Search result for sequence:
TACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTCGCTAAGACAGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATTTGTGACTGGCGGGCTAGAGTATGGCAGAGGGGGGTAGAATTCCACG
common ontology terms
term enrichment score
TermScore
soil0.348647
rhizosphere0.273592
triticum aestivum0.156863
china0.145852
shaanxi province0.137931
zea mays0.133333
mexico0.131455
loess plateau0.129032
root0.123944
brazil0.122786
wheat0.114286
silt loam0.108108
united states of america0.106345
topsoil0.102564
myrtillocactus geometrizans0.096386
opuntia robusta0.096386
ph 60.096386
cultivated environment0.096386
cactus0.091954
semi-arid0.091954
leaf0.087146
minas gerais state0.085366
campos rupestres0.085366
mesocosm0.085366
depth (soil) 0-20cm0.079349
agricultural feature0.077670
forest ecosystem0.077135
woodland area0.074271
north china plain0.074074
agave0.074074
robinia pseudoacacia0.074074
reforestation0.074074
state of idaho0.071429
desert0.067961
state of georgia0.067961
state of michigan0.066667
state of new york0.063492
hordeum vulgare0.063492
guanajuato0.062500
coarse-loamy soil0.062500
20 years0.062500
depth (soil) 0-5cm0.060606
glycine max0.059701
zhejiang province0.055556
agricultural field0.054054
depth (soil) 0-10cm0.052632
boechera stricta0.050633
orchard0.050633
barbacenia macrantha0.050633
day 820.050633
mature barley plants0.050633
days 1800.050633
quzhou county0.050633
lushan mountain0.050633
kellogg biological station0.050633
mesic type hapludalf0.050633
kalamazoo loam0.050633
ph 50.050000
citrus0.050000
peatland0.049383
skin0.048387
depth (soil) 15cm0.048193
forested area0.047059
water0.046154
jiangxi province0.045977
winter0.045455
LOWER IN soil0.044248
brassicaceae0.043011
ph 4-50.039604
odontomachus chelifer0.039216
sao paulo state0.039216
ph<60.038835
heilongjiang province0.038835
ph 6-6.50.038462
bon portage island0.038462
burrow0.038462
root endosphere0.038462
red soil0.038462
hani peatland0.038462
baekdudaegan0.038462
koshi river0.038462
southern united states0.038462
cherokia georgiana georgiana0.038462
millipede0.038462
depth 50-100m0.038462
restored prairie0.038462
LOWER IN reforestation0.038462
LOWER IN robinia pseudoacacia0.038462
LOWER IN 30 years0.038462
tropical moist broadleaf forest biome0.038462
plant0.038462
canada0.038095
fresh water0.038095
soybean0.037736
cambisol0.037736
fen0.037736
nepal0.037736
snake0.037736
plant litter0.037736
greenhouse0.037736
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN odontomachus hastatus1.000000
odontomachus chelifer1.000000
atlantic rainforest1.000000
parque estadual serra do mar-núcleo picinguaba1.000000
sao paulo state1.000000
cuticle1.000000
chitin-based cuticle1.000000
LOWER IN reserva biológica de mogi-guaçu1.000000
lanternfish1.000000
myctophidae1.000000
isla coronado norte1.000000
ph<60.666667
LOWER IN ph&gt;60.666667
hordeum vulgare0.666667
heilongjiang province0.666667
field soil0.500000
non-seleniferous0.500000
LOWER IN seleniferous0.500000
central park0.500000
merlot0.500000
grapevine0.500000
water treatment plant0.500000
LOWER IN distribution system0.500000
winter barley0.500000
hedera hibernica0.500000
ivy0.500000
moor0.500000
scrubland0.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
ph 6-6.50.500000
root zone soil0.500000
leaf interior0.500000
root interior0.500000
alpine bog0.500000
plant surface0.500000
tomato0.500000
slit loam soil0.500000
ph 60.500000
slit loam0.500000
seed structure0.500000
yellowstone national park0.500000
oceanodroma leucorhoa0.500000
seabird0.500000
bon portage island0.500000
burrow0.500000
surface burrow0.500000
LOWER IN deep burrow0.500000
LOWER IN seabird0.500000
LOWER IN oceanodroma leucorhoa0.500000
arachis hypogaea0.500000
peanut0.500000
non-manured soil0.500000
LOWER IN soilwater0.500000
ph 5.50.500000
boechera stricta0.500000
north china plain0.500000
ph>80.500000
ph>7, ph<80.500000
ph>6, ph<70.500000
ph>5, ph<60.500000
ph>4, ph<50.500000
cambridgeshire0.500000
lissotriton vulgaris0.500000
moist tropical forest0.500000
ph<4.50.500000
LOWER IN ph&gt;4.50.500000
subpolar coniferous forest biome0.500000
boreal forest0.500000
southern temperate forest0.500000
temperate broadleaf and mixed forest biome0.500000
montane forest0.500000
mediterranean forest biome0.500000
agave0.500000
root endosphere0.500000
agave salmiana0.500000
guanajuato0.500000
agave tequiliana0.500000
cultivated environment0.500000
agave deserti0.500000
