Search result for sequence:
TACGTAGGGGGCGAGCGTTGTCCGGAATGATTGGGCGTAAAGGGCGCGTAGGCGGCCTGCTAAGTCTGGAGTGAAAGTCCTGCTTTCAAGGTGGGAAGTGCTTTGGATACTGGTGGGCTGGAGTGCAGGAGAGGAAAGCGGAATTACCGG
common ontology terms
term enrichment score
TermScore
feces0.340849
homo sapiens0.291670
adult0.286432
zoological garden0.240250
china0.159426
monkey0.144578
rural community0.131004
control0.120527
captive0.110924
female0.105495
macaca mulatta0.105263
gorilla gorilla0.096953
male0.092593
rumen0.090909
sheep0.087866
ovis aries0.085366
child0.082645
kingdom of spain0.081871
research facility0.079895
united states of america0.073692
rhesus macaque0.068493
goat0.068493
capra hircus0.068493
italy0.065868
pregnancy0.064103
small village0.055556
europe0.055556
pan troglodytes0.055556
chimpanzee0.055556
LOWER IN crohn's disease0.054422
msm0.054054
homosexual0.054054
ruminal fluid0.054054
LOWER IN wild0.052174
sus scrofa0.050847
pig0.050847
sweden0.049751
wild0.043478
hunter gatherer0.042857
estonia0.042705
age 30-500.042705
papio anubis0.042705
lake hulun0.042254
municipality of yogyakarta0.042254
indonesia0.042254
nigeria0.042254
tanzania0.042254
age 10-15 years0.042254
dairy goat0.042254
como zoo0.042254
guangzhou city prefecture0.041812
LOWER IN ulcerative colitis0.041667
india0.041667
nanjing city prefecture0.041379
LOWER IN infant0.041379
shanxi province0.041379
gay0.040541
LOWER IN child0.040541
lamb0.040541
new zealand0.040541
mongolia0.039735
age 6 weeks0.039735
state of tennessee0.039735
obesity0.038961
thailand0.038961
digesta0.038217
state of minnesota0.038217
rat0.037500
hiv infection0.036145
female organism0.034884
winter0.032086
colon0.030151
canada0.030151
amerindian0.028777
venezuela0.028777
olive baboon0.028777
LOWER IN pan troglodytes troglodytes0.028777
corsac fox0.028571
vulpes corsac0.028571
pemba island0.028571
age 13-140.028571
age 2 years0.028571
kebbi state0.028571
LOWER IN age 3-60.028571
age 8 months0.028571
subacute rumen acidosis0.028571
acidosis0.028571
tunapuco0.028571
indian rhesus macaque0.028571
cayo santiago0.028571
LOWER IN cameroon0.028571
pan troglodytes verus0.028571
lincoln park zoo0.028571
toronto zoo0.028571
saint louis zoo0.028571
saint louis0.028571
age 60-790.028571
chuquisaca department0.028571
LOWER IN nouabale-ndoki national park0.028571
LOWER IN republic of congo0.028571
Fraction of dbbact annotations with this term covered by the query
TermScore
gorilla gorilla0.833333
hunter gatherer0.750000
estonia0.666667
age 30-500.666667
amerindian0.666667
venezuela0.666667
papio anubis0.666667
olive baboon0.666667
LOWER IN pan troglodytes troglodytes0.666667
rural community0.600000
small village0.500000
corsac fox0.500000
vulpes corsac0.500000
lake hulun0.500000
bihar state0.500000
midwest region0.500000
zhengzhou city prefecture0.500000
gestational age 8-12 weeks0.500000
chengdu city prefecture0.500000
santa catarina state0.500000
municipality of yogyakarta0.500000
indonesia0.500000
LOWER IN insomnia0.500000
age 1-18 years0.500000
sri lanka0.500000
nigeria0.500000
ibadan0.500000
municipality of reus0.500000
tanzania0.500000
pemba island0.500000
novosibirsk0.500000
LOWER IN age 2-4 years0.500000
hmong0.500000
LOWER IN usa born0.500000
non usa born0.500000
LOWER IN antiretroviral therapy0.500000
municipality of logrono0.500000
LOWER IN human immunodeficiency virus infectious disease0.500000
LOWER IN restricted feed0.500000
myanmar0.500000
karen0.500000
age 13-140.500000
age 2 years0.500000
kebbi state0.500000
age 10-15 years0.500000
urinary schistosomiasis0.500000
schistosomiasis0.500000
red fox0.500000
vulpes vulpes0.500000
age 8-120.500000
LOWER IN age 3-60.500000
hadza0.500000
preweaned0.500000
age 2-4 weeks0.500000
suckling0.500000
taipei city0.500000
low anterior resection0.500000
age 8 months0.500000
rhesus macaque0.500000
macaca mulatta0.500000
nouabale-ndoki national park0.500000
republic of congo0.500000
induced type 1 diabetes0.500000
subacute rumen acidosis0.500000
