Search result for sequence:
TACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTCGGAAAGAAAGATGTGAAATCCCAGAGCTTAACTTTGGAACTGCATTTTTAACTACCGAGCTAGAGTGTGTCAGAGGGAGGTGGAATTCCGCG
common ontology terms
term enrichment score
TermScore
rhizosphere0.318313
soil0.240310
rainbow trout0.211765
oncorhynchus mykiss0.211765
cultivated environment0.200501
sweden0.173121
skin0.159468
fish0.154506
china0.151899
citrus0.134228
wheat0.134228
germany0.126195
united states of america0.124921
digestive system0.124590
depth 0-20cm0.115016
agricultural feature0.110599
orchard0.094595
research facility0.092908
food (fermented)0.091703
root0.089314
united kingdom0.084592
state of california0.083707
north china plain0.082192
vitis vinifera0.070671
gut content0.069444
cold environment0.069444
agave0.069444
cambridgeshire0.069444
triticum aestivum0.069444
frog0.068650
costa rica0.067114
newt0.067114
mexico0.062893
desert0.059172
farm0.058027
warm temperature habitat0.056338
18c0.056338
gastrointestinal system mucosa0.056338
12c0.056338
larvae insect diet0.056338
guanajuato0.056338
amphibia0.056338
ensete ventricosum0.056338
ethiopian banana0.056338
days 30-600.056338
anaerobic fermentation0.056338
glycine max0.056338
populus0.056338
LOWER IN root0.055944
LOWER IN soil0.055172
winter0.053571
ethiopia0.053333
late timepoint0.053333
state of tennessee0.051948
tree0.051948
leaf0.050209
state of florida0.050000
fresh water0.047059
adult0.044693
canada0.043796
jejunum0.043321
endosphere0.042857
koshi river0.042857
southern united states0.042857
agave tequiliana0.042857
tomato0.042857
state of rhode island0.042857
triturus cristatus0.042857
30-60 days0.042857
oryza sativa0.042403
grape0.041958
nepal0.041958
filtered 0.2um0.041958
snake0.041958
state of georgia0.041958
soybean0.041958
depth 10 cm0.041096
solanum lycopersicum0.041096
ileum0.041096
duodenum0.040678
free floating0.040268
stem0.039474
cow0.038710
late timepoints0.038710
pacific ocean0.037618
bos taurus0.035928
river0.035294
water0.035088
feces0.032818
day 00.029197
toad0.029197
heilongjiang province0.029197
paddy field soil0.029197
tributary0.028986
LOWER IN left colon0.028986
red pepper sauce0.028986
zea mays subsp. mays0.028986
corn0.028986
LOWER IN ensete ventricosum var. ketishe0.028986
lissotriton vulgaris0.028986
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.000000
agricultural feature0.750000
vitis vinifera0.666667
jejunum0.666667
day 00.666667
toad0.666667
citrus0.666667
heilongjiang province0.666667
paddy field soil0.666667
wheat0.666667
cultivated environment0.625000
endosphere0.500000
rainbow trout0.500000
oncorhynchus mykiss0.500000
gut content0.500000
warm temperature habitat0.500000
18c0.500000
gastrointestinal system mucosa0.500000
12c0.500000
cold environment0.500000
b. subtilis isolate titration0.500000
larvae insect diet0.500000
koshi river0.500000
tributary0.500000
southern united states0.500000
agkistrodon piscivorus0.500000
aquatic snake0.500000
pre pupae insect diet0.500000
fossorial snake0.500000
storeria dekayi0.500000
ground snake0.500000
agave0.500000
guanajuato0.500000
agave tequiliana0.500000
xylella fastidiosa temecula10.500000
pierce disease0.500000
LOWER IN pre pupae insect diet0.500000
tomato0.500000
LOWER IN transverse colon0.500000
LOWER IN left colon0.500000
red pepper sauce0.500000
high salt concentration0.500000
LOWER IN low salt concentration0.500000
zea mays subsp. mays0.500000
corn0.500000
fresh corn0.500000
LOWER IN fermented corn0.500000
LOWER IN defatted larvae insect diet0.500000
temp 12c0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN temp 18c0.500000
defatted larvae insects diet0.500000
amphibia0.500000
oophaga pumilio0.500000
strawberry poison frog0.500000
state of rhode island0.500000
kimchi0.500000
LOWER IN days 1-90.500000
cambridgeshire0.500000
triturus cristatus0.500000
ensete ventricosum0.500000
ethiopian banana0.500000
days 30-600.500000
anaerobic fermentation0.500000
ensete ventricosum var. maze0.500000
LOWER IN ensete ventricosum var. ketishe0.500000
kelp0.500000
nereocystis0.500000
lissotriton vulgaris0.500000
bufo bufo0.500000
common toad0.500000
rhaebo haematiticus0.500000
truando toad0.500000
ensete ventricosum var. gena0.500000
pre-pupae insect diet0.500000
craugastor fitzingeri0.500000
common rain frog0.500000
