Search result for sequence:
TACGTAGGGGGCGAGCGTTGTCCGGAATCACTGGGCGTAAAGGGCGCGTAGGCGGCCTAGTAAGTCAGATGTGAAAAGTGAGGGCTCAACCCTTAGAGTGCATCTGATACTGCTAGGCTTGAGTACAGAAGAGGAAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
monkey0.229008
ethiopia0.228571
small village0.181818
rural community0.142857
LOWER IN age 3-60.129032
chlorocebus aethiops0.129032
LOWER IN nouabale-ndoki national park0.129032
LOWER IN republic of congo0.129032
macaca mulatta0.121212
africa0.114286
feces0.111908
adult0.106075
LOWER IN child0.102564
homo sapiens0.099681
LOWER IN wild0.075472
zoological garden0.070175
pemba island0.068966
LOWER IN usa born0.068966
non usa born0.068966
indian rhesus macaque0.068966
cayo santiago0.068966
LOWER IN cross-cutucu0.068966
upano valley0.068966
shuar population0.068966
age 8-120.068966
age 13-140.068966
low income0.068966
LOWER IN sewer0.068966
LOWER IN age 30-500.068966
LOWER IN age 60-790.068966
LOWER IN age >940.068966
soldiers0.068966
LOWER IN pancreatitis0.068966
LOWER IN acute pancreatitis0.068966
LOWER IN nepal0.068966
LOWER IN himalayas0.068966
el salvador0.068966
LOWER IN lima0.068966
LOWER IN shantytown0.068966
cron diet0.068966
grivet monkey0.068966
vervet monkey0.068966
age 60-790.068966
LOWER IN age 8-120.068966
chlorocebus djamdjamensis0.068966
bale monkey0.068966
LOWER IN state of california0.068966
rhesus macaque0.068966
LOWER IN madagascar0.068966
bangui0.068966
LOWER IN antananarivo0.068966
theropithecus gelada0.068966
gorilla gorilla gorilla0.068966
LOWER IN age 1-3 years0.066667
hispanic or latin american0.066667
LOWER IN age 10-15 years0.066667
village0.066667
south america0.066667
LOWER IN wastewater treatment plant0.066667
age 19-240.066667
nanchang city prefecture0.066667
LOWER IN european0.066667
asian0.066667
LOWER IN american diet0.066667
venezuela0.066667
amerindian0.066667
age 30-500.066667
central african republic0.066667
LOWER IN pan troglodytes troglodytes0.066667
tanzania0.064516
puerto rico0.064516
LOWER IN caucasian0.064516
hunter gatherer0.064516
gay0.064516
pan troglodytes0.064516
chimpanzee0.064516
LOWER IN adult organism0.062500
rectal swab0.062500
caloric restriction diet0.062500
LOWER IN msw0.062500
LOWER IN heterosexual0.062500
city0.061538
ecuador0.060606
LOWER IN rural community0.060606
homosexual0.060606
msm0.060606
state of oregon0.060606
wet season0.060606
LOWER IN dry season0.060606
LOWER IN city0.058824
age < 1 year0.058824
kingdom of norway0.057143
state of new york0.054054
LOWER IN duodenum0.054054
hiv infection0.054054
sweden0.050000
ileum0.047619
female0.045455
captive0.045455
united states of america0.045430
Fraction of dbbact annotations with this term covered by the query
TermScore
small village0.500000
pemba island0.500000
LOWER IN usa born0.500000
non usa born0.500000
indian rhesus macaque0.500000
cayo santiago0.500000
LOWER IN cross-cutucu0.500000
upano valley0.500000
shuar population0.500000
age 8-120.500000
age 13-140.500000
LOWER IN age 3-60.500000
low income0.500000
LOWER IN sewer0.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
LOWER IN age &gt;940.500000
soldiers0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
el salvador0.500000
LOWER IN lima0.500000
LOWER IN shantytown0.500000
cron diet0.500000
ethiopia0.500000
chlorocebus aethiops0.500000
grivet monkey0.500000
vervet monkey0.500000
age 60-790.500000
LOWER IN age 8-120.500000
chlorocebus djamdjamensis0.500000
bale monkey0.500000
LOWER IN state of california0.500000
rhesus macaque0.500000
LOWER IN madagascar0.500000
bangui0.500000
LOWER IN antananarivo0.500000
theropithecus gelada0.500000
LOWER IN nouabale-ndoki national park0.500000
LOWER IN republic of congo0.500000
gorilla gorilla gorilla0.500000
LOWER IN age 1-3 years0.333333
hispanic or latin american0.333333
LOWER IN age 10-15 years0.333333
macaca mulatta0.333333
village0.333333
south america0.333333
LOWER IN wastewater treatment plant0.333333
age 19-240.333333
nanchang city prefecture0.333333
LOWER IN european0.333333
asian0.333333
LOWER IN american diet0.333333
venezuela0.333333
amerindian0.333333
age 30-500.333333
central african republic0.333333
LOWER IN pan troglodytes troglodytes0.333333
monkey0.300000
tanzania0.250000
puerto rico0.250000
LOWER IN caucasian0.250000
africa0.250000
hunter gatherer0.250000
gay0.250000
pan troglodytes0.250000
chimpanzee0.250000
rural community0.200000
LOWER IN adult organism0.200000
rectal swab0.200000
caloric restriction diet0.200000
LOWER IN msw0.200000
LOWER IN heterosexual0.200000
LOWER IN child0.166667
ecuador0.166667
LOWER IN rural community0.166667
homosexual0.166667
msm0.166667
state of oregon0.166667
wet season0.166667
LOWER IN dry season0.166667
LOWER IN city0.142857
age < 1 year0.142857
kingdom of norway0.125000
state of new york0.100000
LOWER IN duodenum0.100000
hiv infection0.100000
sweden0.076923
LOWER IN wild0.076923
ileum0.066667
zoological garden0.066667
adult0.060976
feces0.059406
captive0.058824
