Search result for sequence:
TACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTCCGCTAAGACAGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATTTGTGACTGGCGGGCTAGAGTATGGCAGAGGGGGGTAGAATTCCACG
common ontology terms
term enrichment score
TermScore
soil0.253146
topsoil0.206349
forest ecosystem0.157895
brazil0.128000
forested area0.117647
rhizosphere0.115546
depth (soil) 0-10cm0.115108
peatland0.103093
lushan mountain0.103093
tree0.102564
china0.099798
silt loam0.098039
sao paulo state0.087912
jiangxi province0.085470
woodland area0.085366
peat soil0.084211
ph 60.084211
populus0.084211
robinia pseudoacacia0.084211
reforestation0.084211
shaanxi province0.084211
tropical moist broadleaf forest biome0.084211
loess plateau0.080808
ant0.080808
glycine max0.079208
zea mays0.074766
state of tennessee0.074766
united states of america0.070475
larval stage0.069565
cultivated environment0.067227
atlantic rainforest0.066667
parque estadual serra do mar-núcleo picinguaba0.066667
odontomachus chelifer0.066667
qingdao city prefecture0.066667
veined rapa whelk0.066667
rapana venosa0.066667
potting mix0.065574
hani peatland0.064516
baekdudaegan0.064516
mesocosm0.064516
subsurface drainage0.064516
kelley0.064516
nicollet soil series0.064516
des moines0.064516
united states0.064516
fen0.062500
ph 4.50.062500
iowa0.062500
solanum lycopersicum0.061538
depth (soil) 0-20cm0.057143
leaf0.055556
fish0.054795
canada0.054422
state of georgia0.054054
skin0.051613
united kingdom0.048780
agricultural field0.048780
body proper0.048780
wild0.047619
intestine0.047619
cuticle0.044944
chitin-based cuticle0.044944
juvenile oyster containing diet0.044944
sphagnum bog0.044444
taxus0.043956
taxus mairei0.043956
tomato0.043956
ph 40.043956
dermanyssus gallinae0.043956
red poulty mite0.043956
poulty farm0.043956
yellowstone national park0.043956
bon portage island0.043956
burrow0.043956
LOWER IN food spoilage0.043956
cambridgeshire0.043956
subpolar coniferous forest biome0.043956
boreal forest0.043956
southern temperate forest0.043956
temperate broadleaf and mixed forest biome0.043956
bank vole0.043956
myodes glareolus0.043956
ukraine0.043956
substraat arabidopsis0.043956
lentse potgrond0.043956
lu'an city prefecture0.043956
flowerpot0.043956
20 years0.043956
30 years0.043956
LOWER IN 10 years0.043956
gaster0.043956
tundra0.043478
ph 5-60.043478
geothermal field0.043011
province of quebec0.043011
newt0.043011
coniferous forest biome0.043011
depth (soil) 0-15cm0.043011
high temperature environment0.042105
mexico0.041667
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN chitin-based cuticle1.000000
LOWER IN cuticle1.000000
atlantic rainforest1.000000
parque estadual serra do mar-núcleo picinguaba1.000000
sao paulo state1.000000
odontomachus hastatus1.000000
LOWER IN odontomachus hastatus1.000000
odontomachus chelifer1.000000
cuticle1.000000
chitin-based cuticle1.000000
LOWER IN reserva biológica de mogi-guaçu1.000000
lanternfish1.000000
myctophidae1.000000
isla coronado norte1.000000
tonsillar hypertrophy1.000000
tonsil tissue1.000000
tonsil surface1.000000
juvenile oyster containing diet1.000000
qingdao city prefecture1.000000
veined rapa whelk1.000000
rapana venosa1.000000
sphagnum bog0.666667
potting mix0.666667
peatland0.500000
peat soil0.500000
temperate grassland biome0.500000
central park0.500000
ph<5.50.500000
LOWER IN ph&gt;5.50.500000
alpine bog0.500000
plant surface0.500000
taxus0.500000
taxus mairei0.500000
southeast china0.500000
LOWER IN taxus media0.500000
LOWER IN taxus cuspidata0.500000
LOWER IN temperate0.500000
temperate0.500000
tomato0.500000
slit loam soil0.500000
ph 60.500000
slit loam0.500000
pinus sibirica0.500000
pine forest0.500000
ph 40.500000
dermanyssus gallinae0.500000
red poulty mite0.500000
poulty farm0.500000
yellowstone national park0.500000
thermophilic sediment0.500000
oceanodroma leucorhoa0.500000
seabird0.500000
bon portage island0.500000
burrow0.500000
LOWER IN seabird0.500000
