Search result for sequence:
TACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTCGGAAAGAAAGATGTGAAATCCCAGAGCTTAACTTTGGAACTGCATTTTTAACTACCGAGCTAGAGTGTGTCAGAGGGAGGTGGAATTCCGCG
common ontology terms
term enrichment score
TermScore
rhizosphere0.283797
soil0.258960
rainbow trout0.184615
oncorhynchus mykiss0.184615
cultivated environment0.173348
fish0.162822
china0.150943
sweden0.149606
united states of america0.141443
skin0.138528
citrus0.114943
digestive system0.112983
wheat0.111732
germany0.106452
root0.105820
new york0.104348
research facility0.104283
ph 60.101695
depth 0-20cm0.094488
agricultural feature0.094303
farm0.085960
coarse-loamy soil0.080925
orchard0.080925
state of florida0.080402
food (fermented)0.078799
fresh water0.076312
depth 0-5cm0.074866
united kingdom0.073491
state of california0.072822
canada0.072727
north china plain0.070175
vitis vinifera0.060060
gut content0.059172
cold environment0.059172
agave0.059172
root endosphere0.059172
cambridgeshire0.059172
frog0.058594
triticum aestivum0.058309
newt0.057471
costa rica0.056657
water0.054732
mexico0.054348
desert0.051546
winter0.048193
warm temperature habitat0.047904
18c0.047904
gastrointestinal system mucosa0.047904
12c0.047904
larvae insect diet0.047904
guanajuato0.047904
amphibia0.047904
ensete ventricosum0.047904
ethiopian banana0.047904
days 30-600.047904
anaerobic fermentation0.047904
day 820.047904
spring water0.047904
glycine max0.047904
populus0.047904
ph 7-80.047525
LOWER IN root0.047059
LOWER IN soil0.046784
biochar0.046243
ethiopia0.045714
late timepoint0.045714
state of tennessee0.044693
tree0.044693
israel0.043243
leaf0.043088
adult0.038065
jejunum0.036697
koshi river0.036364
southern united states0.036364
agave tequiliana0.036364
tomato0.036364
day 120.036364
LOWER IN day 10.036364
state of rhode island0.036364
triturus cristatus0.036364
cannabis sativa0.036364
30-60 days0.036364
gastrointestinal system0.036036
oryza sativa0.036036
grape0.035714
endosphere0.035714
nepal0.035714
filtered 0.2um0.035714
snake0.035714
soybean0.035714
depth 10 cm0.035088
state of georgia0.035088
duodenum0.034783
ileum0.034783
free floating0.034483
LOWER IN wild0.034483
solanum lycopersicum0.034483
stem0.033333
late timepoints0.033333
cow0.032787
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.000000
agricultural feature0.750000
vitis vinifera0.666667
jejunum0.666667
day 00.666667
new york0.666667
toad0.666667
citrus0.666667
heilongjiang province0.666667
paddy field soil0.666667
cultivated environment0.625000
rainbow trout0.500000
oncorhynchus mykiss0.500000
gut content0.500000
warm temperature habitat0.500000
18c0.500000
gastrointestinal system mucosa0.500000
12c0.500000
cold environment0.500000
b. subtilis isolate titration0.500000
larvae insect diet0.500000
koshi river0.500000
tributary0.500000
southern united states0.500000
agkistrodon piscivorus0.500000
aquatic snake0.500000
pre pupae insect diet0.500000
fossorial snake0.500000
storeria dekayi0.500000
ground snake0.500000
olsztyn0.500000
poland0.500000
gut0.500000
esox lucius0.500000
pike fry0.500000
agave0.500000
root endosphere0.500000
guanajuato0.500000
agave tequiliana0.500000
LOWER IN days 0-30.500000
days 57-600.500000
harvard forest0.500000
plant fluid0.500000
pitcher fluid0.500000
pitcher plant0.500000
sarracenia purpurea0.500000
xylella fastidiosa temecula10.500000
pierce disease0.500000
LOWER IN pre pupae insect diet0.500000
tomato0.500000
LOWER IN transverse colon0.500000
LOWER IN left colon0.500000
red pepper sauce0.500000
high salt concentration0.500000
LOWER IN low salt concentration0.500000
zea mays subsp. mays0.500000
corn0.500000
fresh corn0.500000
LOWER IN fermented corn0.500000
LOWER IN defatted larvae insect diet0.500000
temp 12c0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN temp 18c0.500000
defatted larvae insects diet0.500000
coarse-loamy soil0.500000
ph 60.500000
day 120.500000
LOWER IN day 10.500000
amphibia0.500000
oophaga pumilio0.500000
strawberry poison frog0.500000
state of rhode island0.500000
kimchi0.500000
LOWER IN days 1-90.500000
cambridgeshire0.500000
triturus cristatus0.500000
ensete ventricosum0.500000
ethiopian banana0.500000
days 30-600.500000
anaerobic fermentation0.500000