red soil0.500000
orchard0.500000
LOWER IN mediterranean0.500000
termite0.500000
reticulitermes flaviceps0.500000
wood diet0.500000
LOWER IN mulch diet0.500000
bank vole0.500000
myodes glareolus0.500000
ukraine0.500000
no human contact0.500000
chernobyl exclusion zone0.500000
fragaria x ananassa0.500000
strawberry0.500000
yellow brown soil0.500000
LOWER IN age 10 years0.500000
LOWER IN continuous cropping0.500000
astyanax paranae0.500000
astyanax0.500000
poecilia reticulata0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.540000
china0.353333
united states of america0.280000
rhizosphere0.220000
triticum aestivum0.100000
mexico0.093333
depth (soil) 0-20cm0.086667
brazil0.086667
zea mays0.080000
silt loam0.080000
loess plateau0.080000
shaanxi province0.080000
root0.073333
wheat0.066667
topsoil0.066667
leaf0.053333
myrtillocactus geometrizans0.053333
opuntia robusta0.053333
cactus0.053333
semi-arid0.053333
ph 60.053333
agricultural feature0.053333
cultivated environment0.053333
woodland area0.046667
forest ecosystem0.046667
desert0.046667
minas gerais state0.046667
campos rupestres0.046667
mesocosm0.046667
state of georgia0.046667
state of new york0.040000
water0.040000
LOWER IN soil0.040000
research facility0.040000
state of idaho0.040000
north china plain0.040000
winter0.040000
depth (soil) 0-10cm0.040000
agave0.040000
state of michigan0.040000
agricultural field0.040000
robinia pseudoacacia0.040000
reforestation0.040000
hordeum vulgare0.033333
plant0.033333
glycine max0.033333
skin0.033333
guanajuato0.033333
depth (soil) 0-5cm0.033333
coarse-loamy soil0.033333
zhejiang province0.033333
20 years0.033333
peatland0.026667
canada0.026667
ph 50.026667
brassicaceae0.026667
boechera stricta0.026667
feces0.026667
citrus0.026667
orchard0.026667
fresh water0.026667
barbacenia macrantha0.026667
day 820.026667
mature barley plants0.026667
days 1800.026667
ph 4-50.026667
depth (soil) 15cm0.026667
quzhou county0.026667
jiangxi province0.026667
lushan mountain0.026667
forested area0.026667
kellogg biological station0.026667
mesic type hapludalf0.026667
kalamazoo loam0.026667
ph<60.020000
germany0.020000
ph 6-6.50.020000
bulk soil0.020000
state of california0.020000
bon portage island0.020000
burrow0.020000
soybean0.020000
adult0.020000
root endosphere0.020000
hunan province0.020000
red soil0.020000
cambisol0.020000
heilongjiang province0.020000
intestine0.020000
fish0.020000
fen0.020000
peat soil0.020000
hani peatland0.020000
baekdudaegan0.020000
ph 5-60.020000
river0.020000
depth (water) 10cm0.020000
koshi river0.020000
nepal0.020000
snake0.020000
Exp. ID User ID Description Date Region Flag Sequences
198amnon high in water compared to sediment in yellowstone national park united states of america geothermal field high temperature environment 2017-09-14v4No1 / 2
512amnondominant fen, peatland, peat soil, soil, hani peatland, baekdudaegan, ph 5-6, china2019-03-22v4No1 / 5
932amnon high in odontomachus chelifer compared to odontomachus hastatus in atlantic rainforest parque estadual serra do mar-núcleo picinguaba sao paulo state cuticle chitin-based cuticle ant brazil tropical moist broadleaf forest biome 2022-08-30v4No1 / 6
129amnondominant mexico, myrtillocactus geometrizans, opuntia robusta, cactus, rhizosphere, semi-arid2017-04-15v4No1 / 8
932amnoncommon cuticle, chitin-based cuticle, odontomachus chelifer, sao paulo state, ant, brazil, tropical moist broadleaf forest biome2022-08-30v4No1 / 12
788amnondominant cherokia georgiana georgiana, millipede, feces, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 13
129amnon high in rhizosphere compared to soil in ph 6-6.5 mexico myrtillocactus geometrizans opuntia robusta cactus semi-arid 2017-04-15v4No1 / 14
129amnonfound INSIDE leaves of cactus (common mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf, leaf interior)2017-04-15v4No1 / 14
788amnondominant plant litter, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 15
129amnonfound INSIDE roots of cactus (common mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, root interior, root)2017-04-15v4No1 / 29
709sheryoHigher in potting mix soil mixed with Murashige and Skoog (MS) medium and not inoculated with Verticillium dahliae ( high in not inoculated with verticillium dahliae compared to inoculated with verticillium dahliae in murashige and skoog (ms) medium substraat arabidopsis lentse potgrond soil potting mix kingdom of the netherlands )2028-05-16v4No1 / 34