LOWER IN oceanodroma leucorhoa0.500000
cloud0.500000
LOWER IN soilwater0.500000
boechera stricta0.500000
fresh0.500000
LOWER IN late timpoint0.500000
LOWER IN food spoilage0.500000
middle timepoint0.500000
LOWER IN fresh0.500000
cambridgeshire0.500000
lissotriton vulgaris0.500000
triturus cristatus0.500000
ph 5.40.500000
temperate woodland biome0.500000
temperate deciduos forest0.500000
subpolar coniferous forest biome0.500000
boreal forest0.500000
ph<30.500000
LOWER IN ph&gt;30.500000
southern temperate forest0.500000
temperate broadleaf and mixed forest biome0.500000
ph<40.500000
LOWER IN ph&gt;40.500000
montane forest0.500000
guanajuato0.500000
agave0.500000
bank vole0.500000
myodes glareolus0.500000
ukraine0.500000
no human contact0.500000
chernobyl exclusion zone0.500000
mature soil0.500000
outdoor0.500000
LOWER IN indoor0.500000
LOWER IN office0.500000
populus0.500000
depth 30-75cm0.500000
silt clay loam0.500000
astyanax paranae0.500000
astyanax0.500000
poecilia reticulata0.500000
guppy0.500000
hani peatland0.500000
baekdudaegan0.500000
LOWER IN riganqiao peatland0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.436782
china0.310345
united states of america0.206897
topsoil0.149425
rhizosphere0.126437
forest ecosystem0.103448
depth (soil) 0-10cm0.091954
brazil0.091954
woodland area0.080460
tree0.068966
depth (soil) 0-20cm0.068966
forested area0.068966
peatland0.057471
silt loam0.057471
jiangxi province0.057471
lushan mountain0.057471
research facility0.057471
peat soil0.045977
ph 60.045977
adult0.045977
larval stage0.045977
canada0.045977
skin0.045977
glycine max0.045977
zea mays0.045977
state of tennessee0.045977
populus0.045977
cultivated environment0.045977
robinia pseudoacacia0.045977
reforestation0.045977
loess plateau0.045977
shaanxi province0.045977
tropical moist broadleaf forest biome0.045977
sao paulo state0.045977
ant0.045977
leaf0.034483
solanum lycopersicum0.034483
LOWER IN soil0.034483
foodon product type0.034483
wild0.034483
LOWER IN research facility0.034483
united kingdom0.034483
intestine0.034483
fish0.034483
fen0.034483
hani peatland0.034483
baekdudaegan0.034483
ph 5-60.034483
potting mix0.034483
ph 4.50.034483
mesocosm0.034483
state of georgia0.034483
subsurface drainage0.034483
kelley0.034483
nicollet soil series0.034483
des moines0.034483
united states0.034483
agricultural field0.034483
iowa0.034483
atlantic rainforest0.034483
parque estadual serra do mar-núcleo picinguaba0.034483
odontomachus chelifer0.034483
homo sapiens0.034483
qingdao city prefecture0.034483
body proper0.034483
veined rapa whelk0.034483
rapana venosa0.034483
sphagnum bog0.022989
plant0.022989
taxus0.022989
taxus mairei0.022989
tomato0.022989
tundra0.022989
ph 40.022989
dermanyssus gallinae0.022989
red poulty mite0.022989
czech republic0.022989
poulty farm0.022989
biofilm0.022989
LOWER IN water0.022989
yellowstone national park0.022989
geothermal field0.022989
high temperature environment0.022989
water0.022989
bon portage island0.022989
burrow0.022989
air0.022989
province of quebec0.022989
root0.022989
LOWER IN food spoilage0.022989
newt0.022989
cambridgeshire0.022989
subpolar coniferous forest biome0.022989
boreal forest0.022989
southern temperate forest0.022989
temperate broadleaf and mixed forest biome0.022989
state of california0.022989
mexico0.022989
bank vole0.022989
myodes glareolus0.022989
Exp. ID User ID Description Date Region Flag Sequences
512amnondominant fen, peatland, peat soil, soil, hani peatland, baekdudaegan, ph 5-6, china2019-03-22v4No1 / 5
932amnon high in odontomachus chelifer compared to odontomachus hastatus in atlantic rainforest parque estadual serra do mar-núcleo picinguaba sao paulo state cuticle chitin-based cuticle ant brazil tropical moist broadleaf forest biome 2022-08-30v4No1 / 6
932amnoncommon cuticle, chitin-based cuticle, odontomachus chelifer, sao paulo state, ant, brazil, tropical moist broadleaf forest biome2022-08-30v4No1 / 12
