Search result for sequence:
TACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTGTGTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAATTGCATTTGAGACTGCACGGCTAGAGTGTGTCAGAGGGGGGTAGAATTCCACG
common ontology terms
term enrichment score
TermScore
ant0.302872
costa rica0.227941
skin0.201117
rhizosphere0.121607
stomach0.119601
united states of america0.113492
brazil0.109863
china0.091527
larval stage0.078788
soil0.070877
root0.067416
minas gerais state0.063291
campos rupestres0.063291
new york city0.063158
sea water0.060345
homo sapiens0.059395
pseudomyrmex elongatus0.051282
pseudomyrmex cubaensis0.051282
root endosphere0.051282
campinas0.051282
cannabis sativa0.051282
suan cai0.051282
fermneted chinese cabbage0.051282
saccharum0.050000
sugarcane0.050000
fermented vegetable food product0.050000
two weeks0.050000
greenhouse0.046512
bird0.045455
canada0.044843
state of texas0.044444
farm0.041580
pacific ocean0.040000
nile tilapia0.038961
army ant0.038961
gaster0.038961
pet0.038961
pseudomyrmex spinicola0.038961
ensete ventricosum0.038961
ethiopian banana0.038961
days 30-600.038961
anaerobic fermentation0.038961
LOWER IN 20 years0.038961
shaanxi province0.038961
3%-5% salt concentration0.038961
oreochromis niloticus0.038217
crematogaster0.038217
loess plateau0.038217
high salt concentration0.038217
black soil0.038217
jilin province0.038217
glycine max0.037855
frog0.037500
ethiopia0.037500
late timepoint0.037500
sediment0.037037
ph 70.036810
silt loam0.036145
cat0.035503
food (fermented)0.034884
felis catus0.034286
mexico0.034286
state of florida0.034286
research facility0.033898
fresh water0.033708
adult0.032328
state of california0.031830
ocean0.030612
amphibia0.030151
israel0.030151
water0.029557
child0.029056
toad0.026490
bermuda0.026316
contact lens0.026316
skin under eyes0.026316
brackish water0.026316
caspian sea0.026316
linepithema humile0.026316
argentine ant0.026316
yellowstone national park0.026316
arachis hypogaea0.026316
peanut0.026316
sea urchin0.026316
artificial seawater0.026316
pseudomyrmex nigrocinctus0.026316
pseudomyrmex flavicornis0.026316
pheidole0.026316
pseudomyrmex nigropilosus0.026316
pseudomyrmex pallidus0.026316
hani peatland0.026316
baekdudaegan0.026316
chuquisaca department0.026316
forearm0.026316
vellozia epidendroides0.026316
barbacenia macrantha0.026316
early flowering stage0.026316
LOWER IN hypolimnion0.026316
epilimnion0.026316
bog lake0.026316
Fraction of dbbact annotations with this term covered by the query
TermScore
cuticle1.000000
chitin-based cuticle1.000000
atlantic rainforest1.000000
parque estadual serra do mar-núcleo picinguaba1.000000
odontomachus hastatus1.000000
sao paulo state1.000000
lanternfish1.000000
myctophidae1.000000
isla coronado norte1.000000
xiyuan river1.000000
fuzhou city prefecture1.000000
river water1.000000
toad0.666667
ant0.666667
bermuda0.500000
contact lens0.500000
skin under eyes0.500000
nile tilapia0.500000
quail0.500000
coturnix coturnix0.500000
depth (water) 2000-4000m0.500000
sediment depth 0-12cm0.500000
brackish water0.500000
caspian sea0.500000
depth (water) 150-600m0.500000
sediment depth 12-35cm0.500000
linepithema humile0.500000
argentine ant0.500000
eciton burchellii0.500000
army ant0.500000
gaster0.500000
labidus praedator0.500000
neivamyrmex0.500000
seed structure0.500000
train0.500000
boston0.500000
yellowstone national park0.500000
thermophilic sediment0.500000
bon portage island0.500000
oceanodroma leucorhoa0.500000
seabird0.500000
LOWER IN burrow0.500000
jiulong river0.500000
arachis hypogaea0.500000
peanut0.500000
boechera stricta0.500000
melopsittacus undulatus0.500000
parakeet0.500000
pet0.500000
serinus canaria0.500000
canary0.500000
nymphicus hollandicus0.500000
cockatiel0.500000
sea urchin0.500000
artificial seawater0.500000
bronchial brush0.500000
rhaebo haematiticus0.500000
truando toad0.500000
craugastor fitzingeri0.500000
common rain frog0.500000
craugastor bransfordii0.500000
bransford’s litter frog0.500000
fungus growing ant0.500000
myrmicocrypta ednaella0.500000
pseudomyrmex gracilis0.500000
pseudomyrmex nigrocinctus0.500000
pseudomyrmex flavicornis0.500000
