Search result for sequence:
TACGTAGGGTCCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTGTGCAAGACCGATGTGAAATCCCCGAGCTTAACTTGGGAATTGCATTGGTGACTGCACGGCTAGAGTGTGTCAGAGGGGGGTAGAATTCCACG
common ontology terms
term enrichment score
TermScore
rhizosphere0.199170
water0.187826
united states of america0.174978
china0.146789
drinking water0.111675
soil0.106886
pacific ocean0.106195
cat0.102128
felis catus0.092664
sea water0.092127
foodon product type0.091139
fresh water0.089888
germany0.089249
ocean0.083650
river0.077295
state of rhode island0.074074
depth 10 cm0.074074
homo sapiens0.068209
breast milk0.066667
coral0.066667
plant0.064171
LOWER IN soil0.063358
brazil0.061538
air0.060914
state of florida0.058537
mucus0.056872
state of california0.056338
skin0.055684
farm0.055300
koshi river0.054054
minas gerais state0.054054
campos rupestres0.054054
nepal0.052632
depth 0-20cm0.051948
sediment0.046875
greenhouse0.044199
beach0.043716
yellowstone national park0.043716
bronchial epithelium0.043243
LOWER IN water0.043011
mountain0.042781
geothermal field0.042781
nasal cavity0.042781
austria0.042781
root0.042105
snow field0.041885
high temperature environment0.041885
bird0.041885
dog0.040201
canis lupus familiaris0.038647
japan0.036530
particle bound0.033426
aerosol0.033149
tributary0.033149
centrocercus urophasianus0.033149
greater sage-grouse0.033149
state of wyoming0.033149
south florida0.033149
shark0.033149
philippine sea0.033149
cultivated environment0.032787
beetle0.032609
depth 1-2m0.032609
filtered 0.2um0.032609
LOWER IN saliva0.032609
biofilm0.032609
soybean0.032609
glycine max0.032086
free floating0.031579
usa0.031579
whole body0.031088
atlantic ocean0.030151
digestive system0.029557
adult0.029557
infant0.029484
leaf0.029268
mouth0.029056
feces0.026750
control0.025316
research facility0.025078
mouse0.023715
mus musculus0.022770
canada0.022472
citrus0.022472
santa cruz province0.022346
fish sauce0.022346
galaxea astreata0.022346
poland0.022346
nida basin0.022346
herbivorous beetle0.022346
centricnemus leucogrammus0.022346
lower back0.022346
pavona varians0.022346
groin0.022346
nasal cavity mucosa0.022346
thermophilic sediment0.022346
bronchial brush0.022346
bermuda0.022346
turtle farm0.022346
cow milk (raw)0.022346
Fraction of dbbact annotations with this term covered by the query
TermScore
greenhouse0.666667
particle bound0.666667
canada0.666667
citrus0.666667
LOWER IN allergy0.500000
LOWER IN atopic dermatitis0.500000
turbinaria reniformis0.500000
beach0.500000
aerosol0.500000
santa cruz province0.500000
state of rhode island0.500000
fish sauce0.500000
galaxea astreata0.500000
poland0.500000
plant0.500000
nida basin0.500000
herbivorous beetle0.500000
centricnemus leucogrammus0.500000
LOWER IN depth 6-7m0.500000
lower back0.500000
yellowstone national park0.500000
depth 10 cm0.500000
koshi river0.500000
tributary0.500000
fungus growing ant0.500000
mycocepurus smithii0.500000
seriatopora caliendrum0.500000
pavona varians0.500000
groin0.500000
nasal cavity mucosa0.500000
cinara0.500000
acropora hyacinthus0.500000
tissue0.500000
arawacus togarna0.500000
thermophilic sediment0.500000
onion0.500000
drinking water0.500000
LOWER IN reproductive organ0.500000
LOWER IN reproductive system0.500000
LOWER IN genitalia0.500000
radish0.500000
interdigital region0.500000
reproductive system0.500000
reproductive organ0.500000
genitalia0.500000
red pepper sauce0.500000
high salt concentration0.500000
LOWER IN low salt concentration0.500000
depth 6-7m0.500000
pikas0.500000
bronchial brush0.500000
LOWER IN sputum0.500000
LOWER IN induced sputum0.500000
bermuda0.500000
porites astreoides0.500000
agave0.500000
guanajuato0.500000
agave tequiliana0.500000
centrocercus urophasianus0.500000
greater sage-grouse0.500000
state of wyoming0.500000
beginning0.500000
middle timepoint0.500000
two weeks0.500000
LOWER IN fresh0.500000
LOWER IN food spoilage0.500000
red-eared slider turtle0.500000
trachemys scripta elegans0.500000
turtle farm0.500000
age <=24 hours0.500000
LOWER IN age &gt;= 7 days0.500000
cabbage0.500000
LOWER IN oral wash0.500000
malvaviscus penduliflorus0.500000
south florida0.500000
shark0.500000
root structure0.500000
