Search result for sequence:
TACGTAGGGTGCAAGCGTTATCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCCGCGCCGGGTACGGGCGGGCTTGAGTGCGGTAGGGGAGACTGGAATTCCCGG
common ontology terms
term enrichment score
TermScore
homo sapiens0.656215
feces0.604607
adult0.430266
united states of america0.250507
infant0.220586
child0.203789
china0.124299
control0.117876
germany0.114148
female0.107002
city0.086674
obesity0.073596
kingdom of spain0.067164
monkey0.065336
research facility0.065109
sweden0.063528
state of california0.062810
obsolete_juvenile stage0.060264
india0.058252
italy0.057992
breast fed0.053950
formula fed0.052533
rural community0.050715
3-month-old human stage0.046243
kingdom of denmark0.045889
israel0.044280
wild0.043697
1-month-old human stage0.042430
age < 3 years0.039526
fourth decade human stage0.039526
2-5 year-old child stage0.039396
ulcerative colitis0.039293
state of colorado0.039293
homosexual0.035871
msm0.035871
12-month-old human stage0.035156
jiangsu province0.035026
state of new york0.033582
heterosexual0.031936
msw0.031936
fifth decade human stage0.031894
age 5-13 years0.031809
colombia0.031809
parkinson's disease0.031725
rhesus macaque0.031558
south korea0.030948
macaca mulatta0.029685
male0.029460
skin0.029423
finland0.027595
russia0.027469
pregnancy0.027344
age0.027158
captive0.025518
obese body mass index status0.024048
taiwan0.024048
under-1-year-old human stage0.023928
biopsy0.023928
zambia0.023857
chuquisaca department0.023857
republic of congo0.023857
nouabale-ndoki national park0.023857
human late adulthood stage0.023715
kingdom of norway0.023669
poland0.023576
2-year-old human stage0.023576
hiv infection0.023483
bolivia0.023301
amsterdam0.023301
mus musculus0.023285
high bmi0.023211
kingdom of the netherlands0.022770
digestive system0.021938
LOWER IN control0.021180
small village0.020094
metabolic syndrome0.020060
overweight body mass index status0.020060
state of oklahoma0.020060
estonia0.020060
republic of china0.020060
age 7 months0.019960
13-year-old human stage0.019960
indonesia0.019960
municipality of yogyakarta0.019960
age 4-10 years0.019960
ecuador0.019960
oncorhynchus mykiss0.019960
rainbow trout0.019960
mouse0.019900
rectal swab0.019861
food allergy0.019763
duodenum0.019634
crohn's disease0.019569
river0.019569
LOWER IN adult0.019455
fish0.019011
caecum0.018204
water0.017162
gay0.016118
2-month-old human stage0.016097
Fraction of dbbact annotations with this term covered by the query
TermScore
homosexual0.833333
msm0.833333
heterosexual0.800000
msw0.800000
obesity0.750000
small village0.750000
fifth decade human stage0.750000
LOWER IN 1-month-old human stage0.750000
obese body mass index status0.750000
taiwan0.750000
gay0.750000
metabolic syndrome0.666667
LOWER IN animal product diet0.666667
2-month-old human stage0.666667
venezuela0.666667
amerindian0.666667
LOWER IN 1-year-old human stage0.666667
arm0.666667
age 5-13 years0.666667
overweight body mass index status0.666667
state of oklahoma0.666667
estonia0.666667
colombia0.666667
age < 3 years0.666667
fourth decade human stage0.666667
adolescent stage0.666667
sigmoid colon0.666667
medellin metropolitan area0.666667
republic of china0.666667
young adult stage0.666667
india0.625000
rural community0.600000
2-5 year-old child stage0.600000
parkinson's disease0.600000
city0.578947
under-1-year-old human stage0.571429
biopsy0.571429
ulcerative colitis0.555556
state of colorado0.555556
homo sapiens0.547529
infant0.541667
child0.527778
high arabinoxylan and resistant starch diet0.500000
plant based diet0.500000
vellore district0.500000
breast fed0.500000
zambia0.500000
papio ursinus0.500000
grayfoot chacma baboon0.500000
hunter gatherer0.500000
hirundo rustica0.500000
barn swallow0.500000
outdoor0.500000
age 7 months0.500000
indoor0.500000
office0.500000
forearm0.500000
chuquisaca department0.500000
LOWER IN formula fed0.500000
LOWER IN weight loss0.500000