ensete ventricosum var. maze0.500000
LOWER IN ensete ventricosum var. ketishe0.500000
kelp0.500000
nereocystis0.500000
lissotriton vulgaris0.500000
food product type0.500000
alfalfa sprouts0.500000
medicago sativa0.500000
producer c10.500000
bufo bufo0.500000
common toad0.500000
rhaebo haematiticus0.500000
truando toad0.500000
ensete ventricosum var. gena0.500000
pre-pupae insect diet0.500000
craugastor fitzingeri0.500000
common rain frog0.500000
dracaena draco0.500000
craugastor bransfordii0.500000
bransford’s litter frog0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.276730
soil0.264151
rhizosphere0.232704
research facility0.176101
china0.176101
fish0.125786
sweden0.119497
digestive system0.119497
rainbow trout0.113208
oncorhynchus mykiss0.113208
skin0.100629
cultivated environment0.100629
germany0.069182
root0.062893
citrus0.062893
wheat0.062893
new york0.056604
ph 60.056604
farm0.056604
depth 0-20cm0.056604
water0.050314
fresh water0.050314
adult0.050314
state of florida0.050314
agricultural feature0.050314
state of california0.044025
food (fermented)0.044025
depth 0-5cm0.044025
coarse-loamy soil0.044025
feces0.044025
united kingdom0.044025
orchard0.044025
canada0.037736
north china plain0.037736
winter0.037736
vitis vinifera0.031447
gut content0.031447
cold environment0.031447
agave0.031447
desert0.031447
root endosphere0.031447
mexico0.031447
costa rica0.031447
frog0.031447
newt0.031447
cambridgeshire0.031447
triticum aestivum0.031447
warm temperature habitat0.025157
18c0.025157
gastrointestinal system mucosa0.025157
12c0.025157
larvae insect diet0.025157
guanajuato0.025157
israel0.025157
amphibia0.025157
ethiopia0.025157
ensete ventricosum0.025157
ethiopian banana0.025157
late timepoint0.025157
days 30-600.025157
anaerobic fermentation0.025157
biochar0.025157
leaf0.025157
day 820.025157
spring water0.025157
LOWER IN soil0.025157
glycine max0.025157
state of tennessee0.025157
populus0.025157
tree0.025157
ph 7-80.025157
LOWER IN root0.025157
grape0.018868
stem0.018868
endosphere0.018868
river0.018868
depth 10 cm0.018868
koshi river0.018868
nepal0.018868
free floating0.018868
filtered 0.2um0.018868
snake0.018868
southern united states0.018868
gastrointestinal system0.018868
agave tequiliana0.018868
LOWER IN wild0.018868
solanum lycopersicum0.018868
tomato0.018868
duodenum0.018868
jejunum0.018868
ileum0.018868
day 120.018868
LOWER IN day 10.018868
state of rhode island0.018868
triturus cristatus0.018868
pacific ocean0.018868
cannabis sativa0.018868
bos taurus0.018868
cow0.018868
state of georgia0.018868
Exp. ID User ID Description Date Region Flag Sequences
189amnondominant united states of america, state of california, grape, vitis vinifera, stem, endosphere2017-08-30v4No1 / 5
313amnonhigh freq. in rainbow trout gut content grown in 18C water (dominant sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, warm temperature habitat, 18c)2018-04-10v4No1 / 5
313amnonhigh freq. in rainbow trout gut mucosa grown in 18C water (dominant sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, warm temperature habitat, 18c, gastrointestinal system mucosa)2018-04-10v4No1 / 5
313amnonhigh freq. in rainbow trout gut mucosa grown in 12C water (dominant sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gastrointestinal system mucosa, 12c, cold environment)2018-04-10v4No1 / 6
313amnoncommon in rainbow trout gut mucosa grown in 18C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, warm temperature habitat, 18c, gastrointestinal system mucosa)2018-04-10v4No1 / 8
143amnonmedium level in single isolate samples using mobio powermag extraction (contamination)2017-04-19v4No1 / 9
313amnoncommon in rainbow trout gut content grown in 18C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, warm temperature habitat, 18c)2018-04-10v4No1 / 9
392amnondominant fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, fishmeal diet2018-11-05v4No1 / 9
313amnonhigh freq. in rainbow trout gut content grown in 12C water (dominant sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, 12c, cold environment)2018-04-10v4No1 / 10
313amnoncommon in rainbow trout gut mucosa grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gastrointestinal system mucosa, 12c, cold environment)2018-04-10v4No1 / 13