apple0.500000
malus x domestica0.500000
state of connecticut0.500000
scallion0.500000
aphodius depressus0.500000
detritivorous beetle0.500000
bulgaria0.500000
balkan mountains0.500000
alpine pasture0.500000
alpine0.500000
cow milk (raw)0.500000
cow milk (fluid)0.500000
milk0.500000
distribution system0.500000
LOWER IN water treatment plant0.500000
LOWER IN estonia0.500000
shenzhen city prefecture0.500000
hong kong0.500000
LOWER IN leaf endosphere0.500000
upper stem0.500000
campinas0.500000
howea forsteriana0.500000
subway0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.365714
water0.154286
china0.142857
rhizosphere0.137143
homo sapiens0.108571
soil0.074286
cat0.068571
felis catus0.068571
pacific ocean0.068571
ocean0.062857
drinking water0.062857
sea water0.062857
germany0.062857
fresh water0.057143
foodon product type0.051429
river0.045714
breast milk0.040000
coral0.040000
state of rhode island0.040000
depth 10 cm0.040000
brazil0.040000
skin0.034286
mucus0.034286
state of california0.034286
air0.034286
plant0.034286
farm0.034286
state of florida0.034286
LOWER IN soil0.034286
feces0.034286
sediment0.028571
koshi river0.028571
nepal0.028571
adult0.028571
depth 0-20cm0.028571
minas gerais state0.028571
campos rupestres0.028571
control0.022857
research facility0.022857
beach0.022857
snow field0.022857
mountain0.022857
japan0.022857
yellowstone national park0.022857
geothermal field0.022857
LOWER IN water0.022857
high temperature environment0.022857
nasal cavity0.022857
austria0.022857
bronchial epithelium0.022857
dog0.022857
canis lupus familiaris0.022857
root0.022857
bird0.022857
greenhouse0.022857
mus musculus0.017143
mouse0.017143
mouth0.017143
aerosol0.017143
whole body0.017143
beetle0.017143
depth 1-2m0.017143
tributary0.017143
free floating0.017143
filtered 0.2um0.017143
digestive system0.017143
LOWER IN saliva0.017143
usa0.017143
cultivated environment0.017143
centrocercus urophasianus0.017143
greater sage-grouse0.017143
state of wyoming0.017143
infant0.017143
biofilm0.017143
leaf0.017143
atlantic ocean0.017143
south florida0.017143
shark0.017143
glycine max0.017143
soybean0.017143
particle bound0.017143
philippine sea0.017143
finland0.011429
oral cavity0.011429
balb/c0.011429
santa cruz province0.011429
fish sauce0.011429
galaxea astreata0.011429
poland0.011429
nida basin0.011429
herbivorous beetle0.011429
centricnemus leucogrammus0.011429
lower back0.011429
kingdom of spain0.011429
south africa0.011429
intestine0.011429
pavona varians0.011429
inguinal region0.011429
groin0.011429
nasal cavity mucosa0.011429
Exp. ID User ID Description Date Region Flag Sequences
245amnondominant homo sapiens, breast milk, finland2017-11-21v4No1 / 4
158amnonhigh in skin of healthy cats compared to cats with skin allergy ( high in control compared to allergy atopic dermatitis in cat felis catus skin united states of america )2017-07-05v4No1 / 5
179amnondominant mus musculus, mouse, oral cavity, research facility, united states of america, balb/c, mouth2017-08-13v4No1 / 7
418amnondominant coral, ocean, turbinaria reniformis, mucus2018-12-02v4No1 / 7
245amnondominant homo sapiens, breast milk, china2017-11-21v4No1 / 9
304amnondominant united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 10
311amnondominant united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 11
418amnondominant coral, ocean, galaxea astreata, mucus2018-12-02v4No1 / 11
515amnondominant poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 11
287amnon high in depth 1-2m compared to depth 6-7m in snow field mountain japan 2018-01-29v4No1 / 12
158amnondominant united states of america, lower back, felis catus, cat2017-07-06v4No1 / 13
198amnon high in sediment compared to water in yellowstone national park united states of america geothermal field high temperature environment 2017-09-14v4No1 / 13
245amnoncommon homo sapiens, breast milk, kingdom of spain2017-11-21v4No1 / 13
534amnondominant river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 13
245amnondominant homo sapiens, breast milk, south africa2017-11-21v4No1 / 14
304amnoncandidate contaminants - higher in blanks (contamination)2018-03-12v4No1 / 14