pseudomyrmex spinicola0.500000
pheidole0.500000
pseudomyrmex nigropilosus0.500000
pseudomyrmex viduus0.500000
pseudomyrmex elongatus0.500000
pseudomyrmex cubaensis0.500000
pseudomyrmex pallidus0.500000
pseudomyrmex simplex0.500000
anal swab0.500000
myotis myotis0.500000
bat0.500000
greater mouse eared bat0.500000
bufo bufo0.500000
common toad0.500000
hani peatland0.500000
baekdudaegan0.500000
LOWER IN riganqiao peatland0.500000
LOWER IN ph 5.5-6.50.500000
chuquisaca department0.500000
forearm0.500000
ensete ventricosum0.500000
ethiopian banana0.500000
days 30-600.500000
anaerobic fermentation0.500000
LOWER IN days 1-150.500000
LOWER IN aerobic fermentation0.500000
ensete ventricosum var. ketishe0.500000
LOWER IN ensete ventricosum var. gena0.500000
minas gerais state0.500000
campos rupestres0.500000
vellozia epidendroides0.500000
barbacenia macrantha0.500000
root endosphere0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.418919
costa rica0.209459
ant0.195946
skin0.162162
china0.155405
homo sapiens0.135135
stomach0.121622
rhizosphere0.094595
soil0.087838
larval stage0.087838
brazil0.074324
research facility0.054054
sea water0.047297
new york city0.040541
feces0.040541
adult0.040541
root0.040541
canada0.033784
minas gerais state0.033784
campos rupestres0.033784
farm0.033784
state of texas0.027027
pacific ocean0.027027
sediment0.027027
bird0.027027
pseudomyrmex elongatus0.027027
pseudomyrmex cubaensis0.027027
root endosphere0.027027
saccharum0.027027
sugarcane0.027027
campinas0.027027
greenhouse0.027027
cannabis sativa0.027027
suan cai0.027027
fermneted chinese cabbage0.027027
fermented vegetable food product0.027027
two weeks0.027027
state of california0.020270
caecum0.020270
oreochromis niloticus0.020270
nile tilapia0.020270
ocean0.020270
cat0.020270
felis catus0.020270
army ant0.020270
gaster0.020270
LOWER IN soil0.020270
water0.020270
fresh water0.020270
glycine max0.020270
mexico0.020270
pet0.020270
state of florida0.020270
amphibia0.020270
frog0.020270
crematogaster0.020270
pseudomyrmex spinicola0.020270
child0.020270
ethiopia0.020270
ensete ventricosum0.020270
ethiopian banana0.020270
days 30-600.020270
anaerobic fermentation0.020270
late timepoint0.020270
food (fermented)0.020270
LOWER IN 20 years0.020270
silt loam0.020270
loess plateau0.020270
shaanxi province0.020270
3%-5% salt concentration0.020270
high salt concentration0.020270
israel0.020270
food product type0.020270
black soil0.020270
jilin province0.020270
ph 70.020270
bermuda0.013514
nipple0.013514
conjunctiva0.013514
contact lens0.013514
skin of face0.013514
skin under eyes0.013514
LOWER IN caecum0.013514
marine sediment0.013514
brackish water0.013514
caspian sea0.013514
LOWER IN saliva0.013514
LOWER IN mouth0.013514
linepithema humile0.013514
argentine ant0.013514
body proper0.013514
yellowstone national park0.013514
geothermal field0.013514
high temperature environment0.013514
infant0.013514
age < 3 years0.013514
russia0.013514
river0.013514
sus scrofa0.013514
pig0.013514
Exp. ID User ID Description Date Region Flag Sequences
408amnon high in stomach compared to larval stage in ant costa rica united states of america pseudomyrmex spinicola 2018-11-22v4No1 / 5
408amnoncommon ant, costa rica, united states of america, pheidole, stomach2018-11-22v4No1 / 5
408amnondominant ant, costa rica, united states of america, pseudomyrmex cubaensis, stomach2018-11-22v4No1 / 5
52amnondominant homo sapiens, nipple, skin, state of california2017-01-19v4No1 / 6
183amnoncommon eciton burchellii, army ant, stomach, gaster2017-08-15v4No1 / 6
183amnoncommon army ant, stomach, gaster, labidus praedator2017-08-15v4No1 / 6
52amnoncommon homo sapiens, skin, nipple, state of california2017-01-19v4No1 / 7
182amnoncommon argentina, linepithema humile, argentine ant, body proper2017-08-15v4No1 / 7
183amnoncommon neivamyrmex, army ant, stomach, gaster2017-08-15v4No1 / 7
408amnoncommon ant, costa rica, united states of america, pseudomyrmex flavicornis, stomach2018-11-22v4No1 / 7
408amnondominant ant, costa rica, united states of america, pseudomyrmex elongatus, stomach2018-11-22v4No1 / 7
