Search result for sequence:
TACGTAGGGTCCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTGTGCAAGACCGATGTGAAATCCCCGAGCTTAACTTGGGAATTGCATTGGTGACTGCACGGCTAGAGTGTGTCAGAGGGGGGTAGAATTCCACG
common ontology terms
term enrichment score
TermScore
rhizosphere0.207718
united states of america0.179191
water0.172786
china0.139303
drinking water0.117647
soil0.117470
pacific ocean0.111111
cat0.106667
germany0.097561
felis catus0.096386
sea water0.096154
foodon product type0.096000
ocean0.086957
river0.081218
state of rhode island0.078212
depth 10 cm0.078212
fresh water0.075117
homo sapiens0.073422
breast milk0.070000
coral0.070000
plant0.067797
air0.064171
mucus0.059701
skin0.059259
state of california0.059113
koshi river0.057143
minas gerais state0.057143
campos rupestres0.057143
depth 0-20cm0.056338
LOWER IN soil0.055944
nepal0.055556
sediment0.049180
beach0.046243
mountain0.046243
yellowstone national park0.046243
bronchial epithelium0.045714
LOWER IN water0.045455
geothermal field0.045198
nasal cavity0.045198
austria0.045198
root0.044944
bird0.044693
snow field0.044199
high temperature environment0.044199
brazil0.042553
dog0.042328
state of florida0.041885
canis lupus familiaris0.040609
japan0.038278
particle bound0.035398
aerosol0.035088
tributary0.035088
centrocercus urophasianus0.035088
greater sage-grouse0.035088
state of wyoming0.035088
south florida0.035088
shark0.035088
philippine sea0.035088
cultivated environment0.034682
beetle0.034483
depth 1-2m0.034483
filtered 0.2um0.034483
LOWER IN saliva0.034483
biofilm0.034483
soybean0.034483
whole body0.033898
glycine max0.033898
free floating0.033333
usa0.033333
adult0.032787
atlantic ocean0.031746
digestive system0.031250
infant0.031250
leaf0.031008
mouth0.030534
feces0.028860
control0.027211
research facility0.027180
mouse0.025157
mus musculus0.024096
canada0.023952
citrus0.023810
santa cruz province0.023669
fish sauce0.023669
galaxea astreata0.023669
nida basin0.023669
herbivorous beetle0.023669
centricnemus leucogrammus0.023669
lower back0.023669
pavona varians0.023669
groin0.023669
nasal cavity mucosa0.023669
external acoustic meatus0.023669
ear canal0.023669
thermophilic sediment0.023669
bronchial brush0.023669
bermuda0.023669
greenhouse0.023669
hong kong0.023669
southern united states0.023669
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.000000
particle bound0.666667
citrus0.666667
LOWER IN allergy0.500000
LOWER IN atopic dermatitis0.500000
turbinaria reniformis0.500000
beach0.500000
aerosol0.500000
santa cruz province0.500000
state of rhode island0.500000
fish sauce0.500000
galaxea astreata0.500000
plant0.500000
nida basin0.500000
herbivorous beetle0.500000
centricnemus leucogrammus0.500000
mountain0.500000
LOWER IN depth 6-7m0.500000
lower back0.500000
yellowstone national park0.500000
depth 10 cm0.500000
koshi river0.500000
tributary0.500000
fungus growing ant0.500000
mycocepurus smithii0.500000
seriatopora caliendrum0.500000
pavona varians0.500000
groin0.500000
nasal cavity mucosa0.500000
cinara0.500000
acropora hyacinthus0.500000
tissue0.500000
external acoustic meatus0.500000
ear canal0.500000
arawacus togarna0.500000
thermophilic sediment0.500000
onion0.500000
drinking water0.500000
LOWER IN reproductive organ0.500000
LOWER IN reproductive system0.500000
LOWER IN genitalia0.500000
radish0.500000
interdigital region0.500000
reproductive system0.500000
reproductive organ0.500000
genitalia0.500000
red pepper sauce0.500000
high salt concentration0.500000
LOWER IN low salt concentration0.500000
depth 6-7m0.500000
pikas0.500000
bronchial brush0.500000
LOWER IN sputum0.500000
LOWER IN induced sputum0.500000
bermuda0.500000
porites astreoides0.500000
agave0.500000
guanajuato0.500000
agave tequiliana0.500000
centrocercus urophasianus0.500000
greater sage-grouse0.500000
state of wyoming0.500000
beginning0.500000
middle timepoint0.500000
two weeks0.500000
LOWER IN fresh0.500000
LOWER IN food spoilage0.500000
age <=24 hours0.500000
LOWER IN age >= 7 days0.500000
