Search result for sequence:
TACGTAGGGGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCGCGTAGGCGGCATGATGTGTCGTTTGTGAAAACTACAGGCTCAACTTGTAGATTGCAGGCGAAACTATCATACTTGAGTGCAGGAGAGGAAAGCGGAATTCCCAG
common ontology terms
term enrichment score
TermScore
LOWER IN equine grass sickness0.666667
LOWER IN disease0.400000
horse0.285714
equus caballus0.250000
united kingdom0.200000
farm0.068966
control0.014085
feces0.008734
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN equine grass sickness0.500000
LOWER IN disease0.250000
horse0.166667
equus caballus0.142857
united kingdom0.111111
farm0.035714
control0.007092
feces0.004386
Fraction of annotations for the query sequences containing the term
TermScore
equus caballus1.000000
horse1.000000
feces1.000000
farm1.000000
control1.000000
LOWER IN equine grass sickness1.000000
LOWER IN disease1.000000
united kingdom1.000000

Problems / suggestions? Please email info AT dbbact DOT org