homo sapiens0.053640
city0.052632
kingdom of spain0.050000
LOWER IN feces0.047619
Fraction of annotations for the query sequences containing the term
TermScore
feces0.962963
homo sapiens0.703704
adult0.407407
united states of america0.259259
china0.222222
monkey0.185185
ethiopia0.148148
rural community0.111111
small village0.111111
LOWER IN child0.074074
female0.074074
macaca mulatta0.074074
LOWER IN age 3-60.074074
city0.074074
africa0.074074
child0.074074
chlorocebus aethiops0.074074
LOWER IN nouabale-ndoki national park0.074074
LOWER IN republic of congo0.074074
LOWER IN wild0.074074
zoological garden0.074074
LOWER IN city0.037037
kingdom of norway0.037037
LOWER IN feces0.037037
colon0.037037
ileum0.037037
LOWER IN age 1-3 years0.037037
tanzania0.037037
pemba island0.037037
LOWER IN usa born0.037037
non usa born0.037037
hispanic or latin american0.037037
LOWER IN age 10-15 years0.037037
LOWER IN adult organism0.037037
age < 1 year0.037037
infant0.037037
rectal swab0.037037
indian rhesus macaque0.037037
cayo santiago0.037037
puerto rico0.037037
LOWER IN cross-cutucu0.037037
upano valley0.037037
shuar population0.037037
village0.037037
ecuador0.037037
age 8-120.037037
age 13-140.037037
south america0.037037
low income0.037037
LOWER IN sewer0.037037
LOWER IN wastewater treatment plant0.037037
age 19-240.037037
LOWER IN adult0.037037
LOWER IN age 30-500.037037
LOWER IN age 60-790.037037
LOWER IN age &gt;940.037037
soldiers0.037037
nanchang city prefecture0.037037
control0.037037
LOWER IN pancreatitis0.037037
LOWER IN acute pancreatitis0.037037
LOWER IN nepal0.037037
LOWER IN himalayas0.037037
LOWER IN rural community0.037037
el salvador0.037037
LOWER IN lima0.037037
LOWER IN shantytown0.037037
LOWER IN caucasian0.037037
LOWER IN european0.037037
asian0.037037
state of new york0.037037
cron diet0.037037
caloric restriction diet0.037037
LOWER IN american diet0.037037
diet0.037037
LOWER IN duodenum0.037037
grivet monkey0.037037
venezuela0.037037
amerindian0.037037
hunter gatherer0.037037
vervet monkey0.037037
age 30-500.037037
age 60-790.037037
LOWER IN age 8-120.037037
chlorocebus djamdjamensis0.037037
bale monkey0.037037
hiv infection0.037037
kingdom of spain0.037037
sweden0.037037
male0.037037
homosexual0.037037
msm0.037037
gay0.037037
LOWER IN msw0.037037
LOWER IN heterosexual0.037037
LOWER IN state of california0.037037
state of oregon0.037037
rhesus macaque0.037037
research facility0.037037
captive0.037037
Exp. ID User ID Description Date Region Flag Sequences
290amnon high in rural community small village compared to city in homo sapiens feces adult china 2018-02-01v4No1 / 21
194amnon high in colon ileum compared to feces in homo sapiens kingdom of norway 2017-09-07v4No1 / 67
736amnon high in adult female compared to age 1-3 years child in tanzania pemba island feces homo sapiens 2021-01-25v3No1 / 79
644amnonhigher in individuals born in latin america compared to indivuals born in usa ( high in non usa born compared to usa born in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 107
770amnon high in age < 1 year infant compared to age 10-15 years adult organism in rectal swab feces indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v4No1 / 111
660amnonlower in the cross cutcu population (more modern) comparen to upano valley (less modern) ( high in upano valley compared to cross-cutucu in shuar population village rural community ecuador feces homo sapiens )2020-09-20v4No1 / 132
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 168
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 187
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in age 19-24 soldiers compared to adult age 30-50 age 60-79 age >94 in homo sapiens feces china )2018-12-30v4No1 / 238
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
650amnon high in asian compared to caucasian european in feces adult homo sapiens united states of america state of new york 2020-09-12v4No1 / 317
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
578amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to msw heterosexual in homo sapiens feces hiv infection kingdom of spain sweden adult male )2020-01-14v3No1 / 519
671amnon high in state of oregon compared to state of california in female adult united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 534
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
331amnon high in wet season compared to dry season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 818
620amnon high in united states of america zoological garden pan troglodytes compared to nouabale-ndoki national park republic of congo wild pan troglodytes troglodytes in chimpanzee feces 2020-05-06v4No1 / 964
620amnon high in united states of america zoological garden compared to nouabale-ndoki national park wild republic of congo in gorilla gorilla gorilla feces 2020-05-06v4No1 / 1019

Problems / suggestions? Please email info AT dbbact DOT org