acidosis0.500000
dairy goat0.500000
goat0.500000
capra hircus0.500000
LOWER IN state of oregon0.500000
sus scrofa domesticus0.500000
gorilla0.500000
south american tapir0.500000
tapirus terrestris0.500000
black-handed spider monkey0.500000
ateles geoffroyi0.500000
como zoo0.500000
bangladesh0.500000
tunapuco0.500000
indian rhesus macaque0.500000
cayo santiago0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
hainan black goat0.500000
LOWER IN age 0-6 months0.500000
LOWER IN short bowel syndrome0.500000
LOWER IN cameroon0.500000
LOWER IN central chimpanzee0.500000
europe0.500000
pan troglodytes verus0.500000
western chimpanzee0.500000
lincoln park zoo0.500000
pan troglodytes0.500000
chimpanzee0.500000
macropus rufus0.500000
red kangaroo0.500000
african lion safari0.500000
zambia0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.882353
homo sapiens0.544118
adult0.375000
china0.227941
united states of america0.191176
zoological garden0.161765
control0.154412
research facility0.139706
female0.088235
monkey0.088235
captive0.080882
italy0.080882
rural community0.073529
male0.073529
rumen0.058824
child0.058824
macaca mulatta0.058824
kingdom of spain0.051471
sheep0.051471
ovis aries0.051471
gorilla gorilla0.051471
sweden0.036765
pregnancy0.036765
rhesus macaque0.036765
goat0.036765
capra hircus0.036765
small village0.029412
wild0.029412
msm0.029412
homosexual0.029412
LOWER IN crohn's disease0.029412
sus scrofa0.029412
pig0.029412
ruminal fluid0.029412
europe0.029412
pan troglodytes0.029412
chimpanzee0.029412
LOWER IN wild0.029412
lake hulun0.022059
winter0.022059
mongolia0.022059
LOWER IN ulcerative colitis0.022059
guangzhou city prefecture0.022059
india0.022059
hiv infection0.022059
gay0.022059
municipality of yogyakarta0.022059
indonesia0.022059
nigeria0.022059
obesity0.022059
estonia0.022059
LOWER IN child0.022059
tanzania0.022059
age 30-500.022059
thailand0.022059
nanjing city prefecture0.022059
digesta0.022059
female organism0.022059
hunter gatherer0.022059
colon0.022059
lamb0.022059
age 6 weeks0.022059
new zealand0.022059
LOWER IN infant0.022059
age 10-15 years0.022059
rat0.022059
dairy goat0.022059
shanxi province0.022059
state of minnesota0.022059
como zoo0.022059
papio anubis0.022059
skin0.022059
canada0.022059
state of tennessee0.022059
LOWER IN city0.014706
corsac fox0.014706
vulpes corsac0.014706
msw0.014706
heterosexual0.014706
south korea0.014706
russia0.014706
czech republic0.014706
high bmi0.014706
pemba island0.014706
amerindian0.014706
venezuela0.014706
age 13-140.014706
age 2 years0.014706
kebbi state0.014706
infant0.014706
belgium0.014706
age 1 month0.014706
LOWER IN age 3-60.014706
farm0.014706
jiangxi province0.014706
LOWER IN female0.014706
age 8 months0.014706
rattus norvegicus0.014706
sprague dawley0.014706
subacute rumen acidosis0.014706
Exp. ID User ID Description Date Region Flag Sequences
290amnon high in rural community small village compared to city in homo sapiens feces adult china 2018-02-01v4No1 / 21
815amnondominant corsac fox, vulpes corsac, lake hulun, wild, winter, mongolia, feces2021-07-04v3No1 / 27
779amnon high in control compared to ulcerative colitis in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v4No1 / 28
570amnoncommon homo sapiens, feces, india, bihar state2019-12-16v3No1 / 46
597amnoncommon homo sapiens, feces, adult, zhejiang province, china, control2020-03-23v3No1 / 46
578amnoncommon homo sapiens, feces, adult, male, kingdom of spain, sweden, msw, heterosexual, hiv infection2020-01-14v3No1 / 53
578amnon high in sweden compared to kingdom of spain in homo sapiens feces hiv infection adult male msm gay homosexual 2020-01-14v3No1 / 55
745amnoncommon adult, midwest region, united states of america, feces, homo sapiens2021-02-25v3No1 / 55
720amnoncommon control, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 56
831amnoncommon control, homo sapiens, feces, adult, israel2021-09-11v3No1 / 60
627amnoncommon feces, pregnancy, adult, female, china2020-05-16v3No1 / 61