397amnoncommon panama, digestive system, intestine, fungus growing ant, mycocepurus smithii2018-11-14v4No1 / 14
158amnoncommon united states of america, lower back, felis catus, cat2017-07-06v4No1 / 15
245amnoncommon homo sapiens, breast milk, china2017-11-21v4No1 / 15
418amnondominant coral, ocean, seriatopora caliendrum, mucus2018-12-02v4No1 / 15
418amnondominant coral, ocean, pavona varians, mucus2018-12-02v4No1 / 15
158amnondominant united states of america, inguinal region, felis catus, cat, groin2017-07-06v4No1 / 16
345amnondominant homo sapiens, nasal cavity, nasal cavity mucosa, austria, adult, graz city district2018-06-11v4No1 / 16
68amnonfound in some aphid samples (prevalence <=0.1) (other cinara)2017-02-20v4No1 / 17
158amnondominant cat, felis catus, united states of america, axilla2017-07-06v4No1 / 17
287amnondominant snow field, mountain, depth 1-2m, japan2018-01-29v4No1 / 17
418amnondominant coral, ocean, acropora hyacinthus, tissue2018-12-02v4No1 / 17
158amnondominant cat, felis catus, united states of america, external acoustic meatus, ear canal2017-07-06v4No1 / 18
245amnoncommon homo sapiens, breast milk, finland2017-11-21v4No1 / 18
245amnoncommon homo sapiens, breast milk, south africa2017-11-21v4No1 / 19
33amnondominant homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 21
501amnoncommon costa rica, butterfly, digestive system, arawacus togarna2019-03-09v4No1 / 21
158amnoncommon cat, felis catus, united states of america, external acoustic meatus, ear canal2017-07-06v4No1 / 22
198amnondominant sediment, yellowstone national park, united states of america, thermophilic sediment, geothermal field, high temperature environment2017-09-13v4No1 / 23
418amnoncommon coral, ocean, galaxea astreata, mucus2018-12-02v4No1 / 24
158amnoncommon united states of america, pair of nares, felis catus, cat2017-07-06v4No1 / 25
158amnonhigher in skin sites compared to mouth in cats ( high in skin compared to saliva mouth in felis catus cat united states of america )2017-07-06v4No1 / 26
311amnoncommon united states of america, state of rhode island, allium cepa, onion, foodon product type2018-04-09v4No1 / 26
158amnoncommon united states of america, inguinal region, felis catus, cat, groin2017-07-06v4No1 / 27
109amnoncommon water, drinking water, united states of america, site b2017-04-08v4No1 / 31
418amnoncommon coral, ocean, pavona varians, mucus2018-12-02v4No1 / 34
287amnoncommon snow field, mountain, depth 1-2m, japan2018-01-29v4No1 / 35
231amnonhigher in urine compared to genitalia in dogs ( high in urine compared to reproductive organ reproductive system genitalia in dog canis lupus familiaris united states of america )2017-11-02v4No1 / 36
311amnoncommon united states of america, state of rhode island, radish, foodon product type2018-04-09v4No1 / 36
158amnoncommon cat, felis catus, united states of america, axilla2017-07-06v4No1 / 37
345amnoncommon homo sapiens, nasal cavity, nasal cavity mucosa, austria, adult, graz city district2018-06-11v4No1 / 37
33amnoncommon homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 40
158amnoncommon united states of america, interdigital region, felis catus, cat2017-07-06v4No1 / 42
275amnonhigher in fall 2010 compared to summer 2013 in whale skin ( high in autumn compared to summer in megaptera novaeangliae humpback whale antarctica antarctic peninsula skin )2018-01-16v4No1 / 42
231amnoncommon in dog genitalia (common dog, canis lupus familiaris, united states of america, reproductive system, reproductive organ, genitalia)2017-11-02v4No1 / 43
547amnon high in high salt concentration compared to low salt concentration in red pepper sauce capsicum annuum sichuan province china food (fermented) 2019-08-15v4No1 / 43
287amnoncommon snow field, mountain, depth 6-7m, japan2018-01-29v4No1 / 47
279amnon high in mouth compared to small intestine stomach in ochotonidae pikas china 2018-01-24v4No1 / 53
109amnoncommon usa, water, drinking water, site a2017-04-08v4No1 / 54
354amnon high in bronchus bronchial epithelium bronchial brush compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 55
9amnonhigher in sea water with coral ( high in porites astreoides compared to control in bermuda sea water )2016-10-27v4No1 / 61
