Search result for sequence:
TACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGCTTTGCAAGACAGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATTTGTGACTGCATGGCTGGAGTGCGGCAGAGGGGGATGGAATTCCGCG
common ontology terms
term enrichment score
TermScore
soil0.565412
rhizosphere0.313857
china0.212412
cultivated environment0.191630
depth (soil) 0-10cm0.141176
united states of america0.135310
silt loam0.123457
robinia pseudoacacia0.114094
reforestation0.114094
shaanxi province0.114094
loess plateau0.107937
kellogg biological station0.102041
mesic type hapludalf0.102041
kalamazoo loam0.102041
forest ecosystem0.100756
oryza sativa0.097054
leaf0.093101
root0.089085
topsoil0.085809
depth (soil) 0-20cm0.077519
citrus0.075472
skin0.074468
zea mays0.073171
woodland area0.072727
state of michigan0.072464
ph 60.071685
glycine max0.071048
tree0.068966
paddy field soil0.064865
farm0.063694
state of tennessee0.063694
wheat0.062827
desert0.062500
state of idaho0.061856
brazil0.058680
restored prairie0.057143
triticum aestivum0.055944
mexico0.053333
heilongjiang province0.051002
ph 7-80.050847
ph 6-70.050847
state of new york0.050633
permafrost0.050360
populus0.050360
united states0.050360
nicollet soil series0.050360
des moines0.050360
panicum virgatum0.050360
agricultural feature0.050000
iowa0.049123
orchard0.047945
state of california0.047619
north china plain0.043478
yunwushan national natural grassland protection zone0.043478
ningxia province0.043478
calci-orthic aridisol0.043478
haplic calcisol0.043478
grazing exclusion0.043478
10 years0.043478
20 years0.043478
hunan province0.043165
depth (soil) 0-15cm0.042553
corn0.042553
winter0.042360
kingdom of norway0.041667
agricultural field0.040230
jiangsu province0.039604
pasture0.036832
svalbard archipelago0.036496
east antarctica0.036496
nunatak0.036496
depth (soil) 2cm0.036496
miscanthus0.036496
gleysol0.036496
sihong county0.036496
chenwei forest0.036496
poplar plantation0.036496
poplar0.036496
30 years0.036496
depth (soil) 10-25cm0.035842
depth (soil) 25-50cm0.035842
clay loam0.035842
wild0.035088
antarctica0.034014
canada0.033898
state of florida0.032362
united kingdom0.030864
brassica oleracea0.029630
ph 5.90.029630
depth 10-20cm0.029630
merlot0.029412
grapevine0.029412
hedera hibernica0.029412
ivy0.029412
myrtillocactus geometrizans0.029412
opuntia robusta0.029412
taxus0.029412
boechera stricta0.029412
depth (soil) 20-30cm0.029412
cambridgeshire0.029412
Fraction of dbbact annotations with this term covered by the query
TermScore
jinxiang county1.000000
LOWER IN low npk fertilizer dose1.000000
high npk fertilizer dose1.000000
snow0.750000
cultivated environment0.750000
brassica oleracea0.666667
fen0.666667
ph 60.666667
soybean0.666667
pasture0.666667
heilongjiang province0.666667
paddy field soil0.666667
ph 5.90.666667
depth 10-20cm0.666667
depth 5cm0.600000
rhizosphere0.574468
oryza sativa0.571429
glycine max0.571429
achatinella mustelina0.500000
environmental system determined by an organism0.500000
maryland county0.500000
field soil0.500000
non-seleniferous0.500000
LOWER IN seleniferous0.500000
seleniferous0.500000
temperate grassland biome0.500000
peat soil0.500000
flooded grassland biome0.500000
quincy, fl0.500000
immokalee, fl0.500000
ft. pierce, fl0.500000
gainesville, fl0.500000
anaxyrus americanus0.500000
american toad0.500000
central park0.500000
merlot0.500000
grapevine0.500000
winter barley0.500000
hedera hibernica0.500000
ivy0.500000
LOWER IN scrubland0.500000
LOWER IN moor0.500000
moor0.500000
scrubland0.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
ph 6-6.50.500000
root zone soil0.500000
taxus0.500000
taxus cuspidata0.500000
LOWER IN taxus media0.500000
taxus media0.500000
temperate0.500000
taxus mairei0.500000
rice0.500000
tomato0.500000
slit loam soil0.500000
slit loam0.500000
phyllosphere0.500000
ph 7-90.500000
quarry0.500000
greenschist0.500000
size < 10um0.500000
dust storm0.500000
stratovolcano0.500000
LOWER IN wound0.500000
LOWER IN ulcer0.500000
arachis hypogaea0.500000
peanut0.500000
LOWER IN soilwater0.500000
ph 5.50.500000
boechera stricta0.500000
grassland0.500000
steppe0.500000
alpine soil0.500000
north china plain0.500000
ph>80.500000
ph>7, ph<80.500000
ph>6, ph<70.500000
ph>5, ph<60.500000
ph>4, ph<50.500000
state of utah0.500000
depth 1cm0.500000
soil crust0.500000
geranium pratense0.500000
meadow geranium0.500000
LOWER IN other plants0.500000
svalbard archipelago0.500000
permafrost0.500000
depth (soil) 20-30cm0.500000
depth 100-150cm0.500000
depth 150-200cm0.500000
LOWER IN permafrost transition layer0.500000
LOWER IN depth 100-150cm0.500000
LOWER IN depth 150-200cm0.500000
lissotriton vulgaris0.500000
cambridgeshire0.500000
triturus cristatus0.500000
ph 5.40.500000
snow covered soil0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.659091
china0.356061
united states of america0.284091
rhizosphere0.215909
cultivated environment0.109848
depth (soil) 0-10cm0.083333
silt loam0.075758
robinia pseudoacacia0.064394
reforestation0.064394
loess plateau0.064394
shaanxi province0.064394
forest ecosystem0.056818
depth (soil) 0-20cm0.056818
state of michigan0.056818
kellogg biological station0.056818
mesic type hapludalf0.056818
kalamazoo loam0.056818