637amnoncommon gestational age 8-12 weeks, chengdu city prefecture, china, adult, pregnancy, female, feces, homo sapiens2020-08-18v3No1 / 61
593amnoncommon homo sapiens, feces, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 62
575amnoncommon in professional martial arts athletes (common homo sapiens, feces, athlete, high physical activity, adult, china, age 19-24)2020-01-05v3No1 / 63
757amnoncommon feces, adult, santa catarina state, brazil, homo sapiens2021-03-28v3No1 / 67
574amnoncommon feces, homo sapiens, russia, adult2020-01-05v3No1 / 68
593amnoncommon homo sapiens, feces, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
723amnoncommon feces, municipality of yogyakarta, adult, female, indonesia, homo sapiens2021-01-02v3No1 / 69
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
566amnon high in control compared to insomnia in homo sapiens feces china adult 2019-11-24v4No1 / 71
656amnoncommon age 1-18 years, sri lanka, feces, homo sapiens2020-09-13v3No1 / 71
832amnoncommon nigeria, ibadan, adult, feces, homo sapiens2021-09-11v4No1 / 74
578amnoncommon homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, hiv infection2020-01-14v3No1 / 74
799amnoncommon in obese participant fecal samples before ketogenic diet (common obesity, high bmi, adult, estonia, feces, homo sapiens)2021-06-13v3No1 / 77
630amnoncommon madrid, kingdom of spain, feces, adult, homo sapiens2020-06-01v3No1 / 78
732amnoncommon municipality of reus, kingdom of spain, adult, feces, homo sapiens2021-01-11v3No1 / 79
736amnon high in adult female compared to age 1-3 years child in tanzania pemba island feces homo sapiens 2021-01-25v3No1 / 79
707amnoncommon guangzhou city prefecture, age 30-50, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 82
680amnoncommon obesity, adult, novosibirsk, russia, feces, homo sapiens2028-03-04v3No1 / 85
723amnonlower in children age 2-4 years compared to mothers ( high in adult compared to age 2-4 years child in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 87
578amnoncommon homo sapiens, feces, adult, male, kingdom of spain, sweden, control, msw, heterosexual2020-01-14v3No1 / 92
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common ketogenic diet, high bmi, estonia, adult, obesity, homo sapiens, feces)2021-06-13v3No1 / 93
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
736amnoncommon tanzania, pemba island, adult, female, feces, homo sapiens2021-01-25v3No1 / 95
644amnonhigher in individuals born in latin america compared to indivuals born in usa ( high in non usa born compared to usa born in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 107
794amnon high in control compared to antiretroviral therapy human immunodeficiency virus infectious disease hiv infection in municipality of logrono kingdom of spain adult homo sapiens feces 2021-06-08v4No1 / 112
735amnon high in control compared to restricted feed in research facility nanjing city prefecture china pregnancy digesta rumen female organism female sheep ovis aries 2021-01-22v3No1 / 112
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
779amnon high in control compared to crohn's disease in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v4No1 / 127
649amnoncommon colon, lamb, age 6 weeks, research facility, new zealand, ovis aries, sheep2020-09-07v3No1 / 128
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
578amnoncommon homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, control2020-01-14v3No1 / 132
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
797amnon high in child age 2 years compared to infant age 1 year in formula fed germany homo sapiens feces 2021-06-13v3No1 / 139
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 146
815amnoncommon corsac fox, vulpes corsac, lake hulun, wild, winter, mongolia, feces2021-07-04v3No1 / 146
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