360amnoncommon agave, desert, root endosphere, mexico, guanajuato, agave tequiliana, cultivated environment, root2018-08-21v4No1 / 62
558amnon high in duodenum compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 64
109amnoncommon water, drinking water, united states of america, site d2017-04-08v4No1 / 67
311amnoncommon united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 68
231amnoncommon in dog urine (common dog, canis lupus familiaris, united states of america, urine)2017-11-02v4No1 / 69
9amnonhigher in beginning of experiment comapred to 12 days ( high in beginning compared to end in bermuda sea water )2016-10-27v4No1 / 71
109amnoncommon water, drinking water, united states of america, site e2017-04-08v4No1 / 80
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 80
269amnonpeaks at 2 weeks in refrigeration of yao meat ( high in middle timepoint two weeks compared to fresh food spoilage late timepoint in china foodon product type )2018-01-09v4No1 / 83
590amnoncommon china, red-eared slider turtle, trachemys scripta elegans, age 3-5 weeks, intestine, turtle farm, farm, hainan autonomous prefecture2020-02-10v4No1 / 83
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
227amnonhiger in first 24hrs compared to later timepoints in baby nasopharynx ( high in age age <=24 hours compared to age >= 7 days in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v4No1 / 85
311amnoncommon in salted cabbage (common cabbage, united states of america, state of rhode island, foodon product type)2018-04-09v4No1 / 85
109amnoncommon usa, water, drinking water, site c2017-04-08v4No1 / 86
354amnon high in bronchus bronchial brush bronchial epithelium compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 94
558amnon high in colon compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 97
196amnonlower in water compared to biofilm ( high in biofilm compared to water in drinking water united states of america )2017-09-12v4No1 / 100
361amnoncommon leaf, austria, greenhouse, plant, malvaviscus penduliflorus2018-08-21v4No1 / 102
198amnoncommon yellowstone national park, united states of america, geothermal field, water, hot spring, high temperature environment2017-09-13v4No1 / 103
323amnonhigher in sharks compared to sea water ( high in shark compared to water surface water depth 0m sea water in atlantic ocean south florida state of florida united states of america )2018-04-24v4No1 / 107
271amnon high in root structure root compared to soil rhizosphere in depth 0-20cm glycine max soybean china 2018-01-09v4No1 / 110
198amnoncommon sediment, yellowstone national park, united states of america, thermophilic sediment, geothermal field, high temperature environment2017-09-13v4No1 / 113
269amnoncommon in fresh yao meat food (common china, foodon product type)2018-01-09v4No1 / 113
343amnoncommon in apple flowers (common apple, malus x domestica, flower structure, flower, united states of america, state of connecticut)2018-05-28v4No1 / 118
196amnoncommon in biofilm in tap water (common water, drinking water, united states of america, biofilm)2017-09-12v4No1 / 121
311amnoncommon united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 121
515amnoncommon whole body, beetle, aphodius depressus, detritivorous beetle, feces, bulgaria, balkan mountains2019-04-18v4No1 / 121
590amnoncommon in turtle pond water (common china, turtle farm, farm, hainan autonomous prefecture, pond water, water)2020-02-10v4No1 / 127
617amnoncommon alpine pasture, alpine, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 137
109amnon high in distribution system compared to water treatment plant in water drinking water united states of america site e 2017-04-08v4No1 / 143
291amnoncommon canis lupus familiaris, dog, pair of nares, nasal cavity, germany2018-02-01v4No1 / 144
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 146
85amnoncommon litopenaeus vannamei, pacific white shrimp, shenzhen city prefecture, digestive system, china, sea water2017-03-06v4No1 / 147
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
278amnon high in subgingival plaque compared to saliva in homo sapiens united states of america state of california adult 2018-01-23v4No1 / 149
