Search result for sequence:
TACGTAGGGGGCGAGCGTTGTCCGGAATGATTGGGCGTAAAGGGCGCGTAGGCGGCCCGTTAAGTCTGGAGTGAAAGTCCTGTTTTCAAGATGGGAATTGCTTTGGATACTGATGGGCTTGAGTGCAGGAGAGGTTATCGGAATTCCCGG
common ontology terms
term enrichment score
TermScore
equus caballus0.558140
horse0.428571
equus zebra0.285714
mountain zebra0.285714
LOWER IN cecal content0.285714
LOWER IN equine grass sickness0.285714
LOWER IN equus przewalskii0.285714
state of texas0.222222
LOWER IN disease0.222222
united kingdom0.173913
french republic0.166667
zoological garden0.133333
LOWER IN caecum0.117647
farm0.065574
feces0.034483
adult0.019417
research facility0.017699
control0.013937
united states of america0.009756
Fraction of dbbact annotations with this term covered by the query
TermScore
equus zebra0.500000
mountain zebra0.500000
LOWER IN cecal content0.500000
LOWER IN equine grass sickness0.500000
LOWER IN equus przewalskii0.500000
equus caballus0.428571
horse0.333333
state of texas0.250000
LOWER IN disease0.250000
french republic0.142857
united kingdom0.111111
zoological garden0.100000
LOWER IN caecum0.083333
farm0.035714
feces0.017544
adult0.010204
research facility0.009259
control0.007092
united states of america0.005000
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
equus caballus0.800000
horse0.600000
farm0.400000
control0.400000
united kingdom0.400000
zoological garden0.200000
french republic0.200000
equus zebra0.200000
mountain zebra0.200000
LOWER IN caecum0.200000
LOWER IN cecal content0.200000
adult0.200000
united states of america0.200000
state of texas0.200000
research facility0.200000
LOWER IN equine grass sickness0.200000
LOWER IN disease0.200000
LOWER IN equus przewalskii0.200000

Problems / suggestions? Please email info AT dbbact DOT org