629amnon high in msm homosexual compared to msw heterosexual in male adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v4No1 / 154
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
815amnoncommon lake hulun, wild, winter, mongolia, red fox, vulpes vulpes, feces2021-07-04v3No1 / 160
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens adult feces china 2018-02-05v4No1 / 161
700amnoncommon belgium, age 1 month, research facility, sus scrofa, pig, feces2028-04-01v3No1 / 164
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 168
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
521amnoncommon in pre-weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No1 / 169
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
671amnon high in age 8 months compared to female adult in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 182
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
620amnoncommon village, rural community, homo sapiens, nouabale-ndoki national park, republic of congo, feces2020-05-06v4No1 / 197
584amnoncommon male, rattus norvegicus, rat, sprague dawley, research facility, feces, china, type i diabetes mellitus, induced type 1 diabetes2020-01-31v3No1 / 202
787amnonhigher in excess grain induced rumen acidosis compared to healthy controls ( high in subacute rumen acidosis acidosis compared to control in dairy goat shanxi province rumen ruminal fluid research facility china goat capra hircus )2021-05-23v3No1 / 207
671amnon high in state of california compared to state of oregon in age 1 month united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 217
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, china, homo sapiens, adult2019-11-24v4No1 / 221
584amnoncommon male, rattus norvegicus, rat, sprague dawley, research facility, feces, control, china2020-01-31v3No1 / 221
666amnoncommon pig, sus scrofa domesticus, italy, feces2020-09-25v3No1 / 223
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
666amnoncommon south american tapir, tapirus terrestris, italy, feces2020-09-25v3No1 / 242
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
625amnoncommon black-handed spider monkey, ateles geoffroyi, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 256
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
770amnoncommon age < 1 year, infant, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 280
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
625amnoncommon gorilla gorilla, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 293
737amnoncommon ruminal fluid, rumen, hainan autonomous prefecture, age 2 months, research facility, hainan black goat, china, goat, capra hircus2021-01-27v3No1 / 295
666amnoncommon wild boar, sus scrofa, italy, feces2020-09-25v3No1 / 305
723amnon high in age 2-4 years compared to age 0-6 months infant in homo sapiens indonesia municipality of yogyakarta feces child 2021-01-02v3No1 / 305
650amnon high in asian compared to caucasian european in feces adult homo sapiens united states of america state of new york 2020-09-12v4No1 / 317
532amnon high in control compared to short bowel syndrome in homo sapiens feces czech republic adult 2019-07-21v1No1 / 334
729amnon high in europe captive zoological garden eastern chimpanzee pan troglodytes verus compared to cameroon pan troglodytes troglodytes central chimpanzee in feces monkey 2021-01-05v3No1 / 337
666amnoncommon horse, equus caballus, italy, feces2020-09-25v3No1 / 341
729amnoncommon western chimpanzee, pan troglodytes verus, europe, zoological garden, feces, monkey2021-01-05v3No1 / 343
620amnoncommon lincoln park zoo, chicago, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 358
565amnoncommon skin, canada, macropus rufus, red kangaroo, zoological garden, captive, african lion safari2019-11-21v3No1 / 360
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
565amnoncommon skin, canada, papio anubis, olive baboon, zoological garden, captive, toronto zoo2019-11-21v3No1 / 368
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