cabbage0.500000
LOWER IN oral wash0.500000
greenhouse0.500000
malvaviscus penduliflorus0.500000
south florida0.500000
shark0.500000
root structure0.500000
apple0.500000
malus x domestica0.500000
state of connecticut0.500000
scallion0.500000
aphodius depressus0.500000
detritivorous beetle0.500000
bulgaria0.500000
balkan mountains0.500000
distribution system0.500000
LOWER IN water treatment plant0.500000
LOWER IN estonia0.500000
shenzhen city prefecture0.500000
hong kong0.500000
howea forsteriana0.500000
subway0.500000
age<17 years0.500000
ant0.500000
pseudomyrmex spinicola0.500000
LOWER IN age 1-3 weeks0.500000
ginger0.500000
water treatment plant0.500000
LOWER IN distribution system0.500000
theropithecus gelada0.500000
philippine sea0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.375758
water0.145455
rhizosphere0.139394
china0.127273
homo sapiens0.115152
soil0.078788
cat0.072727
felis catus0.072727
pacific ocean0.072727
ocean0.066667
drinking water0.066667
sea water0.066667
germany0.066667
foodon product type0.054545
river0.048485
fresh water0.048485
breast milk0.042424
coral0.042424
state of rhode island0.042424
depth 10 cm0.042424
skin0.036364
mucus0.036364
state of california0.036364
air0.036364
plant0.036364
feces0.036364
sediment0.030303
koshi river0.030303
nepal0.030303
adult0.030303
LOWER IN soil0.030303
depth 0-20cm0.030303
minas gerais state0.030303
campos rupestres0.030303
brazil0.030303
control0.024242
research facility0.024242
beach0.024242
snow field0.024242
mountain0.024242
japan0.024242
yellowstone national park0.024242
geothermal field0.024242
LOWER IN water0.024242
high temperature environment0.024242
nasal cavity0.024242
austria0.024242
bronchial epithelium0.024242
dog0.024242
canis lupus familiaris0.024242
root0.024242
bird0.024242
state of florida0.024242
mus musculus0.018182
mouse0.018182
mouth0.018182
aerosol0.018182
whole body0.018182
beetle0.018182
depth 1-2m0.018182
tributary0.018182
free floating0.018182
filtered 0.2um0.018182
digestive system0.018182
LOWER IN saliva0.018182
usa0.018182
cultivated environment0.018182
centrocercus urophasianus0.018182
greater sage-grouse0.018182
state of wyoming0.018182
infant0.018182
biofilm0.018182
leaf0.018182
atlantic ocean0.018182
south florida0.018182
shark0.018182
glycine max0.018182
soybean0.018182
particle bound0.018182
philippine sea0.018182
finland0.012121
oral cavity0.012121
balb/c0.012121
santa cruz province0.012121
fish sauce0.012121
galaxea astreata0.012121
poland0.012121
nida basin0.012121
herbivorous beetle0.012121
centricnemus leucogrammus0.012121
lower back0.012121
kingdom of spain0.012121
south africa0.012121
pavona varians0.012121
inguinal region0.012121
groin0.012121
nasal cavity mucosa0.012121
graz city district0.012121
axilla0.012121
external acoustic meatus0.012121
Exp. ID User ID Description Date Region Flag Sequences
245amnonhighfreq homo sapiens, breast milk, finland2017-11-21v4No1 / 4
158amnonhigh in skin of healthy cats compared to cats with skin allergy ( high in control compared to allergy atopic dermatitis in cat felis catus skin united states of america )2017-07-05v4No1 / 5
179amnonhighfreq mus musculus, mouse, oral cavity, research facility, united states of america, balb/c, mouth2017-08-13v4No1 / 7
418amnonhighfreq coral, ocean, turbinaria reniformis, mucus2018-12-02v4No1 / 7
245amnonhighfreq homo sapiens, breast milk, china2017-11-21v4No1 / 9
304amnonhighfreq united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 10
311amnonhighfreq united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 11
418amnonhighfreq coral, ocean, galaxea astreata, mucus2018-12-02v4No1 / 11
515amnonhighfreq poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 11
287amnon high in depth 1-2m compared to depth 6-7m in snow field mountain japan 2018-01-29v4No1 / 12
158amnonhighfreq united states of america, lower back, felis catus, cat2017-07-06v4No1 / 13