greenhouse0.500000
dracaena draco0.500000
craugastor bransfordii0.500000
bransford’s litter frog0.500000
ginger0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
30-60 days0.500000
pond0.500000
lithobates catesbeianus0.500000
pearl harbor0.500000
hydroides elegans0.500000
tubeworm0.500000
merlot0.500000
grapevine0.500000
new york0.500000
maryland county0.500000
food processing factory0.500000
shaded0.500000
LOWER IN unshaded0.500000
LOWER IN sunlight0.500000
agave salmiana0.500000
Fraction of annotations for the query sequences containing the term
TermScore
rhizosphere0.261194
united states of america0.231343
soil0.231343
research facility0.186567
china0.179104
sweden0.141791
digestive system0.141791
fish0.134328
rainbow trout0.134328
oncorhynchus mykiss0.134328
skin0.119403
cultivated environment0.119403
germany0.082090
citrus0.074627
wheat0.074627
depth 0-20cm0.067164
adult0.059701
agricultural feature0.059701
state of california0.052239
root0.052239
food (fermented)0.052239
feces0.052239
united kingdom0.052239
orchard0.052239
north china plain0.044776
winter0.044776
vitis vinifera0.037313
gut content0.037313
cold environment0.037313
agave0.037313
desert0.037313
mexico0.037313
costa rica0.037313
frog0.037313
newt0.037313
cambridgeshire0.037313
farm0.037313
triticum aestivum0.037313
warm temperature habitat0.029851
18c0.029851
gastrointestinal system mucosa0.029851
12c0.029851
larvae insect diet0.029851
water0.029851
fresh water0.029851
guanajuato0.029851
amphibia0.029851
ethiopia0.029851
ensete ventricosum0.029851
ethiopian banana0.029851
late timepoint0.029851
days 30-600.029851
anaerobic fermentation0.029851
leaf0.029851
state of florida0.029851
LOWER IN soil0.029851
glycine max0.029851
state of tennessee0.029851
populus0.029851
tree0.029851
LOWER IN root0.029851
grape0.022388
stem0.022388
endosphere0.022388
river0.022388
depth 10 cm0.022388
koshi river0.022388
nepal0.022388
free floating0.022388
filtered 0.2um0.022388
snake0.022388
southern united states0.022388
agave tequiliana0.022388
solanum lycopersicum0.022388
tomato0.022388
duodenum0.022388
jejunum0.022388
ileum0.022388
state of rhode island0.022388
triturus cristatus0.022388
canada0.022388
pacific ocean0.022388
bos taurus0.022388
cow0.022388
state of georgia0.022388
late timepoints0.022388
30-60 days0.022388
soybean0.022388
oryza sativa0.022388
fishmeal diet0.014925
tributary0.014925
root endosphere0.014925
LOWER IN control0.014925
mus musculus0.014925
LOWER IN caecum0.014925
LOWER IN right colon0.014925
LOWER IN left colon0.014925
red pepper sauce0.014925
capsicum annuum0.014925
sichuan province0.014925
Exp. ID User ID Description Date Region Flag Sequences
189amnonhighfreq united states of america, state of california, grape, vitis vinifera, stem, endosphere2017-08-30v4No1 / 5
313amnonhigh freq. in rainbow trout gut content grown in 18C water (highfreq sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, warm temperature habitat, 18c)2018-04-10v4No1 / 5
313amnonhigh freq. in rainbow trout gut mucosa grown in 18C water (highfreq sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, warm temperature habitat, 18c, gastrointestinal system mucosa)2018-04-10v4No1 / 5
313amnonhigh freq. in rainbow trout gut mucosa grown in 12C water (highfreq sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gastrointestinal system mucosa, 12c, cold environment)2018-04-10v4No1 / 6
313amnoncommon in rainbow trout gut mucosa grown in 18C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, warm temperature habitat, 18c, gastrointestinal system mucosa)2018-04-10v4No1 / 8
143amnonmedium level in single isolate samples using mobio powermag extraction (contamination)2017-04-19v4No1 / 9
313amnoncommon in rainbow trout gut content grown in 18C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, warm temperature habitat, 18c)2018-04-10v4No1 / 9
392amnonhighfreq fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, fishmeal diet2018-11-05v4No1 / 9
313amnonhigh freq. in rainbow trout gut content grown in 12C water (highfreq sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, 12c, cold environment)2018-04-10v4No1 / 10
313amnoncommon in rainbow trout gut mucosa grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gastrointestinal system mucosa, 12c, cold environment)2018-04-10v4No1 / 13