620amnoncommon lincoln park zoo, united states of america, chicago, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 384
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
770amnoncommon age 10-15 years, adult organism, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 396
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
666amnoncommon rattus rattus, rat, italy, feces2020-09-25v3No1 / 406
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
625amnoncommon pongo abelii, sumatran orangutan, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 414
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
620amnoncommon saint louis zoo, saint louis, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 433
666amnoncommon lama guanicoe, italy, feces2020-09-25v3No1 / 437
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
787amnoncommon in high grain diet induced subacute acidosis (common acidosis, subacute rumen acidosis, capra hircus, goat, china, research facility, ruminal fluid, rumen, shanxi province, dairy goat)2021-05-23v3No1 / 463
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
639amnon high in oryctolagus cuniculus european rabbit compared to lepus europaeus european brown hare in nature reserve adult wild australia feces 2020-08-21v3No1 / 480
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
620amnoncommon saint louis zoo, saint louis, united states of america, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 530
671amnon high in state of oregon compared to state of california in female adult united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 534
729amnoncommon captive, gorilla gorilla, monkey, feces, zoological garden, europe2021-01-05v3No1 / 542
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
666amnoncommon alpaca, vicugna pacos, italy, feces2020-09-25v3No1 / 546
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
666amnoncommon mouflon, ovis aries musimon, italy, feces2020-09-25v3No1 / 649
729amnon high in captive zoological garden europe compared to wild cameroon in gorilla gorilla monkey feces 2021-01-05v3No1 / 656
565amnoncommon skin, canada, zoological garden, captive, tragelaphus oryx, eland, toronto zoo2019-11-21v3No1 / 674
666amnoncommon goat, capra hircus, italy, feces2020-09-25v3No1 / 674
666amnoncommon equus asinus africanus, african wild ass, feces, italy2020-09-25v3No1 / 683
666amnoncommon sheep, ovis aries, italy, feces2020-09-25v3No1 / 688
787amnoncommon control, capra hircus, goat, china, research facility, ruminal fluid, rumen, shanxi province, dairy goat2021-05-23v3No1 / 700
671amnon high in age 3 months compared to age 1 month in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 714
735amnoncommon restricted feed, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v3No1 / 744
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
735amnoncommon control, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v3No1 / 761
649amnon high in colon compared to ileum in lamb age 6 weeks research facility new zealand ovis aries sheep 2020-09-07v3No1 / 897
701amnoncommon municipality of beijing, research facility, china, male, male organism, age 2 years, rumen liquid, rumen, bos taurus, cow2028-04-01v3No1 / 953
671amnon high in age 8 months compared to age 6 months age 3 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 955
620amnon high in united states of america zoological garden pan troglodytes compared to nouabale-ndoki national park republic of congo wild pan troglodytes troglodytes in chimpanzee feces 2020-05-06v4No1 / 964
620amnon high in united states of america zoological garden compared to nouabale-ndoki national park wild republic of congo in gorilla gorilla gorilla feces 2020-05-06v4No1 / 1019
649amnon high in colon compared to jejunum duodenum in lamb age 6 weeks research facility new zealand ovis aries sheep 2020-09-07v3No1 / 1261

Problems / suggestions? Please email info AT dbbact DOT org