615amnon high in stem endosphere upper stem stem compared to leaf endosphere leaf in endosphere saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 153
361amnoncommon leaf, austria, greenhouse, plant, howea forsteriana2018-08-21v4No1 / 154
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
408amnon high in larval stage compared to stomach in ant costa rica united states of america pseudomyrmex spinicola 2018-11-22v4No1 / 165
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
323amnoncommon in shark gills (common atlantic ocean, south florida, state of florida, united states of america, shark, gill)2018-04-24v4No1 / 170
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 172
196amnoncommon water, drinking water, united states of america2017-09-12v4No1 / 178
311amnoncommon ginger, united states of america, state of rhode island, foodon product type2018-04-09v4No1 / 180
179amnoncommon mus musculus, mouse, oral cavity, research facility, united states of america, balb/c, mouth2017-08-13v4No1 / 183
109amnon high in water treatment plant compared to distribution system in usa water drinking water site c 2017-04-08v4No1 / 193
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 193
170amnoncommon river, water, fresh water, depth 10 cm, united states of america, stream2017-07-24v4No1 / 194
323amnoncommon in shark skin (common atlantic ocean, south florida, state of florida, united states of america, shark, skin)2018-04-24v4No1 / 213
138amnoncommon in ocean water depth 5m (common ocean, pacific ocean, depth 5m, sea water)2017-04-18v4No1 / 214
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 232
342amnoncommon water, pacific ocean, philippine sea, surface water, sea water2018-05-28v4No1 / 236
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 236
617amnoncommon lowland pasture, lowland farm, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 257
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, monterey bay2018-03-12v4No1 / 263
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
441amnonhigher before antibiotic treatment ( high in control compared to antibiotic cefoperazone in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 275
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 315
309amnon high in other plants compared to meadow pea-vine lathyrus pratensis in rhizosphere germany 2018-04-05v4No1 / 316
342amnoncommon water, pacific ocean, philippine sea, depth 300m, sea water2018-05-28v4No1 / 323
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 365
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 52020-04-22v4No1 / 383
170amnonhigher in low turbidity river water ( high in low turbidity turbidity compared to high turbidity in river water fresh water depth 10 cm united states of america stream )2017-07-24v4No1 / 395
342amnoncommon water, pacific ocean, philippine sea, depth 150m, sea water2018-05-28v4No1 / 397
558amnon high in gizzard compared to crop in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 408
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 32020-04-22v4No1 / 420
577amnon high in hypersaline water high salinity depth 4-9m monimolimnion compared to depth 0-3m mixolimnion low salinity in lake romania ursu lake water lake water 2020-01-09v3No1 / 439
373amnoncommon soil, rhizosphere, oryza sativa, rice, hunan province, rice field, china2018-09-08v4No1 / 501
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 518
603amnoncommon in baijiu fermentation pit mud in first 2 batches (common mud, fermentation pit mud, baijiu, china, hefei city prefecture, days 0-90)2020-04-05v3No1 / 542
98amnoncommon citrus, rhizosphere, vero beach, fl, root, state of florida2017-04-01v4No1 / 544
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
138amnoncommon in ocean water depth 1000m (common sea water, ocean, pacific ocean, depth 1000m)2017-04-18v4No1 / 566
138amnoncommon in ocean water depth 150-500m (common sea water, ocean, pacific ocean, depth 150-500m)2017-04-18v4No1 / 582
146amnon high in rhizosphere compared to soil in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 590