392amnondominant fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, larvae insect diet2018-11-05v4No1 / 13
534amnondominant river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 13
536amnondominant snake, skin, united states of america, southern united states, agkistrodon piscivorus, aquatic snake2019-07-28v4No1 / 13
392amnondominant fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, pre pupae insect diet2018-11-05v4No1 / 15
536amnondominant snake, skin, united states of america, southern united states, fossorial snake, storeria dekayi, ground snake2019-07-28v4No1 / 15
613amnondominant olsztyn, poland, aquarium, research facility, gastrointestinal system, gut, esox lucius, pike fry, fish2020-04-25v3No1 / 15
360amnondominant agave, desert, root endosphere, mexico, guanajuato, agave tequiliana, cultivated environment, root2018-08-21v4No1 / 17
614amnonincreases in picher plant fluid grown in lab ( high in research facility days 57-60 late time points compared to wild days 0-3 early time points in harvard forest plant fluid pitcher fluid united states of america commonwealth of massachusetts pitcher plant sarracenia purpurea )2020-04-26v4No1 / 20
614amnoncommon harvard forest, plant fluid, pitcher fluid, united states of america, commonwealth of massachusetts, pitcher plant, sarracenia purpurea2020-04-26v4No1 / 26
189amnonhigherin stems of grape vines with pierce disease compared to control ( high in xylella fastidiosa temecula1 pierce disease compared to control in united states of america state of california grape vitis vinifera stem endosphere )2017-08-30v4No1 / 31
313amnoncommon in rainbow trout gut content grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, 12c, cold environment)2018-04-10v4No1 / 31
392amnon high in larvae insect diet compared to pre pupae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 32
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, fishmeal diet2018-11-05v4No1 / 34
146amnoncommon united states of america, solanum lycopersicum, tomato, botanical fruit food product2017-04-20v4No1 / 35
14amnon high in stomach duodenum jejunum ileum compared to caecum right colon transverse colon left colon feces in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 42
189amnoncommon united states of america, state of california, grape, vitis vinifera, stem, endosphere2017-08-30v4No1 / 43
547amnon high in high salt concentration compared to low salt concentration in red pepper sauce capsicum annuum sichuan province china food (fermented) 2019-08-15v4No1 / 43
306amnondecreases after 2-30 days of fermentation of insiled whole plant corn ( high in fresh corn day 0 compared to fermented corn in zea mays subsp. mays corn whole plant israel )2018-03-19v4No1 / 45
392amnon high in larvae insect diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 46
547amnoncommon red pepper sauce, capsicum annuum, sichuan province, china, food (fermented)2019-08-15v4No1 / 49
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 55
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, defatted larvae insects diet2018-11-05v4No1 / 55
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, larvae insect diet2018-11-05v4No1 / 55
600sheryoincearses after 12 days of unammendment in soil ( high in day 12 compared to day 1 in soil depth 0-5cm united states of america new york coarse-loamy soil ph 6 )2020-03-27v4No1 / 60
374amnoncommon skin, costa rica, amphibia, oophaga pumilio, strawberry poison frog, frog2018-09-09v4No1 / 61
311amnonlower in fermneted kimchi days>1 compared to day 0 ( high in day 0 early timepoints compared to days 1-9 in united states of america state of rhode island kimchi food (fermented) )2018-04-09v4No1 / 62
360amnoncommon agave, desert, root endosphere, mexico, guanajuato, agave tequiliana, cultivated environment, root2018-08-21v4No1 / 62
313amnoncommon in fishfeed (common sweden, fish feed)2018-04-10v4No1 / 71
407amnon high in wet season compared to dry season in costa rica feces monkey cebus capucinus white-faced capuchin wild 2018-11-21v4No1 / 79
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 80