leaf0.053030
oryza sativa0.053030
root0.049242
topsoil0.049242
woodland area0.045455
skin0.045455
citrus0.041667
tree0.041667
farm0.041667
zea mays0.041667
ph 60.037879
glycine max0.037879
state of tennessee0.037879
wheat0.034091
state of idaho0.034091
desert0.034091
brazil0.034091
paddy field soil0.034091
state of new york0.030303
mexico0.030303
triticum aestivum0.030303
state of california0.030303
agricultural feature0.030303
ph 7-80.030303
ph 6-70.030303
restored prairie0.030303
winter0.026515
permafrost0.026515
heilongjiang province0.026515
orchard0.026515
populus0.026515
united states0.026515
nicollet soil series0.026515
des moines0.026515
iowa0.026515
agricultural field0.026515
panicum virgatum0.026515
canada0.022727
north china plain0.022727
kingdom of norway0.022727
wild0.022727
hunan province0.022727
jiangsu province0.022727
depth (soil) 0-15cm0.022727
corn0.022727
yunwushan national natural grassland protection zone0.022727
ningxia province0.022727
calci-orthic aridisol0.022727
haplic calcisol0.022727
grazing exclusion0.022727
10 years0.022727
20 years0.022727
state of florida0.018939
united kingdom0.018939
plant0.018939
svalbard archipelago0.018939
pasture0.018939
antarctica0.018939
east antarctica0.018939
nunatak0.018939
depth (soil) 2cm0.018939
depth (soil) 10-25cm0.018939
depth (soil) 25-50cm0.018939
miscanthus0.018939
clay loam0.018939
gleysol0.018939
sihong county0.018939
chenwei forest0.018939
poplar plantation0.018939
poplar0.018939
30 years0.018939
brassica oleracea0.015152
merlot0.015152
vitis vinifera0.015152
grapevine0.015152
LOWER IN root0.015152
hedera hibernica0.015152
belgium0.015152
ivy0.015152
myrtillocactus geometrizans0.015152
opuntia robusta0.015152
cactus0.015152
semi-arid0.015152
Exp. ID User ID Description Date Region Flag Sequences
462amnoncommon united states of america, state of tennessee, populus, tree, root, cultivated environment2019-01-13v4No1 / 51
558amnon high in crop compared to gizzard in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 69
28amnoncommon hawaii, feces, terrestrial biome, achatinella mustelina, environmental system determined by an organism2016-12-05v4No1 / 71
512amnon high in depth (soil) 10 cm depth (soil) 0-20cm compared to depth (soil) 60cm in fen peatland peat soil soil china 2019-03-22v4No1 / 77
356amnonlower in non-snow covered period ( high in snow snow covered soil winter compared to non snow covered soil summer in soil depth (soil) 0-10cm hokkaido topsoil ph 5.4 forest ecosystem japan )2018-08-15v4No1 / 78
426amnoncommon soil, tundra, permafrost, russia, nenets autonomous okrug2018-12-08v4No1 / 81
279amnoncommon grassland, leaf, stem, steppe, mongolia, china2018-01-24v4No1 / 83
527amnoncommon soil, antarctica, east antarctica, nunatak, depth (soil) 2cm, robertskollen2019-07-14v4No1 / 91
769sheryoHigh in conventional tillage compared to no tillage in wheat field in northern israel ( high in conventional tillage compared to no tillage in bulk soil soil vertisol israel northen israel triticum aestivum )2021-04-18v4No1 / 91
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, external naris, pair of nares2020-01-22v4No1 / 92
536amnoncommon snake, skin, united states of america, southern united states, fossorial snake, storeria dekayi, ground snake2019-07-28v4No1 / 101
582amnon high in ear canal external acoustic meatus compared to lip labial commissure in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 105
128amnonhigher in ivy leaves from forest compared to moor ( high in forest ecosystem compared to scrubland moor in hedera hibernica belgium ivy leaf )2017-04-14v4No1 / 123
1008amnon high in high npk fertilizer dose compared to low npk fertilizer dose in rhizosphere ph 7-8 jinxiang county garlic allium sativum fertilized soil farm china 2023-01-26v4No1 / 123
347amnoncommon kingdom of norway, svalbard archipelago, permafrost, soil, depth 150-200cm2018-07-15v4No1 / 126
514amnoncommon united states of america, state of utah, sandstone, grand staircase-escalante national park, desert, depth (soil) 0-1cm2019-03-25v4No1 / 139
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, axilla2020-01-22v4No1 / 140
29amnoncommon brassica oleracea, french republic, seed2016-12-05v4No1 / 146
837sheryoHigher at 100-300cm depth compared 40-100cm to in soil after 10 years reforestation with Black locust trees, shaanxi, China ( high in depth 100-300cm compared to depth 40-100cm in robinia pseudoacacia 10 years reforestation silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 154
347amnoncommon kingdom of norway, svalbard archipelago, permafrost, soil, depth 100-150cm2018-07-15v4No1 / 173
384amnoncommon equus caballus, horse, canada, farm, nasal cavity, pair of nares, pasture2018-10-22v4No1 / 175
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, anaxyrus americanus, american toad2017-04-02v4No1 / 176
316amnoncommon united states of america, soil, topsoil, state of ohio, depth (soil) 0-10cm, ph 5, forest ecosystem2018-04-10v4No1 / 199
527amnoncommon soil, antarctica, east antarctica, nunatak, depth (soil) 2cm, brugdedalen2019-07-14v4No1 / 200
224amnoncommon united states of america, state of oregon, snow field, glacier, stratovolcano, snow2017-10-26v4No1 / 204