LOWER IN weight loss diet0.500000
gaz:000521000.500000
small waist circumference0.500000
LOWER IN waist circumference0.500000
LOWER IN large waist circumference0.500000
LOWER IN age 7 months0.500000
new delhi0.500000
azerbaijan0.500000
papio kindae0.500000
kinda baboon0.500000
state of arizona0.500000
phoenix0.500000
dysplasia of cervix0.500000
acute severe colitis0.500000
before antibiotics0.500000
LOWER IN amoxicillin0.500000
LOWER IN doxycycline0.500000
novosibirsk0.500000
saguinus imperator0.500000
como zoo0.500000
emperor tamarin0.500000
bangladesh0.500000
peru0.500000
tunapuco0.500000
tharu0.500000
agrarian0.500000
LOWER IN forager0.500000
LOWER IN chepang0.500000
himalayas0.500000
13-year-old human stage0.500000
cheyenne0.500000
native american0.500000
arapaho0.500000
age one week0.500000
17-29-years-old human0.500000
rhesus macaque0.500000
indonesia0.500000
municipality of yogyakarta0.500000
age 0-6 months0.500000
mammalian milk beverage0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.855397
homo sapiens0.818737
adult0.382892
united states of america0.264766
infant0.138493
child0.126273
china0.107943
control0.087576
germany0.077393
female0.067210
research facility0.057026
city0.046843
state of california0.038697
obesity0.038697
monkey0.036660
kingdom of spain0.036660
sweden0.034623
italy0.032587
obsolete_juvenile stage0.032587
india0.030550
breast fed0.028513
formula fed0.028513
wild0.026477
rural community0.026477
kingdom of denmark0.024440
3-month-old human stage0.024440
israel0.024440
1-month-old human stage0.022403
ulcerative colitis0.020367
state of colorado0.020367
2-5 year-old child stage0.020367
age < 3 years0.020367
fourth decade human stage0.020367
jiangsu province0.020367
state of new york0.018330
12-month-old human stage0.018330
homosexual0.018330
msm0.018330
male0.018330
skin0.016293
age 5-13 years0.016293
south korea0.016293
parkinson's disease0.016293
colombia0.016293
heterosexual0.016293
msw0.016293
macaca mulatta0.016293
captive0.016293
rhesus macaque0.016293
fifth decade human stage0.016293
LOWER IN control0.014257
age0.014257
russia0.014257
finland0.014257
mus musculus0.014257
pregnancy0.014257
zambia0.012220
under-1-year-old human stage0.012220
bolivia0.012220
chuquisaca department0.012220
poland0.012220
high bmi0.012220
2-year-old human stage0.012220
human late adulthood stage0.012220
kingdom of the netherlands0.012220
amsterdam0.012220
kingdom of norway0.012220
hiv infection0.012220
mouse0.012220
republic of congo0.012220
nouabale-ndoki national park0.012220
biopsy0.012220
obese body mass index status0.012220
taiwan0.012220
digestive system0.012220
metabolic syndrome0.010183
age 7 months0.010183
overweight body mass index status0.010183
state of oklahoma0.010183
estonia0.010183
small village0.010183
13-year-old human stage0.010183
indonesia0.010183
municipality of yogyakarta0.010183
crohn's disease0.010183
caecum0.010183
LOWER IN adult0.010183
food allergy0.010183
age 4-10 years0.010183
ecuador0.010183
rectal swab0.010183
republic of china0.010183
oncorhynchus mykiss0.010183
fish0.010183
rainbow trout0.010183
duodenum0.010183
river0.010183
water0.010183
diet0.008147
2-month-old human stage0.008147
Exp. ID User ID Description Date Region Flag Sequences
467amnonhigher in arabinoxylan and resistant starch diet compared to normal diet ( high in high fiber plant fiber cell high arabinoxylan and resistant starch diet compared to control diet in feces homo sapiens metabolic syndrome adult kingdom of denmark )2019-01-14v4No1 / 1
63amnon high in diet plant based diet compared to animal product diet in feces homo sapiens united states of america 2017-04-12v4No1 / 6
332amnoncommon homo sapiens, city, infant, vellore district, india, 2-month-old human stage2018-05-14v4No1 / 8
394amnon high in ulcerative colitis compared to control in feces homo sapiens united states of america adult state of california 2018-11-06v4No1 / 8