408amnondominant ant, costa rica, united states of america, pseudomyrmex elongatus, larval stage2018-11-22v4No1 / 7
408amnondominant ant, costa rica, united states of america, pseudomyrmex cubaensis, larval stage2018-11-22v4No1 / 7
79amnondominant skin, united states of america, globicephala macrorhynchus, short finned pilot whale2017-03-03v4No1 / 7
182amnoncommon linepithema humile, argentine ant, body proper, united states of america2017-08-15v4No1 / 8
408amnoncommon ant, costa rica, united states of america, pseudomyrmex gracilis, stomach2018-11-22v4No1 / 8
408amnoncommon ant, costa rica, united states of america, crematogaster, stomach2018-11-22v4No1 / 8
408amnoncommon ant, costa rica, united states of america, pseudomyrmex cubaensis, larval stage2018-11-22v4No1 / 8
646amnondominant lung, bronchoalveolar lavage, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 8
408amnondominant ant, costa rica, united states of america, pheidole, stomach2018-11-22v4No1 / 9
408amnoncommon ant, costa rica, united states of america, eciton, stomach2018-11-22v4No1 / 9
58amnondominant homo sapiens, new york city, conjunctiva2017-02-02v4No1 / 10
408amnoncommon ant, costa rica, united states of america, pseudomyrmex elongatus, stomach2018-11-22v4No1 / 10
408amnoncommon ant, costa rica, united states of america, pseudomyrmex elongatus, larval stage2018-11-22v4No1 / 10
408amnoncommon ant, costa rica, united states of america, pseudomyrmex cubaensis, stomach2018-11-22v4No1 / 10
79amnondominant skin, united states of america, harbor seal, phoca vitulina2017-03-03v4No1 / 10
408amnoncommon ant, costa rica, united states of america, pseudomyrmex nigrocinctus, larval stage2018-11-22v4No1 / 11
408amnoncommon ant, costa rica, united states of america, pseudomyrmex spinicola, stomach2018-11-22v4No1 / 11
408amnoncommon ant, costa rica, united states of america, pseudomyrmex nigropilosus, stomach2018-11-22v4No1 / 11
408amnoncommon ant, costa rica, united states of america, larval stage, pseudomyrmex pallidus2018-11-22v4No1 / 11
408amnondominant ant, costa rica, united states of america, larval stage, pseudomyrmex pallidus2018-11-22v4No1 / 11
108amnoncommon state of texas, research facility, united states of america, caecum, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 12
351amnonhigh freq. in aquarium artificial sea water where sea urchins were grown (dominant sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water, aquarium)2018-07-30v4No1 / 12
408amnoncommon ant, costa rica, united states of america, pseudomyrmex nigrocinctus, stomach2018-11-22v4No1 / 12
198amnon high in sediment compared to water in yellowstone national park united states of america geothermal field high temperature environment 2017-09-14v4No1 / 13
408amnondominant ant, costa rica, united states of america, crematogaster, stomach2018-11-22v4No1 / 13
58amnondominant homo sapiens, new york city, skin of face, skin under eyes2017-02-02v4No1 / 14
58amnondominant homo sapiens, new york city, contact lens2017-02-02v4No1 / 15
408amnoncommon ant, costa rica, united states of america, pseudomyrmex flavicornis, larval stage2018-11-22v4No1 / 15
79amnondominant skin, united states of america, stenella attenuata2017-03-03v4No1 / 16
108amnonincreases during fasting in nile tilapia caecum ( high in fasting late timepoints compared to early timepoints in state of texas research facility united states of america caecum oreochromis niloticus nile tilapia )2017-04-07v4No1 / 17
158amnondominant cat, felis catus, united states of america, external acoustic meatus, ear canal2017-07-06v4No1 / 18
408amnoncommon ant, costa rica, united states of america, pseudomyrmex nigropilosus, larval stage2018-11-22v4No1 / 18
408amnoncommon ant, costa rica, united states of america, crematogaster, larval stage2018-11-22v4No1 / 19
9amnondominant bermuda, sea water2016-10-27v4No1 / 20
58amnoncommon homo sapiens, new york city, skin of face, skin under eyes2017-02-02v4No1 / 21
408amnoncommon ant, costa rica, united states of america, pseudomyrmex spinicola, larval stage2018-11-22v4No1 / 22
