Search result for sequence:
TACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTGTGCAAGACAGATGTGAAATCCCCGGGCTTAACCTGGGAATTGCATTTGTGACTGCACGGCTAGAGTGTGTCAGAGGGGGGTAGAATTCCACG
common ontology terms
term enrichment score
TermScore
soil0.359762
desert0.203077
rhizosphere0.185582
triticum aestivum0.147692
mexico0.139130
china0.124722
shaanxi province0.112360
wheat0.109290
ph 60.106383
loess plateau0.106383
zea mays0.096154
semi-arid0.094118
guanajuato0.091954
silt loam0.091743
state of new york0.089686
biochar0.089219
united states of america0.085624
LOWER IN root0.085106
state of california0.080692
ph 7-80.076677
leaf0.074766
agricultural feature0.074766
depth (soil) 0-20cm0.074534
ph<60.071856
potting mix0.071856
merlot0.070588
grapevine0.070588
myrtillocactus geometrizans0.070588
opuntia robusta0.070588
depth 1cm0.070588
soil crust0.070588
agave0.070588
LOWER IN 10 years0.070588
LOWER IN reforestation0.070588
LOWER IN robinia pseudoacacia0.070588
panax notoginseng0.070588
sanqi plants0.070588
xundian county0.070588
vitis vinifera0.068182
cactus0.068182
yunnan province0.068182
glycine max0.067039
state of utah0.065934
cultivated environment0.065934
river0.065934
pot expreiment0.065934
air0.060914
water0.059701
israel0.057416
fresh water0.055046
agricultural field0.052174
LOWER IN ph&gt;60.048780
LOWER IN plant litter0.048780
ph 6-6.50.048193
size < 10um0.048193
north china plain0.048193
geranium pratense0.048193
meadow geranium0.048193
orchard0.048193
downstream0.048193
LOWER IN upstream0.048193
chuquisaca department0.048193
forearm0.048193
coarse-loamy soil0.048193
day 820.048193
triticum aestivum l. cv., xiaoyan no. 220.048193
silty clay0.048193
difenoconazole0.048193
fungicide0.048193
tobacco field0.048193
limestone0.048193
substraat arabidopsis0.048193
lentse potgrond0.048193
mesocosm0.048193
robinia pseudoacacia0.048193
reforestation0.048193
LOWER IN rhizosphere0.047619
freshwater lake0.047619
dust0.047059
state of idaho0.047059
heilongjiang province0.047059
black soil0.047059
mollisol0.047059
age 5-13 years0.047059
arm0.047059
depth (soil) 0-5cm0.047059
depth 0-20cm0.047059
skin0.046154
rice0.045977
npk fertilizer0.045977
bolivia0.045977
leaf surface0.044944
lake0.043956
bulk soil0.043011
oryza sativa0.043011
root0.042553
kingdom of the netherlands0.042105
state of georgia0.042105
LOWER IN leaf0.040000
city0.039604
Fraction of dbbact annotations with this term covered by the query
TermScore
quaternary laterite soil1.000000
cucurbita moschata1.000000
pumpkin1.000000
river water1.000000
fuzhou city prefecture1.000000
xiyuan river1.000000
ph<60.666667
LOWER IN ph&gt;60.666667
semi-arid0.666667
potting mix0.666667
LOWER IN plant litter0.666667
maryland county0.500000
seleniferous0.500000
non-seleniferous0.500000
central park0.500000
merlot0.500000
grapevine0.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
ph 6-6.50.500000
root zone soil0.500000
ph 7-90.500000
quarry0.500000
duluth complex0.500000
depth 2.5cm0.500000
size < 10um0.500000
clear day0.500000
dust storm0.500000
lake erie0.500000
boechera stricta0.500000
north china plain0.500000
ph>7, ph<80.500000
ph>5, ph<60.500000
depth 1cm0.500000
soil crust0.500000
non mature crust0.500000
LOWER IN mature crust0.500000
geranium pratense0.500000
meadow geranium0.500000
LOWER IN other plants0.500000
guanajuato0.500000
agave0.500000
agave deserti0.500000
agave tequiliana0.500000
LOWER IN agave0.500000
kuwait0.500000
orchard0.500000
mediterranean0.500000
downstream0.500000
LOWER IN upstream0.500000
lower mississippi river0.500000
LOWER IN higher mississippi river0.500000
quesnel lake0.500000
contaminated sediment0.500000
carnivorous beetle0.500000
carabidae0.500000
LOWER IN staphylinidae0.500000
chuquisaca department0.500000
forearm0.500000
minas gerais state0.500000
campos rupestres0.500000
barbacenia macrantha0.500000
urocyon littoralis0.500000
santa catalina island fox0.500000
urocyon littoralis catalinae0.500000
LOWER IN perianal skin0.500000
coarse-loamy soil0.500000
day 820.500000
LOWER IN stover amended0.500000
amended with biochar0.500000
triticum aestivum l. cv., xiaoyan no. 220.500000
silty clay0.500000
urea enriched soil0.500000
tobacco plant present0.500000
difenoconazole0.500000
fungicide0.500000
tobacco field0.500000
limestone0.500000
ryegrass0.500000
days 30-400.500000
without plants0.500000
LOWER IN columbia spotted frog0.500000
LOWER IN rana luteiventris0.500000
substraat arabidopsis0.500000
lentse potgrond0.500000