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 213
279amnoncommon grassland, steppe, mongolia, soil, china2018-01-24v4No1 / 235
384amnon high in pasture compared to barn hay in equus caballus horse canada farm saliva mouth 2018-10-22v4No1 / 245
279amnoncommon grassland, soil, alpine soil, tibetan plateau, china2018-01-24v4No1 / 253
205amnoncommon in Ely Greenstone rock piles (common rock, united states of america, quarry, state of minnesota, ph 7, greenschist)2017-10-03v4No1 / 255
134amnon high in taxus cuspidata compared to taxus media in rhizosphere tree taxus china 2017-04-16v4No1 / 279
527amnoncommon soil, antarctica, east antarctica, nunatak, depth (soil) 2cm, lorentzenpiggen2019-07-14v4No1 / 280
156amnoncommon brassica, brassica oleracea, leaf, phyllosphere, china2017-07-27v4No1 / 292
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common maryland county, leaf)2016-12-09v4No1 / 298
384amnon high in pasture compared to barn hay in equus caballus horse canada farm nasal cavity pair of nares 2018-10-22v4No1 / 304
432amnoncommon united states of america, plant, state of north carolina, stem, tsuga dumosa, himalayan hemlock2018-12-19v4No1 / 309
879amnoncommon canis lupus, wolf, adult organism, chest, captive, austria, skin, research facility2022-03-12v4No1 / 320
512amnoncommon fen, peatland, peat soil, soil, hani peatland, baekdudaegan, ph 5-6, china2019-03-22v4No1 / 329
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, rhizosphere, semi-arid2017-04-15v4No1 / 338
527amnoncommon soil, antarctica, east antarctica, nunatak, valterkulten, depth (soil) 2cm2019-07-14v4No1 / 364
527amnoncommon soil, antarctica, east antarctica, nunatak, depth (soil) 2cm, grunehogna2019-07-14v4No1 / 367
582amnon high in ear canal external acoustic meatus compared to perianal skin rectum in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 374
426amnon high in mature soil compared to sand in soil tundra permafrost russia nenets autonomous okrug 2018-12-08v4No1 / 377
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
879amnoncommon dog, canis lupus familiaris, adult organism, chest, captive, austria, skin, research facility2022-03-12v4No1 / 399
28amnon high in feces achatinella mustelina compared to whole plant leaf in hawaii 2016-12-05v4No1 / 413
353amnoncommon in wild Lissotriton vulgaris newts skin (common newt, adult, skin, lissotriton vulgaris, cambridgeshire, united kingdom)2018-07-30v4No1 / 418
360amnoncommon desert, soil, rhizosphere, agave, agave deserti, state of california2018-08-21v4No1 / 432
360amnoncommon desert, soil, mexico, guanajuato2018-08-21v4No1 / 437
353amnoncommon in wild Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, united kingdom)2018-07-30v4No1 / 456
128amnoncommon hedera hibernica, belgium, ivy, leaf, city, dense settlement biome2017-04-14v4No1 / 461
357amnoncommon soil, topsoil, depth (soil) 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 474
813amnoncommon intact branch, epiphytic material, united states of america, state of washington, olympic national park, canopy soil, soil2021-06-22v4No1 / 475
360amnoncommon desert, soil, rhizosphere, agave, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 484
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 492
415amnoncommon rhizosphere, soil, citrus, orchard, united states of america, cultivated environment2018-11-27v4No1 / 494
357amnoncommon soil, topsoil, depth (soil) 0-10cm, southern temperate forest, temperate broadleaf and mixed forest biome, woodland area, forest ecosystem2018-08-19v4No1 / 499
360amnoncommon desert, soil, mexico, guanajuato, cultivated environment2018-08-21v4No1 / 500
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in corn agriculture fields, Iowa USA ( high in depth (soil) 0-15cm compared to depth (soil) 60-90cm in kanawha nicollet soil series des moines united states agricultural field iowa zea mays soil )2021-06-15v4No1 / 501
357amnoncommon soil, topsoil, depth (soil) 0-10cm, subpolar coniferous forest biome, boreal forest, woodland area, forest ecosystem2018-08-19v4No1 / 538
98amnoncommon citrus, rhizosphere, immokalee, fl, root, state of florida2017-04-01v4No1 / 543
548amnoncommon in leaf surface of barbacenia macrantha (common minas gerais state, campos rupestres, brazil, barbacenia macrantha, leaf, leaf surface)2019-08-17v4No1 / 550
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree leaf cultivated environment 2019-01-13v4No1 / 559
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf2017-04-15v4No1 / 562
357amnoncommon soil, topsoil, depth (soil) 0-10cm, mediterranean forest biome, forest ecosystem, woodland area2018-08-19v4No1 / 564
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
357amnoncommon soil, topsoil, depth (soil) 0-10cm, montane forest, woodland area, forest ecosystem2018-08-19v4No1 / 592
415amnoncommon rhizosphere, soil, citrus, orchard, south africa, cultivated environment2018-11-27v4No1 / 600
357amnoncommon soil, topsoil, depth (soil) 0-10cm, savanna, forest ecosystem, woodland area2018-08-19v4No1 / 614
128amnoncommon hedera hibernica, belgium, ivy, leaf, moor, scrubland2017-04-14v4No1 / 623