332amnondominant homo sapiens, city, infant, vellore district, india, 2-month-old human stage2018-05-14v4No1 / 9
797amnoncommon feces, homo sapiens, infant, germany, breast fed, 1-month-old human stage2021-06-13v3No1 / 9
411amnondominant feces, zambia, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 10
371amnondominant feces, homo sapiens, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 11
161amnonhigh freq. in barn swallows in colorado (dominant feces, united states of america, state of colorado, hirundo rustica, barn swallow)2017-07-12v4No1 / 12
460amnonhigh freq. in outdoor air (dominant united states of america, air, state of california, outdoor)2019-01-12v4No1 / 12
669amnoncommon feces, homo sapiens, infant, sweden, 2-month-old human stage2020-09-26v4No1 / 12
797amnoncommon feces, homo sapiens, infant, germany, breast fed, age 7 months2021-06-13v3No1 / 12
241amnonhigher in babies age <1 year compared to age 1-3 years ( high in age under-1-year-old human stage compared to age 1-3 years 2-year-old human stage 1-year-old human stage in feces homo sapiens infant )2017-11-13v4No1 / 13
460amnonhigh freq. in occupied office air (dominant united states of america, air, state of california, indoor, office)2019-01-12v4No1 / 13
517amnondominant homo sapiens, arm, skin, forearm, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 13
669amnondominant feces, homo sapiens, infant, sweden, 2-month-old human stage2020-09-26v4No1 / 13
797amnon high in breast fed compared to formula fed in feces homo sapiens infant germany 3-month-old human stage 2021-06-13v3No1 / 13
721amnonlower in high protein weight loss diet compared to control diet ( high in control diet compared to weight loss weight loss diet high protein diet in feces homo sapiens obesity adult scotland overweight body mass index status gaz:00052100 )2028-05-23v4No1 / 14
564amnon high in control compared to autistic disorder in feces homo sapiens child italy 2-5 year-old child stage 2019-11-18v3No1 / 14
797amnondominant feces, homo sapiens, infant, germany, breast fed, age 7 months2021-06-13v3No1 / 14
131amnonnegatively correlated with waist circumference ( high in small waist circumference compared to waist circumference large waist circumference in feces homo sapiens south korea )2017-04-16v4No1 / 15
276amnondominant feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 15
339amnondominant feces, homo sapiens, infant, india, under-1-year-old human stage2018-05-24v4No1 / 15
517amnondominant feces, homo sapiens, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 15
651amnondominant feces, homo sapiens, united states of america, adult, state of alabama, parkinson's disease2020-09-13v4No1 / 15
797amnon high in 3-month-old human stage compared to age 7 months in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 15
797amnoncommon feces, homo sapiens, infant, germany, breast fed, 3-month-old human stage2021-06-13v3No1 / 15
797amnoncommon feces, homo sapiens, infant, germany, formula fed, 1-month-old human stage2021-06-13v3No1 / 15
797amnondominant feces, homo sapiens, infant, germany, breast fed, 3-month-old human stage2021-06-13v3No1 / 15
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, 1-month-old human stage2018-01-14v4No1 / 16
352amnondominant feces, homo sapiens, new delhi, india2018-07-30v4No1 / 16
365amnondominant feces, homo sapiens, child, azerbaijan, obsolete_juvenile stage2018-08-30v4No1 / 16
411amnondominant feces, zambia, monkey, wild, papio kindae, kinda baboon2018-11-23v4No1 / 16
535amnonhigh freq. in adult vaginal samples with cervical dysplasia (dominant homo sapiens, united states of america, female, vagina, adult, state of arizona, phoenix, dysplasia of cervix)2019-07-25v4No1 / 16
659amnondominant feces, homo sapiens, ulcerative colitis, child, acute severe colitis2020-09-19v4No1 / 16