858amnondominant 3%-5% salt concentration, suan cai, fermneted chinese cabbage, china, fermented vegetable food product, high salt concentration, two weeks2022-01-11v4No1 / 22
58amnoncommon homo sapiens, new york city, contact lens2017-02-02v4No1 / 23
408amnoncommon ant, costa rica, united states of america, larval stage, pseudomyrmex simplex2018-11-22v4No1 / 23
489amnoncommon feces, anal swab, myotis myotis, bat, greater mouse eared bat, french republic2019-02-25v4No1 / 24
35amnoncommon tanzania, dense settlement biome, hospital, breast milk, homo sapiens2016-12-06v4No1 / 25
158amnonhigher in skin sites compared to mouth in cats ( high in skin compared to saliva mouth in felis catus cat united states of america )2017-07-06v4No1 / 26
58amnoncommon homo sapiens, new york city, conjunctiva2017-02-02v4No1 / 28
397amnoncommon panama, digestive system, intestine, fungus growing ant, myrmicocrypta ednaella2018-11-14v4No1 / 28
710amnonsuspected contaminant (common in blanks) (contamination)2028-05-20v4No1 / 28
193amnonlower in nares of people working in dairy farms ( high in control compared to bos taurus farm in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 29
79amnoncommon skin, united states of america, stenella longirostris, spinner dolphin2017-03-03v4No1 / 34
79amnoncommon skin, united states of america, steno bredanensis, rough-toothed dolphin2017-03-03v4No1 / 35
749amnoncommon third decade human stage, seoul, female, south korea, adult, skin of cheek, skin, homo sapiens2021-03-10v4No1 / 36
749amnoncommon third decade human stage, skin of forehead, seoul, female, south korea, adult, skin, homo sapiens2021-03-10v4No1 / 36
79amnondominant skin, united states of america, delphinus delphis2017-03-03v4No1 / 36
158amnoncommon cat, felis catus, united states of america, axilla2017-07-06v4No1 / 37
79amnoncommon peponocephala electra, skin, united states of america2017-03-03v4No1 / 40
79amnoncommon skin, united states of america, stenella attenuata2017-03-03v4No1 / 40
614amnondecreases in picher plant fluid grown in lab ( high in wild early time points days 0-3 compared to research facility late time points days 57-60 in harvard forest plant fluid pitcher fluid united states of america commonwealth of massachusetts pitcher plant sarracenia purpurea )2020-04-26v4No1 / 42
79amnoncommon skin, united states of america, globicephala macrorhynchus, short finned pilot whale2017-03-03v4No1 / 42
587amnoncommon israel, food product type, producer c1, vigna radiata, mung bean sprouts2020-02-10v3No1 / 42
302amnoncommon in feces of parakeet pet birds (common bird, melopsittacus undulatus, parakeet, mexico, feces, pet)2018-03-05v4No1 / 44
302amnoncommon in feces of canary pet birds (common bird, mexico, feces, pet, serinus canaria, canary)2018-03-05v4No1 / 47
408amnoncommon ant, costa rica, united states of america, pseudomyrmex viduus, larval stage2018-11-22v4No1 / 47
79amnoncommon skin, united states of america, harbor seal, phoca vitulina2017-03-03v4No1 / 49
975amnoncommon lanternfish, myctophidae, isla coronado norte, depth (water) 500-1000m, intestine, hindgut, gut content, pacific ocean, fish2022-12-24v4No1 / 54
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
302amnoncommon in feces of Cockatiel pet birds (common bird, mexico, feces, pet, nymphicus hollandicus, cockatiel)2018-03-05v4No1 / 63
858amnoncommon 0%-1% salt concentration, low salt concentration, two weeks, suan cai, fermneted chinese cabbage, china, fermented vegetable food product2022-01-11v4No1 / 65
858amnon high in 3%-5% salt concentration high salt concentration compared to 0%-1% salt concentration low salt concentration in suan cai fermneted chinese cabbage china fermented vegetable food product two weeks 2022-01-11v4No1 / 67
587amnoncommon israel, food product type, vigna radiata, mung bean sprouts, producer c22020-02-10v3No1 / 67
858amnoncommon 3%-5% salt concentration, high salt concentration, suan cai, fermneted chinese cabbage, china, fermented vegetable food product, two weeks2022-01-11v4No1 / 75
108amnon high in caecum compared to colon in state of texas research facility united states of america oreochromis niloticus nile tilapia 2017-04-07v4No1 / 80