LOWER IN inoculated with verticillium dahliae0.500000
not inoculated with verticillium dahliae0.500000
murashige and skoog (ms) medium0.500000
LOWER IN cherokia georgiana georgiana0.500000
LOWER IN millipede0.500000
mesocosm0.500000
LOWER IN 10 years0.500000
LOWER IN reforestation0.500000
LOWER IN robinia pseudoacacia0.500000
shaanxi province0.500000
LOWER IN 20 years0.500000
LOWER IN 30 years0.500000
20 years0.500000
robinia pseudoacacia0.500000
reforestation0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.658228
china0.354430
united states of america0.291139
rhizosphere0.164557
desert0.139241
mexico0.101266
triticum aestivum0.101266
state of california0.088608
depth (soil) 0-20cm0.075949
state of new york0.063291
wheat0.063291
zea mays0.063291
ph 60.063291
silt loam0.063291
loess plateau0.063291
shaanxi province0.063291
leaf0.050633
LOWER IN root0.050633
semi-arid0.050633
water0.050633
agricultural feature0.050633
guanajuato0.050633
biochar0.050633
ph 7-80.050633
ph<60.037975
vitis vinifera0.037975
merlot0.037975
grapevine0.037975
myrtillocactus geometrizans0.037975
opuntia robusta0.037975
cactus0.037975
LOWER IN rhizosphere0.037975
air0.037975
israel0.037975
fresh water0.037975
homo sapiens0.037975
skin0.037975
glycine max0.037975
state of utah0.037975
depth 1cm0.037975
soil crust0.037975
agave0.037975
cultivated environment0.037975
river0.037975
potting mix0.037975
LOWER IN 10 years0.037975
LOWER IN reforestation0.037975
LOWER IN robinia pseudoacacia0.037975
agricultural field0.037975
panax notoginseng0.037975
sanqi plants0.037975
xundian county0.037975
yunnan province0.037975
pot expreiment0.037975
control0.025316
LOWER IN ph&gt;60.025316
ph 6-6.50.025316
bulk soil0.025316
oryza sativa0.025316
rice0.025316
LOWER IN biofilm0.025316
dust0.025316
size < 10um0.025316
lake0.025316
freshwater lake0.025316
state of idaho0.025316
LOWER IN leaf0.025316
root0.025316
north china plain0.025316
winter0.025316
germany0.025316
geranium pratense0.025316
meadow geranium0.025316
leaf surface0.025316
heilongjiang province0.025316
black soil0.025316
mollisol0.025316
npk fertilizer0.025316
orchard0.025316
downstream0.025316
LOWER IN upstream0.025316
child0.025316
age 5-13 years0.025316
bolivia0.025316
rural community0.025316
chuquisaca department0.025316
arm0.025316
forearm0.025316
LOWER IN feces0.025316
depth (soil) 0-5cm0.025316
coarse-loamy soil0.025316
day 820.025316
triticum aestivum l. cv., xiaoyan no. 220.025316
silty clay0.025316
difenoconazole0.025316
fungicide0.025316
tobacco field0.025316
limestone0.025316
depth 0-20cm0.025316
substraat arabidopsis0.025316
Exp. ID User ID Description Date Region Flag Sequences
709sheryoHigher in potting mix soil mixed with Murashige and Skoog (MS) medium and not inoculated with Verticillium dahliae ( high in not inoculated with verticillium dahliae compared to inoculated with verticillium dahliae in murashige and skoog (ms) medium substraat arabidopsis lentse potgrond soil potting mix kingdom of the netherlands )2028-05-16v4No1 / 34
171amnonlower in rice rhizosphere soil compared to bulk soil (no rice) ( high in soil compared to rhizosphere in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 73
878amnoncommon pm10, respirable suspended particulate matter, city, municipality of beijing, china, air2022-03-11v3No1 / 203
298amnonlower in wetted soil 18hrs compared to dried soil ( high in dry compared to irrigated in soil desert united states of america state of utah depth 1cm soil crust )2018-02-20v4No1 / 205
360amnoncommon agave, desert, leaf, leaf surface, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v4No1 / 210
196amnonhigher in water compared to biofilm ( high in water compared to biofilm biofilm in drinking water united states of america )2017-09-12v4No1 / 223
415amnonlower in citrus from humid subtropical compared to mediterranean and semi-arid climate ( high in mediterranean semi-arid compared to subtropical in rhizosphere soil citrus orchard cultivated environment )2018-11-27v4No1 / 264
205amnonlower in depth 15cm compared to 2.5cm in rock piles in duluth complex ( high in depth 2.5cm compared to depth (soil) 15cm depth in rock united states of america quarry duluth complex ph 4-5 state of minnesota sulfide )2017-10-03v4No1 / 265
602sheryohigher in rhizoshere of tomato plant roots planted in potting mix amended with biochar ( high in amended with biochar compared to unamended in potting mix rhizosphere israel solanum lycopersicum )2020-04-05v4No1 / 270