198amnon high in sediment compared to water in yellowstone national park united states of america geothermal field high temperature environment 2017-09-14v4No1 / 13
245amnoncommon homo sapiens, breast milk, kingdom of spain2017-11-21v4No1 / 13
534amnonhighfreq river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 13
245amnonhighfreq homo sapiens, breast milk, south africa2017-11-21v4No1 / 14
304amnoncandidate contaminants - higher in blanks (contamination)2018-03-12v4No1 / 14
397amnoncommon panama, digestive system, intestine, fungus growing ant, mycocepurus smithii2018-11-14v4No1 / 14
158amnoncommon united states of america, lower back, felis catus, cat2017-07-06v4No1 / 15
245amnoncommon homo sapiens, breast milk, china2017-11-21v4No1 / 15
418amnonhighfreq coral, ocean, seriatopora caliendrum, mucus2018-12-02v4No1 / 15
418amnonhighfreq coral, ocean, pavona varians, mucus2018-12-02v4No1 / 15
158amnonhighfreq united states of america, inguinal region, felis catus, cat, groin2017-07-06v4No1 / 16
345amnonhighfreq homo sapiens, nasal cavity, nasal cavity mucosa, austria, adult, graz city district2018-06-11v4No1 / 16
68amnonfound in some aphid samples (prevalence <=0.1) (other cinara)2017-02-20v4No1 / 17
158amnonhighfreq cat, felis catus, united states of america, axilla2017-07-06v4No1 / 17
287amnonhighfreq snow field, mountain, depth 1-2m, japan2018-01-29v4No1 / 17
418amnonhighfreq coral, ocean, acropora hyacinthus, tissue2018-12-02v4No1 / 17
158amnonhighfreq cat, felis catus, united states of america, external acoustic meatus, ear canal2017-07-06v4No1 / 18
245amnoncommon homo sapiens, breast milk, finland2017-11-21v4No1 / 18
245amnoncommon homo sapiens, breast milk, south africa2017-11-21v4No1 / 19
33amnonhighfreq homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 21
501amnoncommon costa rica, butterfly, digestive system, arawacus togarna2019-03-09v4No1 / 21
158amnoncommon cat, felis catus, united states of america, external acoustic meatus, ear canal2017-07-06v4No1 / 22
198amnonhighfreq sediment, yellowstone national park, united states of america, thermophilic sediment, geothermal field, high temperature environment2017-09-13v4No1 / 23
418amnoncommon coral, ocean, galaxea astreata, mucus2018-12-02v4No1 / 24
158amnoncommon united states of america, pair of nares, felis catus, cat2017-07-06v4No1 / 25
158amnonhigher in skin sites compared to mouth in cats ( high in skin compared to saliva mouth in felis catus cat united states of america )2017-07-06v4No1 / 26
311amnoncommon united states of america, state of rhode island, allium cepa, onion, foodon product type2018-04-09v4No1 / 26
158amnoncommon united states of america, inguinal region, felis catus, cat, groin2017-07-06v4No1 / 27
109amnoncommon water, drinking water, united states of america, site b2017-04-08v4No1 / 31
418amnoncommon coral, ocean, pavona varians, mucus2018-12-02v4No1 / 34
287amnoncommon snow field, mountain, depth 1-2m, japan2018-01-29v4No1 / 35
231amnonhigher in urine compared to genitalia in dogs ( high in urine compared to reproductive organ reproductive system genitalia in dog canis lupus familiaris united states of america )2017-11-02v4No1 / 36
311amnoncommon united states of america, state of rhode island, radish, foodon product type2018-04-09v4No1 / 36
158amnoncommon cat, felis catus, united states of america, axilla2017-07-06v4No1 / 37
345amnoncommon homo sapiens, nasal cavity, nasal cavity mucosa, austria, adult, graz city district2018-06-11v4No1 / 37
33amnoncommon homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 40
158amnoncommon united states of america, interdigital region, felis catus, cat2017-07-06v4No1 / 42
275amnonhigher in fall 2010 compared to summer 2013 in whale skin ( high in autumn compared to summer in megaptera novaeangliae humpback whale antarctica antarctic peninsula skin )2018-01-16v4No1 / 42
231amnoncommon in dog genitalia (common dog, canis lupus familiaris, united states of america, reproductive system, reproductive organ, genitalia)2017-11-02v4No1 / 43
