.500000
carnivorous beetle0.500000
raba river0.500000
aphthona venustula0.500000
centricnemus leucogrammus0.500000
detritivorous beetle0.500000
bulgaria0.500000
balkan mountains0.500000
onthophagus similis0.500000
state of rhode island0.500000
scallion0.500000
aphodius depressus0.500000
aphodius sphacelatus0.500000
bembidion modestum0.500000
aphodius haemorrhoidalis0.500000
onthophagus ruficapillus0.500000
mine tailing0.500000
alkaline mine tailing0.500000
guangxi zhuang autonomous region0.500000
zone 10.500000
LOWER IN zone 2,30.500000
bembidion decorum0.500000
bembidion varicolor0.500000
suckling0.500000
preweaned0.500000
age 2-4 weeks0.500000
LOWER IN weaned0.500000
LOWER IN corn and soybean diet0.500000
LOWER IN age 4-7 weeks0.500000
aphodius pusillus0.500000
carabidae0.500000
LOWER IN staphylinidae0.500000
LOWER IN herbivorous beetle0.500000
LOWER IN poland0.500000
poland0.333333
beetle0.333333
jiangxi province0.333333
whole body0.250000
foodon product type0.200000
plant0.125000
pig0.111111
sus scrofa0.111111
river0.083333
sediment0.043478
farm0.043478
china0.021978
soil0.019231
feces0.009569
united states of america0.005348
Fraction of annotations for the query sequences containing the term
TermScore
whole body0.833333
beetle0.833333
poland0.444444
detritivorous beetle0.388889
feces0.388889
bulgaria0.388889
balkan mountains0.333333
carnivorous beetle0.277778
river0.277778
raba river0.222222
plant0.166667
nida basin0.166667
herbivorous beetle0.166667
china0.111111
argoptochus quadrisignatus0.055556
paederidus rubrothoracicus0.055556
aphthona venustula0.055556
centricnemus leucogrammus0.055556
onthophagus similis0.055556
united states of america0.055556
state of rhode island0.055556
scallion0.055556
foodon product type0.055556
aphodius depressus0.055556
aphodius sphacelatus0.055556
bembidion modestum0.055556
aphodius haemorrhoidalis0.055556
onthophagus ruficapillus0.055556
sediment0.055556
soil0.055556
mine tailing0.055556
alkaline mine tailing0.055556
guangxi zhuang autonomous region0.055556
zone 10.055556
LOWER IN zone 2,30.055556
bembidion decorum0.055556
bembidion varicolor0.055556
pig0.055556
sus scrofa0.055556
farm0.055556
jiangxi province0.055556
suckling0.055556
preweaned0.055556
age 2-4 weeks0.055556
LOWER IN weaned0.055556
LOWER IN corn and soybean diet0.055556
LOWER IN age 4-7 weeks0.055556
aphodius pusillus0.055556
carabidae0.055556
LOWER IN staphylinidae0.055556
LOWER IN herbivorous beetle0.055556
LOWER IN poland0.055556
Exp. ID User ID Description Date Region Flag Sequences
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, argoptochus quadrisignatus2019-04-18v4No1 / 22
515amnoncommon poland, whole body, beetle, paederidus rubrothoracicus, carnivorous beetle, river, raba river2019-04-18v4No1 / 25
515amnoncommon poland, whole body, beetle, aphthona venustula, plant, nida basin, herbivorous beetle2019-04-18v4No1 / 54
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus similis2019-04-18v4No1 / 104
311amnoncommon united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 121
515amnoncommon whole body, beetle, aphodius depressus, detritivorous beetle, feces, bulgaria, balkan mountains2019-04-18v4No1 / 121
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius sphacelatus2019-04-18v4No1 / 127
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion modestum2019-04-18v4No1 / 131
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius haemorrhoidalis2019-04-18v4No1 / 147
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus ruficapillus2019-04-18v4No1 / 178
402amnon high in zone 1 compared to zone 2,3 in sediment soil mine tailing alkaline mine tailing guangxi zhuang autonomous region china 2018-11-18v4No1 / 189
515amnoncommon bembidion decorum, carnivorous beetle, river, poland, raba river, whole body, beetle2019-04-18v4No1 / 198
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion varicolor2019-04-18v4No1 / 308
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 347
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius pusillus2019-04-18v4No1 / 421
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130
515amnon high in detritivorous beetle bulgaria compared to herbivorous beetle poland in whole body beetle 2019-04-19v4No1 / 1543

Problems / suggestions? Please email info AT dbbact DOT org