353amnoncommon in captive Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, research facility, united kingdom)2018-07-30v4No1 / 84
539amnon high in ensete ventricosum var. maze compared to ensete ventricosum var. ketishe in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 84
318amnoncommon canada, vancouver, ocean, pacific ocean, kelp, nereocystis2018-04-16v4No1 / 86
353amnoncommon in captive Lissotriton vulgaris newts skin (common newt, adult, skin, cambridgeshire, research facility, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 86
600sheryoIncearses after 12 days of biochar ammendment in soil ( high in day 12 compared to day 1 in soil depth 0-5cm united states of america new york coarse-loamy soil ph 6 biochar )2020-03-27v4No1 / 86
306amnoncommon at whole plant corn at time 0 (common zea mays subsp. mays, corn, whole plant, israel)2018-03-19v4No1 / 96
360amnoncommon desert, soil, rhizosphere, agave, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v4No1 / 98
587amnoncommon israel, food product type, alfalfa sprouts, medicago sativa, producer c12020-02-10v3No1 / 106
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 110
492amnoncommon skin, adult, germany, bufo bufo, toad, common toad2019-02-27v4No1 / 115
613amnoncommon olsztyn, poland, aquarium, research facility, gastrointestinal system, gut, esox lucius, pike fry, fish2020-04-25v3No1 / 116
374amnoncommon skin, costa rica, amphibia, rhaebo haematiticus, truando toad, toad2018-09-09v4No1 / 121
539amnon high in ensete ventricosum var. gena compared to ensete ventricosum var. ketishe in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 123
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, pre-pupae insect diet2018-11-05v4No1 / 126
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 135
374amnoncommon skin, costa rica, amphibia, craugastor fitzingeri, common rain frog, frog2018-09-09v4No1 / 136
29amnoncommon brassica oleracea, french republic, seed2016-12-05v4No1 / 146
361amnoncommon leaf, austria, greenhouse, plant, dracaena draco2018-08-21v4No1 / 155
539amnoncommon ethiopia, ensete ventricosum, ethiopian banana, late timepoint, days 30-60, anaerobic fermentation, food (fermented)2019-07-31v4No1 / 161
322amnon high in adult compared to tadpole in frog osteopilus septentrionalis united states of america state of florida research facility digestive system 2018-04-23v4No1 / 163
374amnoncommon skin, costa rica, amphibia, craugastor bransfordii, bransford’s litter frog, frog2018-09-09v4No1 / 171
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 172
311amnoncommon ginger, united states of america, state of rhode island, foodon product type2018-04-09v4No1 / 180
371amnonlower in skin of amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in homo sapiens skin )2018-09-06v4No1 / 195
600sheryoIncearses after 12 days of stover ammendment in soil ( high in day 12 compared to day 1 in soil depth 0-5cm united states of america new york coarse-loamy soil ph 6 stover ammendment soil )2020-03-27v4No1 / 196
372amnon high in high fat diet compared to mouse chow in mouse mus musculus feces research facility united states of america 2018-09-07v4No1 / 199
617amnonhigher in cow milk of cows in alpine pasture compared to lowland farm ( high in alpine pasture alpine compared to lowland farm lowland pasture in farm italy cow milk (raw) cow milk (fluid) milk )2020-05-03v3No1 / 204
618amnoncommon early flowering stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 205
587amnoncommon israel, food product type, alfalfa sprouts, medicago sativa, producer c22020-02-10v3No1 / 215
466amnoncommon in cow feces left in field for 30-60 days (common feces, bos taurus, cow, farm, united states of america, state of georgia, late timepoints, 30-60 days)2019-01-14v4No1 / 221
499amnoncommon brazil, pond, water, pond water, fresh water2019-03-05v4No1 / 228
492amnoncommon skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 236
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, shelled egg2019-02-13v4No1 / 243
101amnon high in soil compared to rhizosphere in vitis vinifera united states of america merlot grapevine new york 2017-04-03v4No1 / 249