547amnon high in high salt concentration compared to low salt concentration in red pepper sauce capsicum annuum sichuan province china food (fermented) 2019-08-15v4No1 / 43
287amnoncommon snow field, mountain, depth 6-7m, japan2018-01-29v4No1 / 47
279amnon high in mouth compared to small intestine stomach in ochotonidae pikas china 2018-01-24v4No1 / 53
109amnoncommon usa, water, drinking water, site a2017-04-08v4No1 / 54
354amnon high in bronchus bronchial epithelium bronchial brush compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 55
9amnonhigher in sea water with coral ( high in porites astreoides compared to control in bermuda sea water )2016-10-27v4No1 / 61
360amnoncommon agave, desert, root endosphere, mexico, guanajuato, agave tequiliana, cultivated environment, root2018-08-21v4No1 / 62
558amnon high in duodenum compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 64
109amnoncommon water, drinking water, united states of america, site d2017-04-08v4No1 / 67
311amnoncommon united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 68
231amnoncommon in dog urine (common dog, canis lupus familiaris, united states of america, urine)2017-11-02v4No1 / 69
9amnonhigher in beginning of experiment comapred to 12 days ( high in beginning compared to end in bermuda sea water )2016-10-27v4No1 / 71
109amnoncommon water, drinking water, united states of america, site e2017-04-08v4No1 / 80
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 80
269amnonpeaks at 2 weeks in refrigeration of yao meat ( high in middle timepoint two weeks compared to fresh food spoilage late timepoint in china foodon product type )2018-01-09v4No1 / 83
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
227amnonhiger in first 24hrs compared to later timepoints in baby nasopharynx ( high in age age <=24 hours compared to age >= 7 days in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v4No1 / 85
311amnoncommon in salted cabbage (common cabbage, united states of america, state of rhode island, foodon product type)2018-04-09v4No1 / 85
109amnoncommon usa, water, drinking water, site c2017-04-08v4No1 / 86
354amnon high in bronchus bronchial brush bronchial epithelium compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 94
558amnon high in colon compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 97
196amnonlower in water compared to biofilm ( high in biofilm compared to water in drinking water united states of america )2017-09-12v4No1 / 100
361amnoncommon leaf, austria, greenhouse, plant, malvaviscus penduliflorus2018-08-21v4No1 / 102
198amnoncommon yellowstone national park, united states of america, geothermal field, water, hot spring, high temperature environment2017-09-13v4No1 / 103
323amnonhigher in sharks compared to sea water ( high in shark compared to water surface water depth 0m sea water in atlantic ocean south florida state of florida united states of america )2018-04-24v4No1 / 107
271amnon high in root structure root compared to soil rhizosphere in depth 0-20cm glycine max soybean china 2018-01-09v4No1 / 110
198amnoncommon sediment, yellowstone national park, united states of america, thermophilic sediment, geothermal field, high temperature environment2017-09-13v4No1 / 113
269amnoncommon in fresh yao meat food (common china, foodon product type)2018-01-09v4No1 / 113
343amnoncommon in apple flowers (common apple, malus x domestica, flower structure, flower, united states of america, state of connecticut)2018-05-28v4No1 / 118
196amnoncommon in biofilm in tap water (common water, drinking water, united states of america, biofilm)2017-09-12v4No1 / 121
311amnoncommon united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 121
515amnoncommon whole body, beetle, aphodius depressus, detritivorous beetle, feces, bulgaria, balkan mountains2019-04-18v4No1 / 121
109amnon high in distribution system compared to water treatment plant in water drinking water united states of america site e 2017-04-08v4No1 / 143
