Search result for sequence:
TACGTAGGGGGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGTGCGTAGGCGGTTGATTAAGTTGGATGTGAAATACCCGGGCTTAACTTGGGGGGTGCATTCAAAACTGGTTAACTAGAGTACAGGAGAGGGAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
pig0.375000
sus scrofa0.322581
europe0.200000
pregnancy0.166667
sheep0.153846
zoological garden0.148148
gorilla gorilla0.142857
ovis aries0.142857
pan troglodytes verus0.142857
monkey0.135135
cameroon0.133333
adult organism0.125000
lamb0.125000
new zealand0.125000
captive0.121212
commonwealth of pennsylvania0.117647
age 6 weeks0.117647
colon0.108108
farm0.101695
belgium0.100000
female organism0.100000
kingdom of spain0.090909
canada0.088889
italy0.083333
pemba island0.076923
age 1-3 weeks0.076923
sus scrofa domesticus0.076923
LOWER IN state of alabama0.076923
LOWER IN wild boar0.076923
state of vermont0.076923
early pregnancy0.076923
LOWER IN cameroon0.076923
LOWER IN central chimpanzee0.076923
late pregnancy0.076923
western chimpanzee0.076923
toronto zoo0.076923
LOWER IN europe0.076923
alpaca0.076923
vicugna pacos0.076923
mouflon0.076923
ovis aries musimon0.076923
LOWER IN first pregnancy0.076923
multiple pregnancies0.076923
madrid0.074074
estonia0.074074
LOWER IN age 1-3 years0.074074
LOWER IN age 4 weeks0.074074
LOWER IN pan troglodytes troglodytes0.074074
eastern chimpanzee0.074074
papio anubis0.074074
olive baboon0.074074
province of quebec0.074074
tanzania0.071429
gay0.071429
ketogenic diet0.068966
age 1 month0.068966
tonsil0.068966
LOWER IN msw0.068966
LOWER IN heterosexual0.068966
LOWER IN jejunum0.068966
age 2 months0.066667
homosexual0.066667
msm0.066667
LOWER IN captive0.064516
LOWER IN zoological garden0.064516
feces0.063365
male0.062500
state of michigan0.060606
hiv infection0.058824
LOWER IN duodenum0.058824
obesity0.055556
LOWER IN child0.055556
wild0.055556
high bmi0.054054
LOWER IN wild0.054054
sweden0.054054
LOWER IN ileum0.054054
adult0.053191
LOWER IN control diet0.052632
LOWER IN caecum0.048780
female0.047059
LOWER IN female0.042553
research facility0.039143
skin0.035088
homo sapiens0.028070
united states of america0.023493
control0.010204
Fraction of dbbact annotations with this term covered by the query
TermScore
pemba island0.500000
age 1-3 weeks0.500000
sus scrofa domesticus0.500000
LOWER IN state of alabama0.500000
LOWER IN wild boar0.500000
state of vermont0.500000
early pregnancy0.500000
LOWER IN cameroon0.500000
LOWER IN central chimpanzee0.500000
europe0.500000
pan troglodytes verus0.500000
late pregnancy0.500000
western chimpanzee0.500000
toronto zoo0.500000
LOWER IN europe0.500000
alpaca0.500000
vicugna pacos0.500000
mouflon0.500000
ovis aries musimon0.500000
LOWER IN first pregnancy0.500000
multiple pregnancies0.500000
pig0.375000
madrid0.333333
estonia0.333333
LOWER IN age 1-3 years0.333333
LOWER IN age 4 weeks0.333333
cameroon0.333333
LOWER IN pan troglodytes troglodytes0.333333
eastern chimpanzee0.333333
papio anubis0.333333
olive baboon0.333333
province of quebec0.333333
sus scrofa0.312500
tanzania0.250000
gay0.250000
lamb0.250000
new zealand0.250000
ketogenic diet0.200000
age 1 month0.200000
tonsil0.200000
LOWER IN msw0.200000
LOWER IN heterosexual0.200000
sheep0.200000
age 6 weeks0.200000
LOWER IN jejunum0.200000
age 2 months0.166667
pregnancy0.166667
gorilla gorilla0.166667
homosexual0.166667
msm0.166667
ovis aries0.166667
LOWER IN captive0.142857
LOWER IN zoological garden0.142857
zoological garden0.133333
belgium0.125000
adult organism0.125000
captive0.117647
state of michigan0.111111
commonwealth of pennsylvania0.111111
kingdom of spain0.100000
monkey0.100000
hiv infection0.100000
LOWER IN duodenum0.100000
colon0.095238
canada0.095238
farm0.085714
obesity0.083333
LOWER IN child0.083333
female organism0.083333
high bmi0.076923
LOWER IN wild0.076923
sweden0.076923
LOWER IN ileum0.076923
LOWER IN control diet0.071429
LOWER IN caecum0.058824
italy0.055556
male0.050000
LOWER IN female0.043478
wild0.041667
feces0.033003
female0.032787
adult0.030488
skin0.030303
research facility0.020979
homo sapiens0.015326
united states of america0.012448
control0.005814
Fraction of annotations for the query sequences containing the term
TermScore
feces0.791667
pig0.375000
sus scrofa0.333333
research facility0.291667
adult0.208333
united states of america0.208333
monkey0.208333
homo sapiens0.166667
italy0.166667
pregnancy0.166667
zoological garden0.166667
colon0.125000
farm0.125000
commonwealth of pennsylvania0.125000
adult organism0.125000
female organism0.125000
gorilla gorilla0.125000
europe0.125000
captive0.125000
sheep0.125000