932amnon high in gaster stomach compared to chitin-based cuticle cuticle in atlantic rainforest tropical moist broadleaf forest biome parque estadual serra do mar-núcleo picinguaba sao paulo state brazil odontomachus hastatus ant 2022-08-30v4No1 / 21
460amnonlower in occupied indoor air compared to outdoor air ( high in outdoor compared to indoor office in air united states of america state of california )2019-01-12v4No1 / 25
269amnondecreases during one month in refrigeration of yao meat ( high in fresh early timepoint compared to late timpoint food spoilage in china foodon product type )2018-01-09v4No1 / 34
709sheryoHigher in potting mix soil mixed with Murashige and Skoog (MS) medium and not inoculated with Verticillium dahliae ( high in not inoculated with verticillium dahliae compared to inoculated with verticillium dahliae in murashige and skoog (ms) medium substraat arabidopsis lentse potgrond soil potting mix kingdom of the netherlands )2028-05-16v4No1 / 34
180amnoncommon dermanyssus gallinae, red poulty mite, czech republic, poulty farm, adult2017-08-14v4No1 / 36
614amnondecreases in picher plant fluid grown in lab ( high in wild early time points days 0-3 compared to research facility late time points days 57-60 in harvard forest plant fluid pitcher fluid united states of america commonwealth of massachusetts pitcher plant sarracenia purpurea )2020-04-26v4No1 / 42
894amnoncommon orchard, zhejiang province, china, citrus unshiu, citrus, leaf, endosphere2022-04-11v4No1 / 47
932amnon high in atlantic rainforest parque estadual serra do mar-núcleo picinguaba compared to savanna reserva biológica de mogi-guaçu in stomach gaster odontomachus chelifer sao paulo state ant brazil tropical moist broadleaf forest biome 2022-08-30v4No1 / 51
975amnoncommon lanternfish, myctophidae, isla coronado norte, depth (water) 500-1000m, intestine, hindgut, gut content, pacific ocean, fish2022-12-24v4No1 / 54
990amnon high in juvenile oyster containing diet compared to control diet in rapana venosa veined rapa whelk body proper larval stage china research facility qingdao city prefecture 2022-12-26v3No1 / 58
130amnoncommon peatland, leaf, austria, plant, alpine bog, plant surface, sphagnum bog2017-04-15v4No1 / 65
983amnoncommon tonsillar hypertrophy, tonsil tissue, tonsil, palatine tonsil, child, 2-5 year-old child stage, china, homo sapiens2022-12-26v3No1 / 69
983amnon high in tonsil surface tonsil compared to supragingival plaque supragingival dental plaque in child 2-5 year-old child stage china homo sapiens 2022-12-26v3No1 / 80
269amnonpeaks at 2 weeks in refrigeration of yao meat ( high in middle timepoint two weeks compared to fresh food spoilage late timepoint in china foodon product type )2018-01-09v4No1 / 83
805amnoncommon sputum, city of london, united kingdom, adult, homo sapiens2021-06-18v3No1 / 88
196amnonlower in water compared to biofilm ( high in biofilm biofilm compared to water in drinking water united states of america )2017-09-12v4No1 / 100
198amnoncommon yellowstone national park, united states of america, geothermal field, water, hot spring, high temperature environment2017-09-13v4No1 / 103
198amnoncommon sediment, yellowstone national park, united states of america, thermophilic sediment, geothermal field, high temperature environment2017-09-13v4No1 / 113
269amnoncommon in fresh yao meat food (common china, foodon product type)2018-01-09v4No1 / 113
789amnonhigh in unfemented compared to fermented cocoa mass ( high in time 0 compared to fermented cocoa mass time 5 days in state of tabasco mexico cocoa mass theobroma cacao )2021-06-01v3No1 / 121
180amnoncommon dermanyssus gallinae, red poulty mite, czech republic, poulty farm, larval stage, shelled egg2017-08-14v4No1 / 158
990amnoncommon control diet, qingdao city prefecture, research facility, china, larval stage, body proper, veined rapa whelk, rapana venosa2022-12-26v3No1 / 187
733amnoncommon filtered 0.2um, free floating, depth (water) 1m, lago grande do curuai, river amazon, lake water, fresh water, water, brazil2021-01-17v3No1 / 210