813amnoncommon severed branch, epiphytic material, united states of america, state of washington, olympic national park, canopy soil, soil2021-06-22v4No1 / 633
609sheryoCommon in soil with tobacco plants amended with difenoconazole fungicide and biochar (common biochar, tobacco plant present, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 634
360amnoncommon desert, soil, state of california2018-08-21v4No1 / 637
360amnoncommon agave, desert, state of california, agave deserti, leaf, leaf surface2018-08-21v4No1 / 649
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
609sheryocommon in soil with tobacco plants amended with difenoconazole fungicide (common tobacco plant present, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 671
357amnoncommon in temperate deciduous forests around the world (common soil, topsoil, depth (soil) 0-10cm, temperate woodland biome, temperate deciduos forest, woodland area, forest ecosystem)2018-08-18v4No1 / 681
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 6-7, cultivated environment, china2018-12-04v4No1 / 682
100amnoncommon soil, urban biome, park, new york city, central park2017-04-03v4No1 / 685
309amnon high in geranium pratense meadow geranium compared to other plants in rhizosphere germany 2018-04-05v4No1 / 688
128amnoncommon hedera hibernica, belgium, ivy, leaf, forest ecosystem2017-04-14v4No1 / 693
347amnoncommon kingdom of norway, svalbard archipelago, permafrost, soil, depth (soil) 20-30cm2018-07-15v4No1 / 698
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin australia foot )2017-11-05v4No1 / 708
357amnon high in ph>3 compared to ph<3 in soil topsoil depth (soil) 0-10cm subpolar coniferous forest biome boreal forest woodland area forest ecosystem 2018-08-19v4No1 / 719
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 5-6, cultivated environment, china2018-12-04v4No1 / 726
462amnoncommon depth (soil) 20-60cm, united states of america, state of tennessee, soil, depth 30-75cm, silt clay loam, cultivated environment2019-01-13v4No1 / 728
813amnoncommon forested area, temperate rainforest, united states of america, state of washington, olympic national park, soil2021-06-22v4No1 / 740
415amnoncommon rhizosphere, soil, citrus, australia, orchard, cultivated environment2018-11-27v4No1 / 743
600sheryoDecreases after 12 days of stover ammendment in soil ( high in day 1 compared to day 12 in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 stover ammendment soil )2020-03-27v4No1 / 747
791sheryoHigher at 0cm depth compared to 80cm depth in low saline low sodicity soil in China ( high in depth (soil) 0-20cm depth 0cm compared to depth (soil) 80cm in ph 9 low salinity low sodicity soil salic solonetz da'an station china songnen plain )2021-06-08v4No1 / 748
357amnon high in ph>4 compared to ph<4 in soil topsoil depth (soil) 0-10cm southern temperate forest temperate broadleaf and mixed forest biome woodland area forest ecosystem 2018-08-19v4No1 / 761
813amnonlower in epiphytic materiall attached to intact branch compared to severed suspended branch ( high in severed branch compared to intact branch in epiphytic material united states of america state of washington olympic national park canopy soil soil )2021-06-22v4No1 / 768
171amnoncommon soil, united states of america, state of california, rhizosphere, oryza sativa, rice2017-07-25v4No1 / 772
615amnoncommon endosphere, root, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 776
821sheryoHigher at 25-50cm depth compared to 50-100cm depth in soil in Michigan USA ( high in depth (soil) 25-50cm compared to depth 50-100m in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 784
347amnon high in depth (soil) 20-30cm compared to depth (soil) 0-20cm permafrost transition layer in kingdom of norway svalbard archipelago permafrost soil 2018-07-15v4No1 / 788
828sheryoCommon in gleysol soil of poplar plantation at 40-50cm depth, sihong, china (common depth 40-50cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 790
384amnon high in pair of nares nasal cavity compared to oral cavity saliva mouth in equus caballus horse canada farm 2018-10-22v4No1 / 791
824sheryoHigher at 0-10cm depth compared to 10-20cm depth in soil after grazing exclusion at 0-10cm depth, Ningxia china ( high in depth (soil) 0-10cm compared to depth 10-20cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 807
480amnoncommon soil, pasture, farm, ireland2019-02-05v4No1 / 816
422amnoncommon soil, paddy field soil, oryza sativa, yunnan province, china, cultivated environment2018-12-02v4No1 / 821
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 830
837sheryoHigher at 0-40cm depth compared to 40-100cm in soil after 10 years reforestation with Black locust trees, shaanxi, China ( high in depth 0-40cm compared to depth 40-100cm in robinia pseudoacacia 10 years reforestation silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 831
356amnoncommon in deciduous broad leaved forest top soil in japan (common soil, depth (soil) 0-10cm, hokkaido, topsoil, ph 5.4, japan, forest ecosystem)2018-08-15v4No1 / 834
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
801sheryoCommon at depth 15-30cm in corn and soybean agriculture fields, Iowa USA (common ph 6, depth (soil) 15-30cm, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 841