600sheryohigher in biochar ammendment soil ( high in biochar compared to unamended in soil depth 0-5cm united states of america new york coarse-loamy soil ph 6 day 82 )2020-03-27v4No1 / 252
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common maryland county, leaf)2016-12-09v4No1 / 298
406amnoncommon feces, south africa, ceratotherium simum, white rhinoceros2018-11-21v4No1 / 300
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 324
618amnoncommon late flowering stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 352
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 52020-04-22v4No1 / 383
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 32020-04-22v4No1 / 420
466amnonhigher in shaded compared to unshaded samples in cow feces left in field for 30-60 days ( high in shaded compared to unshaded sunlight in feces bos taurus cow farm united states of america state of georgia late timepoints 30-60 days )2019-01-14v4No1 / 432
353amnoncommon in wild Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, united kingdom)2018-07-30v4No1 / 456
360amnoncommon desert, soil, rhizosphere, agave, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 484
415amnoncommon rhizosphere, soil, citrus, orchard, united states of america, cultivated environment2018-11-27v4No1 / 494
539amnon high in days 30-60 anaerobic fermentation late timepoint compared to days 1-15 aerobic fermentation early timepoint in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 510
618amnon high in root endosphere root compared to rhizosphere in canada farm cannabis sativa 2020-05-04v4No1 / 510
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 518
98amnoncommon citrus, rhizosphere, immokalee, fl, root, state of florida2017-04-01v4No1 / 543
600sheryohigher in stover ammendment soil ( high in stover amended soil compared to unamended soil in soil depth 0-5cm united states of america new york coarse-loamy soil ph 6 day 82 )2020-03-27v4No1 / 567
146amnon high in rhizosphere compared to soil in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 590
536amnon high in terrestrial snake compared to aquatic snake in snake skin united states of america southern united states 2019-07-28v4No1 / 590
360amnon high in rhizosphere agave compared to soil in desert mexico state of california 2018-08-21v4No1 / 593
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 22020-04-22v4No1 / 596
318amnoncommon canada, vancouver, ocean, pacific ocean, red alga, mastocarpus2018-04-16v4No1 / 598
415amnoncommon rhizosphere, soil, citrus, orchard, south africa, cultivated environment2018-11-27v4No1 / 600
309amnon high in galium mollugo hedge bedstraw compared to other plants in rhizosphere germany 2018-04-05v4No1 / 618
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 42020-04-22v4No1 / 655
466amnonhigher in cow feces left in field for 30-60 days compared to initial feces ( high in late timepoints 30-60 days compared to early timepoints 0-2 days in feces bos taurus cow farm united states of america state of georgia )2019-01-14v4No1 / 662
415amnoncommon rhizosphere, soil, citrus, australia, orchard, cultivated environment2018-11-27v4No1 / 743
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 750
171amnon high in drought environment compared to control in soil united states of america state of california rhizosphere oryza sativa rice 2017-07-25v4No1 / 770
384amnon high in pair of nares nasal cavity compared to oral cavity saliva mouth in equus caballus horse canada farm 2018-10-22v4No1 / 791
454amnon high in summer compared to winter in elaphurus davidianus pere deer deer feces china 2019-01-10v4No1 / 791
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 830
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
126amnoncommon rhizosphere, germany, hordeum vulgare, winter barley2017-04-14v4No1 / 925
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
414amnon high in ph<6 npk fertilizer compared to ph>6 in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 963
624sheryoCommon in ryegrass rhizosphere soil after 30-40 days (common days 30-40, rhizosphere, ryegrass, ph 7-8, 10 cm depth, soil, jiangsu province, china)2020-05-11v4No1 / 966
462amnoncommon united states of america, state of tennessee, rhizosphere, populus, tree, depth 0-30cm, silt loam, cultivated environment2019-01-13v4No1 / 997