990amnoncommon juvenile oyster containing diet, qingdao city prefecture, research facility, china, larval stage, body proper, veined rapa whelk, rapana venosa2022-12-26v3No1 / 246
602sheryohigher in rhizoshere of tomato plant roots planted in unamended potting mix ( high in unamended compared to amended with biochar in potting mix rhizosphere israel solanum lycopersicum )2020-04-05v4No1 / 252
788amnoncommon plant litter, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 259
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
499amnoncommon brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 273
357amnon high in ph<4 compared to ph>4 in soil topsoil depth (soil) 0-10cm southern temperate forest temperate broadleaf and mixed forest biome woodland area forest ecosystem 2018-08-19v4No1 / 282
423amnoncommon bank vole, myodes glareolus, ukraine, skin2018-12-05v4No1 / 291
357amnon high in ph<3 compared to ph>3 in soil topsoil depth (soil) 0-10cm subpolar coniferous forest biome boreal forest woodland area forest ecosystem 2018-08-19v4No1 / 297
499amnoncommon brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 308
512amnoncommon fen, peatland, peat soil, soil, hani peatland, baekdudaegan, ph 5-6, china2019-03-22v4No1 / 329
512amnon high in hani peatland baekdudaegan ph 5-6 compared to riganqiao peatland tibetan plateau ph 5.5-6.5 in fen peatland peat soil soil china 2019-03-22v4No1 / 363
426amnon high in mature soil compared to sand in soil tundra permafrost russia nenets autonomous okrug 2018-12-08v4No1 / 377
147amnoncommon pinus sibirica, tundra, soil, pine forest, ph 4, siberia, forest ecosystem2017-04-20v4No1 / 416
357amnoncommon soil, topsoil, depth (soil) 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 474
718amnon high in epilimnion compared to hypolimnion in freshwater lake bog lake united states of america state of wisconsin ph 4.5-5 dimictic lake "north sparkling bog" lake 2028-05-23v4No1 / 488
357amnoncommon soil, topsoil, depth (soil) 0-10cm, southern temperate forest, temperate broadleaf and mixed forest biome, woodland area, forest ecosystem2018-08-19v4No1 / 499
357amnoncommon soil, topsoil, depth (soil) 0-10cm, subpolar coniferous forest biome, boreal forest, woodland area, forest ecosystem2018-08-19v4No1 / 538
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
667amnoncommon depth (soil) 0-20cm, ph 4.5, elevation 500-600m, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 575
146amnon high in rhizosphere compared to soil in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 590
357amnoncommon soil, topsoil, depth (soil) 0-10cm, montane forest, woodland area, forest ecosystem2018-08-19v4No1 / 592
788amnoncommon cherokia georgiana georgiana, millipede, feces, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 607
667amnoncommon depth (soil) 0-20cm, jiangxi province, lushan mountain, china, forested area, ph 4.5, elevation 200-300m, topsoil, soil2020-09-25v4No1 / 613
883amnon high in depth (soil) 60-100cm compared to depth (soil) 0-20cm in oilfield yellow river delta china shengli oilfield oil contaminated soil soil 2022-03-20v4No1 / 627
667amnoncommon depth (soil) 0-20cm, coniferous forest biome, ph 4-4.5, elevation 1000-1100m, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 630
237amnoncommon in burrow soil of seabird (common bird, oceanodroma leucorhoa, seabird, canada, bon portage island, burrow, soil)2017-11-07v4No1 / 638
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
134amnon high in taxus mairei southeast china subtropical compared to taxus media taxus cuspidata northeast china temperate in rhizosphere tree taxus china 2017-04-16v4No1 / 694
667amnoncommon depth (soil) 0-20cm, elevation 800-900m, ph 4.5, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 694
809amnoncommon lu'an city prefecture, flowerpot, research facility, greenhouse, dendrobium officinale, rhizosphere, china2021-06-20v4No1 / 715