392amnonhighfreq fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, larvae insect diet2018-11-05v4No1 / 13
534amnonhighfreq river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 13
536amnonhighfreq snake, skin, united states of america, southern united states, agkistrodon piscivorus, aquatic snake2019-07-28v4No1 / 13
392amnonhighfreq fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, pre pupae insect diet2018-11-05v4No1 / 15
536amnonhighfreq snake, skin, united states of america, southern united states, fossorial snake, storeria dekayi, ground snake2019-07-28v4No1 / 15
360amnonhighfreq agave, desert, root endosphere, mexico, guanajuato, agave tequiliana, cultivated environment, root2018-08-21v4No1 / 17
189amnonhigherin stems of grape vines with pierce disease compared to control ( high in xylella fastidiosa temecula1 pierce disease compared to control in united states of america state of california grape vitis vinifera stem endosphere )2017-08-30v4No1 / 31
313amnoncommon in rainbow trout gut content grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, 12c, cold environment)2018-04-10v4No1 / 31
392amnon high in larvae insect diet compared to pre pupae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 32
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, fishmeal diet2018-11-05v4No1 / 34
146amnoncommon united states of america, solanum lycopersicum, tomato, botanical fruit food product2017-04-20v4No1 / 35
14amnon high in stomach duodenum jejunum ileum compared to caecum right colon transverse colon left colon feces in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 42
189amnoncommon united states of america, state of california, grape, vitis vinifera, stem, endosphere2017-08-30v4No1 / 43
547amnon high in high salt concentration compared to low salt concentration in red pepper sauce capsicum annuum sichuan province china food (fermented) 2019-08-15v4No1 / 43
306amnondecreases after 2-30 days of fermentation of insiled whole plant corn ( high in fresh corn day 0 compared to fermented corn in zea mays subsp. mays corn whole plant israel )2018-03-19v4No1 / 45
392amnon high in larvae insect diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 46
547amnoncommon red pepper sauce, capsicum annuum, sichuan province, china, food (fermented)2019-08-15v4No1 / 49
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 55
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, defatted larvae insects diet2018-11-05v4No1 / 55
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, larvae insect diet2018-11-05v4No1 / 55
374amnoncommon skin, costa rica, amphibia, oophaga pumilio, strawberry poison frog, frog2018-09-09v4No1 / 61
311amnonlower in fermneted kimchi days>1 compared to day 0 ( high in day 0 early timepoints compared to days 1-9 in united states of america state of rhode island kimchi food (fermented) )2018-04-09v4No1 / 62
360amnoncommon agave, desert, root endosphere, mexico, guanajuato, agave tequiliana, cultivated environment, root2018-08-21v4No1 / 62
313amnoncommon in fishfeed (common sweden, fish feed)2018-04-10v4No1 / 71
407amnon high in wet season compared to dry season in costa rica feces monkey cebus capucinus white-faced capuchin wild 2018-11-21v4No1 / 79
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 80
353amnoncommon in captive Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, research facility, united kingdom)2018-07-30v4No1 / 84
539amnon high in ensete ventricosum var. maze compared to ensete ventricosum var. ketishe in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 84
318amnoncommon canada, vancouver, ocean, pacific ocean, kelp, nereocystis2018-04-16v4No1 / 86
353amnoncommon in captive Lissotriton vulgaris newts skin (common newt, adult, skin, cambridgeshire, research facility, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 86
306amnoncommon at whole plant corn at time 0 (common zea mays subsp. mays, corn, whole plant, israel)2018-03-19v4No1 / 96
360amnoncommon desert, soil, rhizosphere, agave, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v4No1 / 98
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 110
492amnoncommon skin, adult, germany, bufo bufo, toad, common toad2019-02-27v4No1 / 115