731amnonlower in oropharingeal otic fluid drainage compared to buccal mucosa ( high in buccal mucosa mouth mucosa compared to oropharynx in adult state of michigan united states of america homo sapiens )2021-01-09v4No1 / 41
894amnoncommon orchard, zhejiang province, china, citrus unshiu, citrus, leaf, endosphere2022-04-11v4No1 / 47
932amnon high in atlantic rainforest parque estadual serra do mar-núcleo picinguaba compared to savanna reserva biológica de mogi-guaçu in stomach gaster odontomachus chelifer sao paulo state ant brazil tropical moist broadleaf forest biome 2022-08-30v4No1 / 51
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in ampicillin antibiotic compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 52
975amnoncommon lanternfish, myctophidae, isla coronado norte, depth (water) 500-1000m, intestine, hindgut, gut content, pacific ocean, fish2022-12-24v4No1 / 54
360amnoncommon agave, desert, root endosphere, mexico, guanajuato, agave tequiliana, cultivated environment, root2018-08-21v4No1 / 62
130amnoncommon peatland, leaf, austria, plant, alpine bog, plant surface, sphagnum bog2017-04-15v4No1 / 65
534amnoncommon river, water, fresh water, depth (water) 10cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 80
731amnoncommon buccal mucosa, mouth mucosa, adult, state of michigan, united states of america, homo sapiens2021-01-09v4No1 / 85
360amnoncommon agave, desert, root endosphere, agave salmiana, mexico, guanajuato, root2018-08-21v4No1 / 87
360amnoncommon desert, soil, rhizosphere, agave, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v4No1 / 98
198amnoncommon yellowstone national park, united states of america, geothermal field, water, hot spring, high temperature environment2017-09-13v4No1 / 103
718amnon high in epilimnion compared to hypolimnion in "crystal bog" lake polymictic lake ph 4-4.5 state of wisconsin united states of america bog lake freshwater lake 2028-05-23v4No1 / 104
536amnoncommon snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 110
416amnon high in wood diet compared to mulch diet in termite reticulitermes flaviceps colon research facility united states of america 2018-11-30v4No1 / 115
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, stem, stem endosphere2019-08-17v4No1 / 123
788amnon high in plant litter compared to soil in mesocosm state of georgia united states of america 2021-05-31v4No1 / 143
192amnoncommon seed, seed structure, brassica napus2017-09-05v4No1 / 161
534amnoncommon river, water, fresh water, depth (water) 10cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 172
179amnoncommon mus musculus, mouse, oral cavity, research facility, united states of america, balb/c, mouth2017-08-13v4No1 / 183
536amnoncommon snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 184
109amnon high in water treatment plant compared to distribution system in united states of america water drinking water site c 2017-04-08v4No1 / 193
534amnoncommon river, water, fresh water, depth (water) 10cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 193
600sheryoIncearses after 12 days of stover ammendment in soil ( high in day 12 compared to day 1 in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 stover ammendment soil )2020-03-27v4No1 / 196
761sheryoHigher in maize rhizosphere compared to bulk soil in sandy soil maize field in Germany ( high in rhizosphere compared to bulk soil in ph 5 lower saxony sandy soil germany maize field )2021-04-06v3No1 / 200
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 236
788amnoncommon plant litter, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 259
499amnoncommon brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 273
499amnoncommon brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 308
512amnoncommon fen, peatland, peat soil, soil, hani peatland, baekdudaegan, ph 5-6, china2019-03-22v4No1 / 329
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, rhizosphere, semi-arid2017-04-15v4No1 / 338
512amnon high in hani peatland baekdudaegan ph 5-6 compared to riganqiao peatland tibetan plateau ph 5.5-6.5 in fen peatland peat soil soil china 2019-03-22v4No1 / 363
259amnonlower in manured soil compared to non-manured ( high in non-manured soil compared to manured soil in soil rhizosphere ph 5 arachis hypogaea peanut fertilized soil china )2017-12-02v4No1 / 397
548amnoncommon minas gerais state, campos rupestres, brazil, vellozia epidendroides, stem2019-08-17v4No1 / 431