266amnoncommon in roots in JAM garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 843
828sheryoCommon in gleysol soil of poplar plantation at 30-40cm depth, sihong, china (common depth 30-4cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 844
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph>5, china2018-11-26v4No1 / 856
801sheryoCommon at depth 0-15cm in corn agriculture fields, Iowa USA (common kanawha, ph 7.1, nicollet soil series, depth (soil) 0-15cm, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 862
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil2017-04-15v4No1 / 884
171amnoncommon in soil with rice growth irrigation protocol (common soil, united states of america, state of california, depth 5cm)2017-07-25v4No1 / 890
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
788amnoncommon soil, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 897
479amnoncommon rhizosphere, united states of america, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 900
206amnoncommon in dust storm air from israel particles <10um size (common israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 902
462amnoncommon depth (soil) 20-60cm, united states of america, state of tennessee, depth 30-75cm, silt clay loam, rhizosphere, populus, tree, cultivated environment2019-01-13v4No1 / 908
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide and biochar (common biochar, without plants, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-07-05v4No1 / 910
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide (common without plants, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-07-05v4No1 / 915
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
126amnoncommon rhizosphere, germany, hordeum vulgare, winter barley2017-04-14v4No1 / 925
791sheryoHigher in low sodicity and low salinity soil compared to high sodicity and high salinity soil at 0cm depth in China ( high in ph 8.5 low sodicity low salinity compared to ph 10.5 high sodicity high salinity in depth (soil) 0-20cm depth 0cm soil salic solonetz da'an station china songnen plain )2021-06-08v4No1 / 932
462amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, united states of america, state of tennessee, soil, silt loam, cultivated environment2019-01-13v4No1 / 938
444amnoncommon in uncultivated soil plot (common yellow brown soil, nanjing city prefecture, soil, china)2019-01-07v4No1 / 946
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
98amnoncommon citrus, rhizosphere, quincy, fl, root, state of florida2017-04-01v4No1 / 950
422amnoncommon soil, paddy field soil, jiangsu province, oryza sativa, china, cultivated environment2018-12-02v4No1 / 957
821sheryoCommon in soil of continuous corn field at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 963
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, root zone soil2017-04-15v4No1 / 968
821sheryoCommon in soil of restored prairie at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 968
480amnoncommon soil, pasture, farm, new zealand2019-02-05v4No1 / 970
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus mairei, china2017-04-16v4No1 / 973
474amnoncommon soil, farm, glycine max, soybean, ph 4-6, brazil, cultivated environment2019-01-16v4No1 / 974
615amnoncommon saccharum, sugarcane, rhizosphere, campinas, brazil, greenhouse2020-04-27v4No1 / 974
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, state of michigan, soil, united states of america)2021-08-03v4No1 / 974
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common panicum virgatum, depth (soil) 25-50cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, state of michigan, soil, united states of america)2021-08-03v4No1 / 974
266amnoncommon in soil from MIL garden (common soil, united states of america, state of idaho, ph 6.5)2017-12-18v4No1 / 980
675sheryoCommon in watermelon rhizosphere soil (common co culture with wheat (triticum aestivum l.), un-inoculated, ph 7, citrullus lanatus, rhizosphere, china)2028-02-22v4No1 / 980
828sheryoCommon in gleysol soil of poplar plantation at 20-30cm depth, sihong, china (common depth (soil) 20-30cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 989
462amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, united states of america, state of tennessee, rhizosphere, populus, tree, silt loam, cultivated environment2019-01-13v4No1 / 997
412amnon high in ph>5 compared to ph<5 in soil hunan province red soil cambisol zea mays triticum aestivum china 2018-11-26v4No1 / 1005
479amnoncommon rhizosphere, united states of america, state of california, heteromeles arbutifolia, ph 6-72019-02-05v4No1 / 1006
266amnoncommon in soil from PAR garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1032
791sheryoCommon at 0cm depth in low saline low sodicity soil in China (common depth (soil) 0-20cm, ph 8.5, depth 0cm, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-07v4No1 / 1035
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in corn and soybean agriculture fields, Iowa USA ( high in depth (soil) 0-15cm compared to depth (soil) 60-90cm in subsurface drainage glycine max kelley nicollet soil series des moines united states agricultural field iowa zea mays soil )2021-06-16v4No1 / 1036