291amnoncommon canis lupus familiaris, dog, pair of nares, nasal cavity, germany2018-02-01v4No1 / 144
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 146
85amnoncommon litopenaeus vannamei, pacific white shrimp, shenzhen city prefecture, digestive system, china, sea water2017-03-06v4No1 / 147
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
278amnon high in subgingival plaque compared to saliva in homo sapiens united states of america state of california adult 2018-01-23v4No1 / 149
361amnoncommon leaf, austria, greenhouse, plant, howea forsteriana2018-08-21v4No1 / 154
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
408amnon high in larval stage compared to stomach in ant costa rica united states of america pseudomyrmex spinicola 2018-11-22v4No1 / 165
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
323amnoncommon in shark gills (common atlantic ocean, south florida, state of florida, united states of america, shark, gill)2018-04-24v4No1 / 170
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 172
196amnoncommon water, drinking water, united states of america2017-09-12v4No1 / 178
311amnoncommon ginger, united states of america, state of rhode island, foodon product type2018-04-09v4No1 / 180
179amnoncommon mus musculus, mouse, oral cavity, research facility, united states of america, balb/c, mouth2017-08-13v4No1 / 183
109amnon high in water treatment plant compared to distribution system in usa water drinking water site c 2017-04-08v4No1 / 193
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 193
170amnoncommon river, water, fresh water, depth 10 cm, united states of america, stream2017-07-24v4No1 / 194
323amnoncommon in shark skin (common atlantic ocean, south florida, state of florida, united states of america, shark, skin)2018-04-24v4No1 / 213
138amnoncommon in ocean water depth 5m (common ocean, pacific ocean, depth 5m, sea water)2017-04-18v4No1 / 214
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 232
342amnoncommon water, pacific ocean, philippine sea, surface water, sea water2018-05-28v4No1 / 236
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 236
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, monterey bay2018-03-12v4No1 / 263
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
441amnonhigher before antibiotic treatment ( high in control compared to antibiotic cefoperazone in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 275
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 315
309amnon high in other plants compared to meadow pea-vine lathyrus pratensis in rhizosphere germany 2018-04-05v4No1 / 316
342amnoncommon water, pacific ocean, philippine sea, depth 300m, sea water2018-05-28v4No1 / 323
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 365
170amnonhigher in low turbidity river water ( high in low turbidity turbidity compared to high turbidity in river water fresh water depth 10 cm united states of america stream )2017-07-24v4No1 / 395
342amnoncommon water, pacific ocean, philippine sea, depth 150m, sea water2018-05-28v4No1 / 397
558amnon high in gizzard compared to crop in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 408
577amnon high in monimolimnion depth 4-9m high salinity hypersaline water compared to low salinity mixolimnion depth 0-3m in lake water water ursu lake romania lake 2020-01-09v3No1 / 439
373amnoncommon soil, rhizosphere, oryza sativa, rice, hunan province, rice field, china2018-09-08v4No1 / 501
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 518
98amnoncommon citrus, rhizosphere, vero beach, fl, root, state of florida2017-04-01v4No1 / 544
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
138amnoncommon in ocean water depth 1000m (common sea water, ocean, pacific ocean, depth 1000m)2017-04-18v4No1 / 566
138amnoncommon in ocean water depth 150-500m (common sea water, ocean, pacific ocean, depth 150-500m)2017-04-18v4No1 / 582
146amnon high in rhizosphere compared to soil in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 590