360amnoncommon desert, soil, rhizosphere, agave, agave deserti, state of california2018-08-21v4No1 / 432
360amnoncommon desert, soil, mexico, guanajuato2018-08-21v4No1 / 437
412amnonlower in pig manured soil with wheat-maize rotation compared to non-manured soil ( high in non-manured soil compared to manured soil in soil hunan province red soil cambisol zea mays triticum aestivum china )2018-11-26v4No1 / 437
415amnonhigher in citrus from humid subtropical compared to mediterranean and semi-arid climate ( high in subtropical compared to mediterranean semi-arid in rhizosphere soil citrus orchard cultivated environment )2018-11-27v4No1 / 458
357amnoncommon soil, topsoil, depth (soil) 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 474
360amnoncommon desert, soil, rhizosphere, agave, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 484
718amnon high in epilimnion compared to hypolimnion in freshwater lake bog lake united states of america state of wisconsin ph 4.5-5 dimictic lake "north sparkling bog" lake 2028-05-23v4No1 / 488
357amnoncommon soil, topsoil, depth (soil) 0-10cm, southern temperate forest, temperate broadleaf and mixed forest biome, woodland area, forest ecosystem2018-08-19v4No1 / 499
128amnonhigher in ivy leaves from moor and forest compared to city ( high in moor forest ecosystem compared to city dense settlement biome in hedera hibernica belgium ivy leaf )2017-04-14v4No1 / 525
357amnoncommon soil, topsoil, depth (soil) 0-10cm, subpolar coniferous forest biome, boreal forest, woodland area, forest ecosystem2018-08-19v4No1 / 538
548amnoncommon on leaf surface (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, leaf)2019-08-17v4No1 / 548
548amnoncommon in leaf surface of barbacenia macrantha (common minas gerais state, campos rupestres, brazil, barbacenia macrantha, leaf, leaf surface)2019-08-17v4No1 / 550
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf2017-04-15v4No1 / 562
357amnoncommon soil, topsoil, depth (soil) 0-10cm, mediterranean forest biome, forest ecosystem, woodland area2018-08-19v4No1 / 564
600sheryohigher in stover ammendment soil ( high in stover amended soil compared to unamended soil in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 day 82 )2020-03-27v4No1 / 567
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
667amnoncommon depth (soil) 0-20cm, ph 4.5, elevation 500-600m, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 575
893amnon high in sandy loam compared to silty clay loam in raphanus sativus greenhouse radish commonwealth of virginia rhizosphere fertilized soil research facility united states of america 2022-04-11v4No1 / 582
788amnon high in cherokia georgiana georgiana millipede feces compared to soil in mesocosm state of georgia united states of america 2021-05-31v4No1 / 589
146amnon high in rhizosphere compared to soil in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 590
357amnoncommon soil, topsoil, depth (soil) 0-10cm, montane forest, woodland area, forest ecosystem2018-08-19v4No1 / 592
360amnon high in rhizosphere agave compared to soil in desert mexico state of california 2018-08-21v4No1 / 593
788amnoncommon cherokia georgiana georgiana, millipede, feces, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 607
128amnoncommon hedera hibernica, belgium, ivy, leaf, moor, scrubland2017-04-14v4No1 / 623
667amnoncommon depth (soil) 0-20cm, coniferous forest biome, ph 4-4.5, elevation 1000-1100m, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 630
237amnoncommon in burrow soil of seabird (common bird, oceanodroma leucorhoa, seabird, canada, bon portage island, burrow, soil)2017-11-07v4No1 / 638
800amnonhigher at 100-250 days compared to 7-28 days following heavy metal contamination ( high in autumn summer compared to spring in reservoir sediment depth 0-10cm heavy metal china xiannv lake lake fresh water sediment )2021-06-15v4No1 / 644
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
667amnoncommon depth (soil) 0-20cm, elevation 800-900m, ph 4.5, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 694
412amnon high in ph<5 compared to ph>5 in soil hunan province red soil cambisol zea mays triticum aestivum china 2018-11-26v4No1 / 706
821sheryoComoon in soil of miscanthus field at 50-100cm depth, Michigan USA (common depth 50-100m, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 726