9amnoncommon bermuda, sea water2016-10-27v4No1 / 91
354amnon high in bronchus bronchial brush bronchial epithelium compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 94
539amnon high in ensete ventricosum var. ketishe compared to ensete ventricosum var. gena in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 110
198amnoncommon sediment, yellowstone national park, united states of america, thermophilic sediment, geothermal field, high temperature environment2017-09-13v4No1 / 113
79amnoncommon skin, united states of america, delphinus delphis2017-03-03v4No1 / 113
492amnoncommon skin, adult, germany, bufo bufo, toad, common toad2019-02-27v4No1 / 115
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v4No1 / 116
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
374amnoncommon skin, costa rica, amphibia, rhaebo haematiticus, truando toad, toad2018-09-09v4No1 / 121
590amnoncommon in turtle pond water (common china, turtle farm, farm, hainan autonomous prefecture, pond water, water)2020-02-10v4No1 / 127
374amnoncommon skin, costa rica, amphibia, craugastor fitzingeri, common rain frog, frog2018-09-09v4No1 / 136
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 146
615amnon high in stem endosphere upper stem stem compared to leaf endosphere leaf in endosphere saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 153
108amnon high in colon compared to caecum in quail state of texas research facility united states of america coturnix coturnix 2017-04-07v4No1 / 157
192amnoncommon seed, seed structure, brassica napus2017-09-05v4No1 / 161
539amnoncommon ethiopia, ensete ventricosum, ethiopian banana, late timepoint, days 30-60, anaerobic fermentation, food (fermented)2019-07-31v4No1 / 161
374amnoncommon skin, costa rica, amphibia, craugastor bransfordii, bransford’s litter frog, frog2018-09-09v4No1 / 171
883amnoncommon oil contaminated soil, oilfield, yellow river delta, china, shengli oilfield, soil2022-03-20v4No1 / 187
618amnoncommon early flowering stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 205
755sheryocommon in wild soybean (Glycine soja) rhizosphere (common ph 7, jilin province, rhizosphere, soil, black soil, china, glycine soja)2021-03-18v3No1 / 210
138amnoncommon in ocean water depth 5m (common ocean, pacific ocean, depth (water) 5m, sea water)2017-04-18v4No1 / 214
587amnoncommon israel, food product type, alfalfa sprouts, medicago sativa, producer c22020-02-10v3No1 / 215
499amnoncommon brazil, pond, water, pond water, fresh water2019-03-05v4No1 / 228
755sheryocommon in domesticated soybean (Glycine max) rhizosphere (common glycine max, china, black soil, soil, rhizosphere, jilin province, ph 7)2021-03-18v3No1 / 234
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
61amnoncommon canis lupus familiaris, skin, research facility, united states of america, inguinal region2017-02-05v4No1 / 327
471amnon high in adult compared to tadpole in digestive system frog osteopilus septentrionalis research facility united states of america state of florida 2019-01-14v4No1 / 328
512amnoncommon fen, peatland, peat soil, soil, hani peatland, baekdudaegan, ph 5-6, china2019-03-22v4No1 / 329
932amnon high in cuticle chitin-based cuticle compared to stomach gaster in atlantic rainforest parque estadual serra do mar-núcleo picinguaba odontomachus hastatus sao paulo state ant brazil tropical moist broadleaf forest biome 2022-08-30v4No1 / 334
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
618amnoncommon late flowering stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 352
512amnon high in hani peatland baekdudaegan ph 5-6 compared to riganqiao peatland tibetan plateau ph 5.5-6.5 in fen peatland peat soil soil china 2019-03-22v4No1 / 363
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
718amnon high in epilimnion compared to hypolimnion in "south sparkling bog" lake ph 4.5-5 dimictic lake freshwater lake bog lake united states of america state of wisconsin 2028-05-23v4No1 / 382
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