824sheryoHigher at 10-20cm depth compared to 20-40cm depth in soil after grazing exclusion, Ningxia china ( high in depth 10-20cm compared to depth 20-40cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 1038
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, china, cultivated environment2018-12-02v4No1 / 1049
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 100-300cm depth, shaanxi, China (common depth 100-300cm, robinia pseudoacacia, 10 years, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1061
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 40-100cm depth, shaanxi, China (common depth 40-100cm, robinia pseudoacacia, 10 years, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1065
828sheryoCommon in gleysol soil of poplar plantation at 0-10cm depth, sihong, china (common depth (soil) 0-10cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 1069
347amnon high in depth (soil) 20-30cm compared to depth 100-150cm depth 150-200cm in kingdom of norway svalbard archipelago permafrost soil 2018-07-15v4No1 / 1080
265amnoncommon canada, province of quebec, soil2017-12-11v4No1 / 1090
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
415amnoncommon rhizosphere, soil, citrus, orchard, kingdom of spain, cultivated environment2018-11-27v4No1 / 1099
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in soybean and corn agriculture fields , Iowa USA ( high in depth (soil) 0-15cm compared to depth (soil) 60-90cm in united states nicollet soil series glycine max zea mays ames des moines iowa agricultural field soil )2021-06-15v4No1 / 1102
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, npk fertilizer, ph<6, china2018-11-26v4No1 / 1105
101amnoncommon state of new york, merlot, vitis vinifera, grapevine, united states of america, root2017-04-03v4No1 / 1106
266amnoncommon in roots in MAH garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1110
828sheryoCommon in gleysol soil of poplar plantation at 10-20cm depth, sihong, china (common depth 10-20cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 1123
146amnon high in soil compared to rhizosphere in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 1135
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus cuspidata, china2017-04-16v4No1 / 1141
146amnoncommon united states of america, solanum lycopersicum, tomato, soil, slit loam soil, ph 62017-04-20v4No1 / 1144
791sheryoCommon at 20cm depth in low saline low sodicity soil in China (common ph 9, depth 20cm, ph 8.5, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-08v4No1 / 1155
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 7-8, cultivated environment, china2018-12-04v4No1 / 1169
615amnon high in rhizosphere compared to soil in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 1181
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
801sheryoCommon at depth 0-15cm in corn and soybean agriculture fields, Iowa USA (common subsurface drainage, ph 6.2, depth (soil) 0-15cm, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 1202
444amnonlower in continuously cropped strawberry soil ( high in age 1 year compared to age 5 years age 10 years continuous cropping in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture china cultivated environment )2019-01-07v4No1 / 1221
801sheryoCommon in soybean and corn agriculture fields at depth 0-15cm, Iowa USA (common united states, ph 7.5, nicollet soil series, depth (soil) 0-15cm, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 1226
423amnon high in no human contact chernobyl exclusion zone compared to human contact in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 1229
821sheryoCommon in soil of restored prairie at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1241
134amnoncommon rhizosphere, tree, taxus, taxus media, northeast china, temperate, china2017-04-16v4No1 / 1251
298amnoncommon soil, desert, united states of america, state of utah, depth 1cm, soil crust2018-02-20v4No1 / 1265
675sheryoCommon in watermelon rhizosphere soil inoculated with Fusarium oxysporum f. sp. niveum (common china, rhizosphere, citrullus lanatus, co culture with wheat (triticum aestivum l.), ph 7, inoculated with fusarium oxysporum f. sp. niveum)2028-02-22v4No1 / 1271
415amnoncommon rhizosphere, soil, citrus, orchard, italy, cultivated environment2018-11-27v4No1 / 1279
788amnon high in soil compared to plant litter in mesocosm state of georgia united states of america 2021-05-31v4No1 / 1280
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, ph>6, china2018-11-26v4No1 / 1282
821sheryoCommon in soil of restored prairie at 0-10cm depth, Michigan USA (common ph 6.5, depth (soil) 0-10cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1291
837sheryoCommon in soil at 0-40-100cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common depth 40-100cm, 20 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1294
266amnonCommon in soil from MAH garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1299
837sheryoCommon in soil at 40-100cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common depth 40-100cm, 30 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1311