761sheryoCommon in maize rhizosphere sandy soil maize field in Germany (common zea mays, rhizosphere, ph 5, lower saxony, sandy soil, germany, maize field)2021-04-06v3No1 / 742
821sheryoCommon in soil of restored prairie at 50-100cm depth, Michigan USA (common depth 50-100m, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 744
271amnon high in rhizosphere glycine max soybean compared to soil in depth (soil) 0-20cm china 2018-01-09v4No1 / 750
709sheryoCommon in potting mix soil from the Netherlands, substraat arabidopsis, Lentse Potgrond (common substraat arabidopsis, lentse potgrond, soil, potting mix, kingdom of the netherlands)2028-05-16v4No1 / 752
821sheryoCommon in soil of continuous corn field at 50-100cm depth, Michigan USA (common depth 50-100m, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 769
667amnoncommon depth (soil) 0-20cm, ph 4, elevation 1300-1400m, coniferous forest biome, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 777
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph<5, china2018-11-26v4No1 / 823
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 830
266amnoncommon in roots in JAM garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 843
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil2017-04-15v4No1 / 884
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
788amnoncommon soil, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 897
357amnon high in ph<4.5 compared to ph>4.5 in soil topsoil depth (soil) 0-10cm moist tropical forest woodland area forest ecosystem 2018-08-18v4No1 / 915
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
126amnoncommon rhizosphere, germany, hordeum vulgare, winter barley2017-04-14v4No1 / 925
414amnon high in ph<6 npk fertilizer compared to ph>6 in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 963
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, root zone soil2017-04-15v4No1 / 968
821sheryoCommon in soil of restored prairie at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 968
809amnoncommon dendrobium moniliforme, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1002
628sheryocommon in bulk soil with barley plants after 180 days in treatments amended with biochar (common biochar, bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1023
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, npk fertilizer, ph<6, china2018-11-26v4No1 / 1105
266amnoncommon in roots in MAH garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1110
628sheryocommon in bulk soil with barley plants after 180 days in treatments unamended with biochar (common bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1136
628sheryocommon in rhizosphere of barley roots after 180 days in treatments amended with biochar (common mature barley plants, days 180, rhizosphere, hordeum vulgare, biochar, ph 4-5, depth (soil) 15cm, china, quzhou county, zhejiang province, soil)2020-05-18v4No1 / 1192
628sheryocommon in rhizosphere of barley roots after 180 days in treatments unamended with biochar (common china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, rhizosphere, days 180, mature barley plants)2020-05-18v4No1 / 1209
837sheryoCommon in agricultural field at depths 100-300cm, shaanxi, China (common depth 100-300cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1220
444amnonlower in continuously cropped strawberry soil ( high in age 1 year compared to age 5 years age 10 years continuous cropping in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture china cultivated environment )2019-01-07v4No1 / 1221
423amnon high in no human contact chernobyl exclusion zone compared to human contact in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 1229
237amnonlower deep in burrow compared to burrow entrance ( high in surface burrow compared to deep burrow in bird oceanodroma leucorhoa seabird canada bon portage island burrow soil )2017-11-07v4No1 / 1247
837sheryoCommon in agricultural field at depths 40-100cm, shaanxi, China (common depth 40-100cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1263
837sheryoCommon in soil at 0-40-100cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common depth 40-100cm, 20 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1294
837sheryoCommon in soil at 100-300cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common depth 100-300cm, 20 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1317