755sheryocommon in domesticated rice (Oryza stavia) rhizosphere (common oryza sativa, ph 7, jilin province, rhizosphere, soil, black soil, china)2021-03-18v3No1 / 415
259amnonlower in fertilized soil (npk) compared to non-fertilized ( high in non-fertilized soil compared to fertilized soil in soil rhizosphere ph 5 arachis hypogaea peanut china )2017-12-02v4No1 / 483
718amnon high in epilimnion compared to hypolimnion in freshwater lake bog lake united states of america state of wisconsin ph 4.5-5 dimictic lake "north sparkling bog" lake 2028-05-23v4No1 / 488
373amnoncommon soil, rhizosphere, oryza sativa, rice, hunan province, rice field, china2018-09-08v4No1 / 501
539amnon high in days 30-60 anaerobic fermentation late timepoint compared to days 1-15 aerobic fermentation early timepoint in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 510
618amnon high in root endosphere root compared to rhizosphere in canada farm cannabis sativa 2020-05-04v4No1 / 510
138amnoncommon in ocean water depth 1000m (common sea water, ocean, pacific ocean, depth (water) 1000m)2017-04-18v4No1 / 566
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth (soil) 50cm jiulong river fujian province china 2017-11-23v4No1 / 581
883amnon high in depth (soil) 60-100cm compared to depth (soil) 0-20cm in oilfield yellow river delta china shengli oilfield oil contaminated soil soil 2022-03-20v4No1 / 627
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
138amnoncommon in ocean water depth 2000-4000m (common sea water, ocean, pacific ocean, depth (water) 2000-4000m)2017-04-18v4No1 / 674
271amnon high in rhizosphere glycine max soybean compared to soil in depth (soil) 0-20cm china 2018-01-09v4No1 / 750
615amnoncommon endosphere, root, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 776
548amnoncommon in endopytic roots of Vellozia epidendroides (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, plant, root)2019-08-15v4No1 / 800
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
996amnon high in upstream compared to city anthropogenic environmental material downstream in river surface water fresh water xiyuan river fuzhou city prefecture china river water 2022-12-28v3No1 / 894
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
615amnoncommon saccharum, sugarcane, rhizosphere, campinas, brazil, greenhouse2020-04-27v4No1 / 974
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
548amnoncommon minas gerais state, campos rupestres, brazil, rhizosphere, vellozia epidendroides2019-08-15v4No1 / 1040
618amnon high in early flowering stage compared to late flowering stage in rhizosphere canada farm cannabis sativa 2020-05-04v4No1 / 1040
266amnon high in leaf compared to root in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 1175
615amnon high in rhizosphere compared to soil in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 1181
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
271amnoncommon depth (soil) 0-20cm, rhizosphere, glycine max, soybean, china2018-01-09v4No1 / 1459
141amnoncommon sediment depth 0-12cm, marine sediment, brackish water, sediment, caspian sea, depth (water) 150-600m2017-04-18v4No1 / 1549
141amnoncommon sediment depth 12-35cm, marine sediment, brackish water, sediment, caspian sea, depth (water) 200m2017-04-18v4No1 / 1659
901amnon high in rhizosphere compared to bulk sediment in depth (sediment) 0-20cm taihu lake depth (water) 20-100cm taihu national park china lake sediment 2022-04-25v4No1 / 1892
837sheryoHigher in soil of agricultural feild compared to after 20 years reforestation with Black locust trees , shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to 20 years robinia pseudoacacia reforestation in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 2892
837sheryoHigher in soil after 10 years compared to 20 years of reforestation with Black locust trees, shaanxi, China ( high in 10 years compared to 20 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 3585
837sheryoHigher in soil after 30 years compared to 20 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 20 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 3936

Problems / suggestions? Please email info AT dbbact DOT org