536amnon high in terrestrial snake compared to aquatic snake in snake skin united states of america southern united states 2019-07-28v4No1 / 590
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
138amnoncommon in ocean water depth 2000-4000m (common sea water, ocean, pacific ocean, depth 2000-4000m)2017-04-18v4No1 / 674
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 750
309amnon high in plantago lanceolata ribwort plantain compared to other plants in rhizosphere germany 2018-04-05v4No1 / 800
548amnoncommon in endopytic roots of Vellozia epidendroides (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, plant, root)2019-08-15v4No1 / 800
421amnoncommon in paddy field soil incubated without copper (common research facility, soil, paddy field soil, zhejiang province, china)2018-12-02v4No1 / 824
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 830
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
444amnoncommon in uncultivated soil plot (common yellow brown soil, nanjing city prefecture, soil, china)2019-01-07v4No1 / 946
83amnon high in diet control normal diet compared to restricted diet in bos taurus rumen holstein-friesian bull ireland 2017-03-05v4No1 / 1023
548amnoncommon minas gerais state, campos rupestres, brazil, rhizosphere, vellozia epidendroides2019-08-15v4No1 / 1040
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
93amnoncommon in marine sediment near the shore in hawaii (common hawaii, shore, marine sediment)2017-03-12v4No1 / 1151
266amnon high in leaf compared to root in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 1175
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
309amnoncommon rhizosphere, germany, prunella vulgaris, woundwort2018-04-05v4No1 / 1217
505amnon high in particle bound size 1-80um compared to free floating size < 1um in water pacific ocean state of california surface water sea water 2019-03-14v4No1 / 1218
309amnoncommon rhizosphere, germany, latyrus pratensis, meadow pea-vine2018-04-05v4No1 / 1296
309amnoncommon rhizosphere, germany, onobrychis viciifolia, common sainfoin2018-04-05v4No1 / 1323
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
309amnoncommon rhizosphere, germany, plantago lanceolata, ribwort plantain2018-04-05v4No1 / 1386
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
309amnoncommon rhizosphere, germany, geranium pratense, meadow geranium2018-04-05v4No1 / 1434
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v4No1 / 1439
271amnoncommon rhizosphere, glycine max, depth 0-20cm, soybean, china2018-01-09v4No1 / 1459
548amnoncommon in phosphorus impoverished soil (common soil, minas gerais state, campos rupestres, brazil, ph 3.5)2019-08-15v4No1 / 1483
309amnoncommon rhizosphere, germany, festuca rubra, red fescue grass2018-04-05v4No1 / 1510
304amnonlower in seawater compared to beach sand ( high in sand compared to water sea water in united states of america state of california beach pacific ocean )2018-03-12v4No1 / 1599
309amnoncommon rhizosphere, germany, galium mollugo, hedge bedstraw2018-04-05v4No1 / 1599
141amnoncommon marine sediment, brackish water, sediment, caspian sea, depth 200m, sample depth 12-35cm2017-04-18v4No1 / 1659
154amnon high in control compared to uranium high uranium in soil australia kakadu national park sediment 2017-06-29v4No1 / 1663
309amnoncommon rhizosphere, germany, veronica chamaedrys, germander speedwell2018-04-05v4No1 / 1788
156amnoncommon soil, rhizosphere, brassica, brassica oleracea, china2017-07-27v4No1 / 1885
271amnoncommon depth 0-20cm, soil, china2018-01-09v4No1 / 2856
265amnon high in soilwater water compared to soil in canada province of quebec 2017-12-11v4No1 / 3277
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>5, ph<6, china2018-02-11v4No1 / 3508
100amnon high in ph ph<5.5 compared to ph>5.5 in soil urban biome park new york city central park 2017-04-03v4No1 / 4262

Problems / suggestions? Please email info AT dbbact DOT org