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 0-40cm depth, shaanxi, China (common depth 0-40cm, robinia pseudoacacia, 10 years, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1317
837sheryoCommon in soil at 100-300cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common depth 100-300cm, 20 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1317
837sheryoCommon in soil at 0-40cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common 20 years, depth 0-40cm, robinia pseudoacacia, loess plateau, shaanxi province, china, reforestation, silt loam, soil)2021-09-26v4No1 / 1323
600sheryoCommon in biochar ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, biochar, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1326
600sheryoCommon in stover ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82, stover ammendment )2020-03-27v4No1 / 1327
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
98amnoncommon citrus, rhizosphere, ft. pierce, fl, root, state of florida2017-04-01v4No1 / 1340
837sheryoCommon in soil at 0-40 cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common 30 years, depth 0-40cm, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1346
837sheryoCommon in soil at 100-300cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common depth 100-300cm, 30 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1354
809amnoncommon dendrobium huoshanense, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1356
98amnoncommon citrus, rhizosphere, gainesville, fl, root, state of florida2017-04-01v4No1 / 1371
821sheryoCommon in soil of miscanthus field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 1377
901amnoncommon in macrophyte plant rhizosphere (common rhizosphere, depth (sediment) 0-20cm, taihu lake, taihu national park, china, depth (water) 20-100cm, lake sediment)2022-04-25v4No1 / 1378
821sheryoCommon in soil of continuous corn field at 0-10cm depth, Michigan USA (common united states of america, state of michigan, kellogg biological station, ph 5.9, mesic type hapludalf, kalamazoo loam, depth (soil) 0-10cm, continuous corn, corn, soil)2021-07-28v4No1 / 1380
883amnon high in non-contaminated soil compared to oil contaminated soil oilfield in yellow river delta china shengli oilfield soil 2022-03-20v4No1 / 1381
821sheryoHigher at 0-10cm depth compared to 10-25cm depth in soil in Michigan USA ( high in depth (soil) 0-10cm compared to depth (soil) 10-25cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 1383
821sheryoCommon in soil of switchgrass field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, state of michigan, soil, united states of america)2021-08-02v4No1 / 1387
266amnoncommon in soil from SIL garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1389
1008amnoncommon ph 7-8, jinxiang county, garlic, allium sativum, fertilized soil, farm, china, rhizosphere2023-01-26v4No1 / 1393
600sheryoCommon in unammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1395
788amnon high in soil compared to cherokia georgiana georgiana millipede feces in mesocosm state of georgia united states of america 2021-05-31v4No1 / 1395
824sheryoCommon in soil after 0-9 years of grazing exclusion at 10-20cm depth, Ningxia china (common depth 10-20cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1397
266amnoncoomon in roots in SIL garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1399
422amnoncommon soil, paddy field soil, oryza sativa, hunan province, hubei province, china, cultivated environment2018-12-02v4No1 / 1399
76amnoncommon in non-seleniferous soil (common soil, rhizosphere, united states of america, non-seleniferous, state of florida)2017-02-28v4No1 / 1414
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
309amnoncommon rhizosphere, germany, geranium pratense, meadow geranium2018-04-05v4No1 / 1434
76amnoncommon in seleniferous soil (common soil, rhizosphere, united states of america, selenium, seleniferous, woodland area)2017-02-28v4No1 / 1438
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v4No1 / 1439
821sheryoCommon in soil of miscanthus field at 0-10cm depth, Michigan USA (common depth (soil) 0-10cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1447
266amnoncommon in soil from JAM garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1456
271amnoncommon depth (soil) 0-20cm, rhizosphere, glycine max, soybean, china2018-01-09v4No1 / 1459
824sheryoCommon in soil after 27-35 years of grazing exclusion at 10-20cm depth, Ningxia china (common depth 10-20cm, 27-35 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1477
760sheryoCommon in rhizosphere soil of rice plants with NPK fertilization in a long term fertilization experiment (common npk fertilization, npk fertilizer, ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, oryza sativa, rhizosphere)2021-04-06v4No1 / 1491
760sheryoCommon in rhizosphere soil of rice plants without fertilization in a long term fertilization experiment (common ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, no fertilization, oryza sativa, rhizosphere)2021-04-06v4No1 / 1506
145amnoncommon soil, rhizosphere, oryza sativa, rice, united states of america, ph 5.62017-04-19v4No1 / 1515