374amnoncommon skin, costa rica, amphibia, rhaebo haematiticus, truando toad, toad2018-09-09v4No1 / 121
539amnon high in ensete ventricosum var. gena compared to ensete ventricosum var. ketishe in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 123
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, pre-pupae insect diet2018-11-05v4No1 / 126
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 135
374amnoncommon skin, costa rica, amphibia, craugastor fitzingeri, common rain frog, frog2018-09-09v4No1 / 136
29amnoncommon brassica oleracea, french republic, seed2016-12-05v4No1 / 146
361amnoncommon leaf, austria, greenhouse, plant, dracaena draco2018-08-21v4No1 / 155
539amnoncommon ethiopia, ensete ventricosum, ethiopian banana, late timepoint, days 30-60, anaerobic fermentation, food (fermented)2019-07-31v4No1 / 161
322amnon high in adult compared to tadpole in frog osteopilus septentrionalis united states of america state of florida research facility digestive system 2018-04-23v4No1 / 163
374amnoncommon skin, costa rica, amphibia, craugastor bransfordii, bransford’s litter frog, frog2018-09-09v4No1 / 171
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 172
311amnoncommon ginger, united states of america, state of rhode island, foodon product type2018-04-09v4No1 / 180
371amnonlower in skin of amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in homo sapiens skin )2018-09-06v4No1 / 195
372amnon high in high fat diet compared to mouse chow in mouse mus musculus feces research facility united states of america 2018-09-07v4No1 / 199
466amnoncommon in cow feces left in field for 30-60 days (common feces, bos taurus, cow, farm, united states of america, state of georgia, late timepoints, 30-60 days)2019-01-14v4No1 / 221
499amnoncommon brazil, pond, water, pond water, fresh water2019-03-05v4No1 / 228
492amnoncommon skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 236
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, shelled egg2019-02-13v4No1 / 243
101amnon high in soil compared to rhizosphere in vitis vinifera united states of america merlot grapevine new york 2017-04-03v4No1 / 249
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common maryland county, leaf)2016-12-09v4No1 / 298
406amnoncommon feces, south africa, ceratotherium simum, white rhinoceros2018-11-21v4No1 / 300
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 324
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
466amnonhigher in shaded compared to unshaded samples in cow feces left in field for 30-60 days ( high in shaded compared to unshaded sunlight in feces bos taurus cow farm united states of america state of georgia late timepoints 30-60 days )2019-01-14v4No1 / 432
353amnoncommon in wild Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, united kingdom)2018-07-30v4No1 / 456
360amnoncommon desert, soil, rhizosphere, agave, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 484
415amnoncommon rhizosphere, soil, citrus, orchard, united states of america, cultivated environment2018-11-27v4No1 / 494
539amnon high in days 30-60 anaerobic fermentation late timepoint compared to days 1-15 aerobic fermentation early timepoint in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 510
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 518
98amnoncommon citrus, rhizosphere, immokalee, fl, root, state of florida2017-04-01v4No1 / 543
146amnon high in rhizosphere compared to soil in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 590
536amnon high in terrestrial snake compared to aquatic snake in snake skin united states of america southern united states 2019-07-28v4No1 / 590
360amnon high in rhizosphere agave compared to soil in desert mexico state of california 2018-08-21v4No1 / 593
318amnoncommon canada, vancouver, ocean, pacific ocean, red alga, mastocarpus2018-04-16v4No1 / 598
415amnoncommon rhizosphere, soil, citrus, orchard, south africa, cultivated environment2018-11-27v4No1 / 600
309amnon high in galium mollugo hedge bedstraw compared to other plants in rhizosphere germany 2018-04-05v4No1 / 618
466amnonhigher in cow feces left in field for 30-60 days compared to initial feces ( high in late timepoints 30-60 days compared to early timepoints 0-2 days in feces bos taurus cow farm united states of america state of georgia )2019-01-14v4No1 / 662