ovis aries0.125000
belgium0.083333
male0.083333
kingdom of spain0.083333
female0.083333
cameroon0.083333
wild0.083333
pan troglodytes verus0.083333
canada0.083333
lamb0.083333
age 6 weeks0.083333
new zealand0.083333
LOWER IN caecum0.041667
control0.041667
age 2 months0.041667
LOWER IN female0.041667
madrid0.041667
LOWER IN control diet0.041667
ketogenic diet0.041667
obesity0.041667
high bmi0.041667
estonia0.041667
LOWER IN age 1-3 years0.041667
LOWER IN child0.041667
tanzania0.041667
pemba island0.041667
age 1 month0.041667
state of michigan0.041667
tonsil0.041667
age 1-3 weeks0.041667
LOWER IN age 4 weeks0.041667
sus scrofa domesticus0.041667
LOWER IN state of alabama0.041667
LOWER IN wild0.041667
LOWER IN wild boar0.041667
state of vermont0.041667
early pregnancy0.041667
LOWER IN cameroon0.041667
LOWER IN pan troglodytes troglodytes0.041667
LOWER IN central chimpanzee0.041667
eastern chimpanzee0.041667
late pregnancy0.041667
western chimpanzee0.041667
skin0.041667
papio anubis0.041667
olive baboon0.041667
toronto zoo0.041667
LOWER IN captive0.041667
LOWER IN zoological garden0.041667
LOWER IN europe0.041667
province of quebec0.041667
hiv infection0.041667
sweden0.041667
homosexual0.041667
msm0.041667
gay0.041667
LOWER IN msw0.041667
LOWER IN heterosexual0.041667
alpaca0.041667
vicugna pacos0.041667
mouflon0.041667
ovis aries musimon0.041667
LOWER IN first pregnancy0.041667
multiple pregnancies0.041667
LOWER IN ileum0.041667
LOWER IN jejunum0.041667
LOWER IN duodenum0.041667
Exp. ID User ID Description Date Region Flag Sequences
700amnon high in colon compared to caecum in control age 2 months belgium research facility sus scrofa pig 2028-04-01v3No1 / 59
630amnon high in male compared to female in madrid kingdom of spain feces adult homo sapiens 2020-05-31v3No1 / 63
799amnonlower before ketogenic diet compared to after ketogenic diet in obese participants ( high in ketogenic diet compared to control diet in obesity high bmi adult estonia feces homo sapiens )2021-06-13v3No1 / 77
736amnon high in adult female compared to age 1-3 years child in tanzania pemba island feces homo sapiens 2021-01-25v3No1 / 79
700amnoncommon belgium, age 1 month, research facility, sus scrofa, pig, feces2028-04-01v3No1 / 164
389amnon high in age 1-3 weeks compared to age 4 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 189
666amnoncommon pig, sus scrofa domesticus, italy, feces2020-09-25v3No1 / 223
759amnon high in state of vermont farm pig compared to state of alabama wild wild boar in united states of america feces sus scrofa 2021-04-04v4No1 / 258
816amnoncommon early pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 313
729amnoncommon cameroon, wild, feces, monkey, gorilla gorilla2021-01-05v3No1 / 321
729amnon high in europe captive zoological garden eastern chimpanzee pan troglodytes verus compared to cameroon pan troglodytes troglodytes central chimpanzee in feces monkey 2021-01-05v3No1 / 337
816amnoncommon late pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 340
729amnoncommon western chimpanzee, pan troglodytes verus, europe, zoological garden, feces, monkey2021-01-05v3No1 / 343
565amnoncommon skin, canada, papio anubis, olive baboon, zoological garden, captive, toronto zoo2019-11-21v3No1 / 368
729amnon high in wild cameroon compared to captive zoological garden europe in gorilla gorilla monkey feces 2021-01-05v3No1 / 383
470amnoncommon sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 457
578amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to msw heterosexual in homo sapiens feces hiv infection kingdom of spain sweden adult male )2020-01-14v3No1 / 519
729amnoncommon captive, gorilla gorilla, monkey, feces, zoological garden, europe2021-01-05v3No1 / 542
666amnoncommon alpaca, vicugna pacos, italy, feces2020-09-25v3No1 / 546
666amnoncommon mouflon, ovis aries musimon, italy, feces2020-09-25v3No1 / 649
666amnoncommon sheep, ovis aries, italy, feces2020-09-25v3No1 / 688
816amnonlower in sows in first pregnancy compared to later pregnancies ( high in multiple pregnancies compared to first pregnancy in commonwealth of pennsylvania pregnancy feces adult organism research facility united states of america female organism sus scrofa pig )2021-07-04v4No1 / 780
649amnon high in colon compared to ileum in lamb age 6 weeks research facility new zealand ovis aries sheep 2020-09-07v3No1 / 897
649amnon high in colon compared to jejunum duodenum in lamb age 6 weeks research facility new zealand ovis aries sheep 2020-09-07v3No1 / 1261

Problems / suggestions? Please email info AT dbbact DOT org