752sheryoHigher in treatments without biochar compared to treatments with biochar in soil planted with Panax notoginseng amended with 2% biochar ( high in without biochar compared to biochar in panax notoginseng sanqi plants ph 6 xundian county yunnan province china pot expreiment soil )2021-03-11v3No1 / 273
226amnoncommon water, lake, lake erie, united states of america, freshwater lake, fresh water2017-10-29v4No1 / 316
582amnon high in ear canal external acoustic meatus compared to perianal skin rectum in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 374
360amnoncommon desert, soil, mexico, guanajuato2018-08-21v4No1 / 437
298amnonhigher in non-mature soil crust ( high in non mature crust compared to mature crust in soil desert united states of america state of utah depth 1cm soil crust )2018-02-20v4No1 / 480
375amnoncommon in oil contaminated desert soil (common soil, kuwait, desert, oil contaminated soil)2018-09-09v4No1 / 490
360amnoncommon desert, soil, mexico, guanajuato, cultivated environment2018-08-21v4No1 / 500
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf2017-04-15v4No1 / 562
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
647amnon high in water freshwater lake lake compared to columbia spotted frog rana luteiventris frog skin in state of montana united states of america 2020-09-06v4No1 / 593
609sheryoCommon in soil with tobacco plants amended with difenoconazole fungicide and biochar (common biochar, tobacco plant present, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 634
360amnoncommon desert, soil, state of california2018-08-21v4No1 / 637
360amnoncommon agave, desert, state of california, agave deserti, leaf, leaf surface2018-08-21v4No1 / 649
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in downstream lower mississippi river compared to upstream higher mississippi river in mississippi river water river fresh water depth (water) 1m united states of america free floating filtered 0.2um )2019-01-07v4No1 / 652
309amnon high in geranium pratense meadow geranium compared to other plants in rhizosphere germany 2018-04-05v4No1 / 688
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin australia foot )2017-11-05v4No1 / 708
752sheryoCommon in soil planted with Panax notoginseng (common panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 730
709sheryoCommon in potting mix soil from the Netherlands, substraat arabidopsis, Lentse Potgrond (common substraat arabidopsis, lentse potgrond, soil, potting mix, kingdom of the netherlands)2028-05-16v4No1 / 752
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
752sheryoCommon in soil planted with Panax notoginseng amended with2% biochar (common biochar, panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 783
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil2017-04-15v4No1 / 884
171amnoncommon in soil with rice growth irrigation protocol (common soil, united states of america, state of california, depth 5cm)2017-07-25v4No1 / 890
996amnon high in city anthropogenic environmental material downstream compared to upstream in river water china fuzhou city prefecture xiyuan river fresh water surface water river 2022-12-28v3No1 / 890
206amnoncommon in dust storm air from israel particles <10um size (common israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 902
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide and biochar (common biochar, without plants, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-07-05v4No1 / 910
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
414amnon high in ph<6 npk fertilizer compared to ph>6 in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 963
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, root zone soil2017-04-15v4No1 / 968
266amnoncommon in soil from MIL garden (common soil, united states of america, state of idaho, ph 6.5)2017-12-18v4No1 / 980
360amnon high in soil compared to agave rhizosphere in desert mexico state of california 2018-08-21v4No1 / 992
933amnoncommon guangxi zhuang autonomous region, ph 5.5, quaternary laterite soil, research facility, china, cucurbita moschata, pumpkin, rhizosphere2022-09-11v3No1 / 1002
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
624sheryocommon in ryegrass rhizosphere soil amended with biochar after 30-40 days (common china, jiangsu province, soil, 10 cm depth, ph 7-8, ryegrass, rhizosphere, days 30-40, biochar)2020-05-11v4No1 / 1017