837sheryoCommon in soil at 0-40cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common 20 years, depth 0-40cm, robinia pseudoacacia, loess plateau, shaanxi province, china, reforestation, silt loam, soil)2021-09-26v4No1 / 1323
600sheryoCommon in biochar ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, biochar, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1326
600sheryoCommon in stover ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82, stover ammendment )2020-03-27v4No1 / 1327
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
809amnoncommon dendrobium huoshanense, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1356
266amnoncommon in soil from SIL garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1389
600sheryoCommon in unammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1395
266amnoncoomon in roots in SIL garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1399
76amnoncommon in non-seleniferous soil (common soil, rhizosphere, united states of america, non-seleniferous, state of florida)2017-02-28v4No1 / 1414
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v4No1 / 1439
266amnoncommon in soil from JAM garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1456
271amnoncommon depth (soil) 0-20cm, rhizosphere, glycine max, soybean, china2018-01-09v4No1 / 1459
837sheryoCommon in agricultural field at depths 0-40cm, shaanxi, China (common depth 0-40cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1470
76amnonhigher in non-seleniferous soil compared to seleniferous soil ( high in non-seleniferous compared to selenium seleniferous in soil united states of america rhizosphere woodland area )2017-02-28v4No1 / 1621
155amnonhigher in tightly bound root soil compared to loose soil and bulk soil ( high in root compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 1714
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>4, ph<5, china2018-02-11v4No1 / 1886
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
101amnon high in root compared to rhizosphere in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 2075
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>7, ph<8, china2018-02-11v4No1 / 2160
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>6, ph<7, china2018-02-11v4No1 / 2223
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>8, china2018-02-11v4No1 / 2646
265amnon high in soil compared to soilwater water in canada province of quebec 2017-12-11v4No1 / 2715
271amnoncommon depth (soil) 0-20cm, soil, china2018-01-09v4No1 / 2856
837sheryoHigher in soil of agricultural feild compared to after 20 years reforestation with Black locust trees , shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to 20 years robinia pseudoacacia reforestation in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 2892
837sheryoHigher in soil of agricultural feild compared to after 30 years reforestation with Black locust trees , shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to robinia pseudoacacia 30 years reforestation in silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 2927
837sheryoHigher in soil in agricultural feild compared after 10 years reforestation with Black locust trees, shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to 10 years reforestation robinia pseudoacacia in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 2994
422amnon high in ph 7-8 compared to ph 5-6 in soil paddy field soil oryza sativa heilongjiang province cultivated environment china 2018-12-04v4No1 / 3267
837sheryoHigher in soil after 10 years compared to 30 years of reforestation with Black locust trees, shaanxi, China ( high in 10 years compared to 30 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 3368
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>5, ph<6, china2018-02-11v4No1 / 3508
237amnonhigher in burrow soil compared to bird ( high in soil burrow compared to bird seabird oceanodroma leucorhoa in canada bon portage island )2017-11-07v4No1 / 3656
837sheryoHigher in soil after 20 years compared to 30 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 30 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 3893
837sheryoHigher in soil after 20 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5270
100amnon high in ph ph<6 compared to ph>6 in soil urban biome park new york city central park 2017-04-03v4No1 / 5770
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5886
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7628
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org