901amnoncommon sediment surface, depth (sediment) 0cm, taihu lake, depth (water) 20-100cm, taihu national park, china, lake sediment2022-04-25v4No1 / 1550
101amnon high in rhizosphere compared to root in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 1588
76amnonhigher in non-seleniferous soil compared to seleniferous soil ( high in non-seleniferous compared to selenium seleniferous in soil united states of america rhizosphere woodland area )2017-02-28v4No1 / 1621
608sheryoCommon in wheat field in China, amended and unamended biochar, unamended with nitrogen fertilizer (common triticum aestivum l. cv., xiaoyan no. 22, china, silty clay, soil)2020-04-20v4No1 / 1643
462amnon high in depth (soil) 0-30 cm depth (soil) 0-20cm silt loam compared to detph 30-75cm silt clay loam in soil united states of america state of tennessee cultivated environment 2019-01-12v4No1 / 1648
821sheryoCommon in soil of continuous corn field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 1649
824sheryoCommon in soil after 27-35 years of grazing exclusion at 0-10cm depth, Ningxia china (common yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, 27-35 years of grazing exclusion, grazing exclusion, china, depth (soil) 0-10cm, soil)2021-08-08v4No1 / 1659
760sheryoCommon in rhizosphere soil of rice plants with manure fertilization in a long term fertilization experiment (common manure fertilization, manured soil, ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, oryza sativa, rhizosphere)2021-04-06v4No1 / 1670
608sheryoCommon in wheat field in China, amended and unamended biochar, amended with nitrogen fertilizer (common triticum aestivum l. cv., xiaoyan no. 22, china, silty clay, soil, urea enriched soil)2020-04-20v4No1 / 1682
821sheryoHigher at 10-25cm depth compared to 25-50cm depth in soil in Michigan USA ( high in depth (soil) 10-25cm compared to depth (soil) 25-50cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 1704
901amnon high in sediment surface depth (sediment) 0cm compared to depth (sediment) 0-20cm in taihu lake depth (water) 20-100cm taihu national park china lake sediment 2022-04-25v4No1 / 1819
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 1834
156amnoncommon soil, rhizosphere, brassica, brassica oleracea, china2017-07-27v4No1 / 1885
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>4, ph<5, china2018-02-11v4No1 / 1886
901amnon high in rhizosphere compared to bulk sediment in depth (sediment) 0-20cm taihu lake depth (water) 20-100cm taihu national park china lake sediment 2022-04-25v4No1 / 1892
824sheryoCommon in soil after 0-9 years of grazing exclusion at 0-10cm depth, Ningxia china (common depth (soil) 0-10cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1903
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
101amnoncommon state of new york, vitis vinifera, united states of america, merlot, grapevine, rhizosphere2017-04-03v4No1 / 1980
821sheryoCommon in soil of switchgrass field at 0-10cm depth, Michigan USA (common kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, depth (soil) 0-10cm, state of michigan, soil, united states of america)2021-08-02v4No1 / 2067
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>7, ph<8, china2018-02-11v4No1 / 2160
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>6, ph<7, china2018-02-11v4No1 / 2223
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
101amnoncommon state of new york, vitis vinifera, united states of america, merlot, grapevine, soil2017-04-03v4No1 / 2537
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>8, china2018-02-11v4No1 / 2646
265amnon high in soil compared to soilwater water in canada province of quebec 2017-12-11v4No1 / 2715
357amnon high in ph>4.5 compared to ph<4.5 in soil topsoil depth (soil) 0-10cm moist tropical forest woodland area forest ecosystem 2018-08-18v4No1 / 2773
271amnoncommon depth (soil) 0-20cm, soil, china2018-01-09v4No1 / 2856
422amnon high in ph 7-8 compared to ph 5-6 in soil paddy field soil oryza sativa heilongjiang province cultivated environment china 2018-12-04v4No1 / 3267
84amnoncommon depth 5cm, soil, temperate grassland biome, fen, peat soil, flooded grassland biome, united kingdom2017-03-07v4No1 / 3434
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>5, ph<6, china2018-02-11v4No1 / 3508
837sheryoHigher in soil after 20 years compared to 30 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 30 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 3893
837sheryoHigher in soil after 10 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 10 years compared to agricultural field wheat zea mays in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 3932
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 20 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5270
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 30 years compared to zea mays triticum aestivum agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5596
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 20 years compared to triticum aestivum zea mays agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 5661
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5886
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7628
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org