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, npk fertilizer, ph<6, china2018-11-26v4No1 / 1105
360amnonlower in leaf surface compared to soil in agave plants ( high in soil compared to leaf leaf surface in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 1108
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
298amnoncommon soil, desert, united states of america, state of utah, depth 1cm, soil crust2018-02-20v4No1 / 1265
788amnon high in soil compared to plant litter in mesocosm state of georgia united states of america 2021-05-31v4No1 / 1280
798amnon high in ph 7-8 soil compared to hay plant litter litter bag in depth (soil) 10 cm depth (soil) 0-20cm orchard apricot prunus armeniaca apennine mountains italy 2021-06-13v3No1 / 1285
101amnon high in rhizosphere compared to root in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 1315
600sheryoCommon in unammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1395
788amnon high in soil compared to cherokia georgiana georgiana millipede feces in mesocosm state of georgia united states of america 2021-05-31v4No1 / 1395
76amnoncommon in non-seleniferous soil (common soil, rhizosphere, united states of america, non-seleniferous, state of florida)2017-02-28v4No1 / 1414
309amnoncommon rhizosphere, germany, geranium pratense, meadow geranium2018-04-05v4No1 / 1434
76amnoncommon in seleniferous soil (common soil, rhizosphere, united states of america, selenium, seleniferous, woodland area)2017-02-28v4No1 / 1438
600sheryolower in stover ammendment soil ( high in unamended soil compared to stover amended in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 day 82 )2020-03-27v4No1 / 1612
608sheryoCommon in wheat field in China, amended and unamended biochar, unamended with nitrogen fertilizer (common triticum aestivum l. cv., xiaoyan no. 22, china, silty clay, soil)2020-04-20v4No1 / 1643
507amnonhigher in mine tailing contaminated sediment compared to uncontaminated control ( high in contaminated sediment compared to control in lake sediment sediment canada quesnel lake province of british columbia )2019-03-17v4No1 / 1681
608sheryoCommon in wheat field in China, amended and unamended biochar, amended with nitrogen fertilizer (common triticum aestivum l. cv., xiaoyan no. 22, china, silty clay, soil, urea enriched soil)2020-04-20v4No1 / 1682
101amnoncommon state of new york, vitis vinifera, united states of america, merlot, grapevine, rhizosphere2017-04-03v4No1 / 1980
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>7, ph<8, china2018-02-11v4No1 / 2160
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
101amnoncommon state of new york, vitis vinifera, united states of america, merlot, grapevine, soil2017-04-03v4No1 / 2537
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
271amnoncommon depth (soil) 0-20cm, soil, china2018-01-09v4No1 / 2856
837sheryoHigher in soil of agricultural feild compared to after 20 years reforestation with Black locust trees , shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to 20 years robinia pseudoacacia reforestation in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 2892
837sheryoHigher in soil of agricultural feild compared to after 30 years reforestation with Black locust trees , shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to robinia pseudoacacia 30 years reforestation in silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 2927
155amnonlower in tightly bound root soil compared to loose soil and bulk soil ( high in bulk soil compared to root in triticum aestivum wheat soil china )2017-07-02v4No1 / 2933
837sheryoHigher in soil in agricultural feild compared after 10 years reforestation with Black locust trees, shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to 10 years reforestation robinia pseudoacacia in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 2994
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>5, ph<6, china2018-02-11v4No1 / 3508
271amnon high in soil compared to rhizosphere glycine max soybean in depth (soil) 0-20cm china 2018-01-09v4No1 / 4853
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 20 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5270
100amnon high in ph ph<6 compared to ph>6 in soil urban biome park new york city central park 2017-04-03v4No1 / 5770
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5886
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7628
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org