624sheryocommon in ryegrass rhizosphere soil amended with biochar after 30-40 days (common china, jiangsu province, soil, 10 cm depth, ph 7-8, ryegrass, rhizosphere, days 30-40, biochar)2020-05-11v4No1 / 1017
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
415amnoncommon rhizosphere, soil, citrus, orchard, kingdom of spain, cultivated environment2018-11-27v4No1 / 1099
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
309amnoncommon rhizosphere, germany, prunella vulgaris, woundwort2018-04-05v4No1 / 1217
415amnoncommon rhizosphere, soil, citrus, orchard, italy, cultivated environment2018-11-27v4No1 / 1279
420amnoncommon in soil of vegetables in organic plastic tunnel (common soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, organic farming, greenhouse soil, china, cultivated environment)2018-12-02v4No1 / 1294
309amnoncommon rhizosphere, germany, latyrus pratensis, meadow pea-vine2018-04-05v4No1 / 1296
309amnoncommon rhizosphere, germany, onobrychis viciifolia, common sainfoin2018-04-05v4No1 / 1323
600sheryoCommon in biochar ammended soil after 82 days (common soil, biochar, depth 0-5cm, united states of america, new york, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1326
600sheryoCommon in stover ammended soil after 82 days (common soil, depth 0-5cm, united states of america, new york, coarse-loamy soil, ph 6, day 82, stover ammendment )2020-03-27v4No1 / 1327
98amnoncommon citrus, rhizosphere, ft. pierce, fl, root, state of florida2017-04-01v4No1 / 1340
98amnoncommon citrus, rhizosphere, gainesville, fl, root, state of florida2017-04-01v4No1 / 1371
309amnoncommon rhizosphere, germany, plantago lanceolata, ribwort plantain2018-04-05v4No1 / 1386
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
309amnoncommon rhizosphere, germany, geranium pratense, meadow geranium2018-04-05v4No1 / 1434
271amnoncommon rhizosphere, glycine max, depth 0-20cm, soybean, china2018-01-09v4No1 / 1459
309amnoncommon rhizosphere, germany, festuca rubra, red fescue grass2018-04-05v4No1 / 1510
515amnon high in detritivorous beetle bulgaria compared to herbivorous beetle poland in whole body beetle 2019-04-19v4No1 / 1543
309amnoncommon rhizosphere, germany, galium mollugo, hedge bedstraw2018-04-05v4No1 / 1599
608sheryoCommon in wheat field in China, amended and unamended biochar, unamended with nitrogen fertilizer (common triticum aestivum l. cv., xiaoyan no. 22, china, silty clay, soil)2020-04-20v4No1 / 1643
141amnoncommon marine sediment, brackish water, sediment, caspian sea, depth 200m, sample depth 12-35cm2017-04-18v4No1 / 1659
608sheryoCommon in wheat field in China, amended and unamended biochar, amended with nitrogen fertilizer (common triticum aestivum l. cv., xiaoyan no. 22, china, silty clay, soil, urea enriched soil)2020-04-20v4No1 / 1682
309amnoncommon rhizosphere, germany, veronica chamaedrys, germander speedwell2018-04-05v4No1 / 1788
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>4, ph<5, china2018-02-11v4No1 / 1886
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>7, ph<8, china2018-02-11v4No1 / 2160
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>6, ph<7, china2018-02-11v4No1 / 2223
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
101amnoncommon vitis vinifera, united states of america, merlot, grapevine, new york, soil2017-04-03v4No1 / 2537
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>8, china2018-02-11v4No1 / 2646
271amnoncommon depth 0-20cm, soil, china2018-01-09v4No1 / 2856
155amnonlower in tightly bound root soil compared to loose soil and bulk soil ( high in bulk soil compared to root in triticum aestivum wheat soil china )2017-07-02v4No1 / 2933
422amnon high in ph 7-8 compared to ph 5-6 in soil paddy field soil oryza sativa heilongjiang province cultivated environment china 2018-12-04v4No1 / 3267
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>5, ph<6, china2018-02-11v4No1 / 3508
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5886
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7628
271amnon high in soil rhizosphere compared to root structure root in depth 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org