415amnoncommon rhizosphere, soil, citrus, australia, orchard, cultivated environment2018-11-27v4No1 / 743
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 750
171amnon high in drought environment compared to control in soil united states of america state of california rhizosphere oryza sativa rice 2017-07-25v4No1 / 770
384amnon high in pair of nares nasal cavity compared to oral cavity saliva mouth in equus caballus horse canada farm 2018-10-22v4No1 / 791
454amnon high in summer compared to winter in elaphurus davidianus pere deer deer feces china 2019-01-10v4No1 / 791
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 830
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
126amnoncommon rhizosphere, germany, hordeum vulgare, winter barley2017-04-14v4No1 / 925
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
414amnon high in ph<6 npk fertilizer compared to ph>6 in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 963
462amnoncommon united states of america, state of tennessee, rhizosphere, populus, tree, depth 0-30cm, silt loam, cultivated environment2019-01-13v4No1 / 997
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
415amnoncommon rhizosphere, soil, citrus, orchard, kingdom of spain, cultivated environment2018-11-27v4No1 / 1099
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
309amnoncommon rhizosphere, germany, prunella vulgaris, woundwort2018-04-05v4No1 / 1217
415amnoncommon rhizosphere, soil, citrus, orchard, italy, cultivated environment2018-11-27v4No1 / 1279
420amnoncommon in soil of vegetables in organic plastic tunnel (common soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, organic farming, greenhouse soil, china, cultivated environment)2018-12-02v4No1 / 1294
309amnoncommon rhizosphere, germany, latyrus pratensis, meadow pea-vine2018-04-05v4No1 / 1296
309amnoncommon rhizosphere, germany, onobrychis viciifolia, common sainfoin2018-04-05v4No1 / 1323
98amnoncommon citrus, rhizosphere, ft. pierce, fl, root, state of florida2017-04-01v4No1 / 1340
98amnoncommon citrus, rhizosphere, gainesville, fl, root, state of florida2017-04-01v4No1 / 1371
309amnoncommon rhizosphere, germany, plantago lanceolata, ribwort plantain2018-04-05v4No1 / 1386
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
309amnoncommon rhizosphere, germany, geranium pratense, meadow geranium2018-04-05v4No1 / 1434
271amnoncommon rhizosphere, glycine max, depth 0-20cm, soybean, china2018-01-09v4No1 / 1459
309amnoncommon rhizosphere, germany, festuca rubra, red fescue grass2018-04-05v4No1 / 1510
515amnon high in detritivorous beetle bulgaria compared to herbivorous beetle poland in whole body beetle 2019-04-19v4No1 / 1543
309amnoncommon rhizosphere, germany, galium mollugo, hedge bedstraw2018-04-05v4No1 / 1599
141amnoncommon marine sediment, brackish water, sediment, caspian sea, depth 200m, sample depth 12-35cm2017-04-18v4No1 / 1659
309amnoncommon rhizosphere, germany, veronica chamaedrys, germander speedwell2018-04-05v4No1 / 1788
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>4, ph<5, china2018-02-11v4No1 / 1886
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>7, ph<8, china2018-02-11v4No1 / 2160
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>6, ph<7, china2018-02-11v4No1 / 2223
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
101amnoncommon vitis vinifera, united states of america, merlot, grapevine, new york, soil2017-04-03v4No1 / 2537
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>8, china2018-02-11v4No1 / 2646
271amnoncommon depth 0-20cm, soil, china2018-01-09v4No1 / 2856
155amnonlower in tightly bound root soil compared to loose soil and bulk soil ( high in bulk soil compared to root in triticum aestivum wheat soil china )2017-07-02v4No1 / 2933
422amnon high in ph 7-8 compared to ph 5-6 in soil paddy field soil oryza sativa heilongjiang province cultivated environment china 2018-12-04v4No1 / 3267
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>5, ph<6, china2018-02-11v4No1 / 3508
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5886
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7628
271amnon high in soil rhizosphere compared to root structure root in depth 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org