813amnoncommon forested area, temperate rainforest, united states of america, state of washington, olympic national park, soil2021-06-22v4No1 / 740
600sheryoDecreases after 12 days of stover ammendment in soil ( high in day 1 compared to day 12 in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 stover ammendment soil )2020-03-27v4No1 / 747
709sheryoCommon in potting mix soil from the Netherlands, substraat arabidopsis, Lentse Potgrond (common substraat arabidopsis, lentse potgrond, soil, potting mix, kingdom of the netherlands)2028-05-16v4No1 / 752
667amnoncommon depth (soil) 0-20cm, ph 4, elevation 1300-1400m, coniferous forest biome, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 777
356amnoncommon in deciduous broad leaved forest top soil in japan (common soil, depth (soil) 0-10cm, hokkaido, topsoil, ph 5.4, japan, forest ecosystem)2018-08-15v4No1 / 834
801sheryoCommon at depth 15-30cm in corn and soybean agriculture fields, Iowa USA (common ph 6, depth (soil) 15-30cm, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 841
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
788amnoncommon soil, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 897
462amnoncommon depth (soil) 20-60cm, united states of america, state of tennessee, depth 30-75cm, silt clay loam, rhizosphere, populus, tree, cultivated environment2019-01-13v4No1 / 908
414amnon high in ph<6 npk fertilizer compared to ph>6 in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 963
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus mairei, china2017-04-16v4No1 / 973
462amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, united states of america, state of tennessee, rhizosphere, populus, tree, silt loam, cultivated environment2019-01-13v4No1 / 997
809amnoncommon dendrobium moniliforme, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1002
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in corn and soybean agriculture fields, Iowa USA ( high in depth (soil) 0-15cm compared to depth (soil) 60-90cm in subsurface drainage glycine max kelley nicollet soil series des moines united states agricultural field iowa zea mays soil )2021-06-16v4No1 / 1036
265amnoncommon canada, province of quebec, soil2017-12-11v4No1 / 1090
84amnoncommon soil, peatland, peat soil, sphagnum bog, temperate grassland biome, depth 5cm, wetland area2017-03-06v4No1 / 1103
357amnon high in ph<5 compared to ph>5 in soil topsoil depth (soil) 0-10cm temperate woodland biome temperate deciduos forest woodland area forest ecosystem 2018-08-18v4No1 / 1104
801sheryoCommon at depth 0-15cm in corn and soybean agriculture fields, Iowa USA (common subsurface drainage, ph 6.2, depth (soil) 0-15cm, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 1202
423amnon high in no human contact chernobyl exclusion zone compared to human contact in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 1229
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 1834
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
265amnon high in soil compared to soilwater water in canada province of quebec 2017-12-11v4No1 / 2715
237amnonhigher in burrow soil compared to bird ( high in soil burrow compared to bird seabird oceanodroma leucorhoa in canada bon portage island )2017-11-07v4No1 / 3656
100amnon high in ph ph<5.5 compared to ph>5.5 in soil urban biome park new york city central park 2017-04-03v4No1 / 4262
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 20 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5270
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 30 years compared to zea mays triticum aestivum agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5596
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 20 years compared to triticum aestivum zea mays agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 5661
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5886

Problems / suggestions? Please email info AT dbbact DOT org