536amnon high in terrestrial snake compared to aquatic snake in snake skin united states of america southern united states 2019-07-28v4No1 / 590
603amnoncommon in baijiu fermentation pit mud in later batches (common hefei city prefecture, china, baijiu, fermentation pit mud, mud, days 180-270)2020-04-05v3No1 / 608
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
138amnoncommon in ocean water depth 2000-4000m (common sea water, ocean, pacific ocean, depth 2000-4000m)2017-04-18v4No1 / 674
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 750
309amnon high in plantago lanceolata ribwort plantain compared to other plants in rhizosphere germany 2018-04-05v4No1 / 800
548amnoncommon in endopytic roots of Vellozia epidendroides (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, plant, root)2019-08-15v4No1 / 800
421amnoncommon in paddy field soil incubated without copper (common research facility, soil, paddy field soil, zhejiang province, china)2018-12-02v4No1 / 824
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 830
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
444amnoncommon in uncultivated soil plot (common yellow brown soil, nanjing city prefecture, soil, china)2019-01-07v4No1 / 946
83amnon high in diet control normal diet compared to restricted diet in bos taurus rumen holstein-friesian bull ireland 2017-03-05v4No1 / 1023
548amnoncommon minas gerais state, campos rupestres, brazil, rhizosphere, vellozia epidendroides2019-08-15v4No1 / 1040
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
93amnoncommon in marine sediment near the shore in hawaii (common hawaii, shore, marine sediment)2017-03-12v4No1 / 1151
266amnon high in leaf compared to root in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 1175
615amnon high in rhizosphere compared to soil in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 1181
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
309amnoncommon rhizosphere, germany, prunella vulgaris, woundwort2018-04-05v4No1 / 1217
505amnon high in particle bound size 1-80um compared to free floating size < 1um in water pacific ocean state of california surface water sea water 2019-03-14v4No1 / 1218
309amnoncommon rhizosphere, germany, latyrus pratensis, meadow pea-vine2018-04-05v4No1 / 1296
309amnoncommon rhizosphere, germany, onobrychis viciifolia, common sainfoin2018-04-05v4No1 / 1323
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
309amnoncommon rhizosphere, germany, plantago lanceolata, ribwort plantain2018-04-05v4No1 / 1386
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
309amnoncommon rhizosphere, germany, geranium pratense, meadow geranium2018-04-05v4No1 / 1434
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v4No1 / 1439
271amnoncommon rhizosphere, glycine max, depth 0-20cm, soybean, china2018-01-09v4No1 / 1459
548amnoncommon in phosphorus impoverished soil (common soil, minas gerais state, campos rupestres, brazil, ph 3.5)2019-08-15v4No1 / 1483
309amnoncommon rhizosphere, germany, festuca rubra, red fescue grass2018-04-05v4No1 / 1510
304amnonlower in seawater compared to beach sand ( high in sand compared to water sea water in united states of america state of california beach pacific ocean )2018-03-12v4No1 / 1599
309amnoncommon rhizosphere, germany, galium mollugo, hedge bedstraw2018-04-05v4No1 / 1599
141amnoncommon marine sediment, brackish water, sediment, caspian sea, depth 200m, sample depth 12-35cm2017-04-18v4No1 / 1659
154amnon high in control compared to uranium high uranium in soil australia kakadu national park sediment 2017-06-29v4No1 / 1663
309amnoncommon rhizosphere, germany, veronica chamaedrys, germander speedwell2018-04-05v4No1 / 1788
156amnoncommon soil, rhizosphere, brassica, brassica oleracea, china2017-07-27v4No1 / 1885
271amnoncommon depth 0-20cm, soil, china2018-01-09v4No1 / 2856
265amnon high in soilwater water compared to soil in canada province of quebec 2017-12-11v4No1 / 3277
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>5, ph<6, china2018-02-11v4No1 / 3508
100amnon high in ph ph<5.5 compared to ph>5.5 in soil urban biome park new york city central park 2017-04-03v4No1 / 4262

Problems / suggestions? Please email info AT dbbact DOT org