659amnon high in before antibiotics compared to antibiotic vancomycin metronidazole amoxicillin doxycycline in feces homo sapiens ulcerative colitis child acute severe colitis 2020-09-19v4No1 / 16
683amnondominant during antibiotics treatment in feces (dominant feces, homo sapiens, united states of america, antibiotic, vancomycin, adult, state of california, metronidazole, neomycin)2028-03-04v4No1 / 16
680amnondominant feces, homo sapiens, obesity, adult, russia, novosibirsk2028-03-04v3No1 / 16
289amnondominant feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 17
400amnonhigh freq. in feces of european american females (dominant feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 17
607amnondominant feces, homo sapiens, control, germany2020-04-19v4No1 / 17
797amnon high in breast fed compared to formula fed in feces homo sapiens infant germany age 7 months 2021-06-13v3No1 / 17
797amnoncommon feces, homo sapiens, infant, germany, formula fed, 3-month-old human stage2021-06-13v3No1 / 17
273amnondominant feces, homo sapiens, infant, kingdom of denmark, 1-month-old human stage2018-01-14v4No1 / 18
284amnondominant feces, homo sapiens, female, infant, state of california, 6-month-old human stage2018-01-27v4No1 / 18
339amnondominant feces, homo sapiens, adult, india2018-05-24v4No1 / 18
607amnondominant feces, homo sapiens, germany, parkinson's disease2020-04-19v4No1 / 18
625amnondominant feces, united states of america, zoological garden, state of minnesota, saguinus imperator, como zoo, emperor tamarin2020-05-16v4No1 / 18
650amnondominant feces, homo sapiens, united states of america, adult, state of new york, asian2020-09-09v4No1 / 18
663amnondominant feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 18
564amnondominant feces, homo sapiens, control, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 18
797amnondominant feces, homo sapiens, infant, germany, breast fed, 12-month-old human stage2021-06-13v3No1 / 18
799amnonhigher before ketogenic diet compared to after ketogenic diet in obese participants ( high in control diet compared to ketogenic diet in feces homo sapiens obesity adult estonia high bmi )2021-06-13v3No1 / 18
62amnondominant feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 19
121amnondominant feces, homo sapiens, adult, bangladesh2017-04-13v4No1 / 19
276amnondominant feces, homo sapiens, adult, peru, small village, tunapuco, rural community2018-01-22v4No1 / 19
339amnoncommon feces, homo sapiens, infant, india, under-1-year-old human stage2018-05-24v4No1 / 19
401amnondominant feces, homo sapiens, united states of america, adult2018-11-18v4No1 / 19
404amnondominant feces, homo sapiens, city, adult, colombia2018-11-20v4No1 / 19
449amnondominant feces, homo sapiens, colombia2019-01-09v4No1 / 19
477amnonhigher in agrarian tharu population compared to foraging chepang population ( high in tharu agrarian compared to forager chepang in feces homo sapiens adult nepal himalayas rural community )2019-01-28v4No1 / 19
797amnondominant feces, homo sapiens, child, germany, breast fed, 2-year-old human stage2021-06-13v3No1 / 19
797amnondominant feces, homo sapiens, infant, germany, formula fed, 1-month-old human stage2021-06-13v3No1 / 19
45amnonhigh freq. in feces babies <2 years in india (dominant feces, homo sapiens, infant, india)2016-12-19v4No1 / 20
197amnondominant feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, 13-year-old human stage2017-09-12v4No1 / 20
238amnondominant feces, homo sapiens, colombia2017-11-07v4No1 / 20
242amnonhigh freq. in native-americans (dominant feces, homo sapiens, united states of america, state of oklahoma, cheyenne, native american, arapaho)2017-11-14v4No1 / 20
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, age one week, 1-month-old human stage2018-01-14v4No1 / 20
273amnondominant feces, homo sapiens, infant, kingdom of denmark, age one week, 1-month-old human stage2018-01-14v4No1 / 20
273amnondominant feces, homo sapiens, infant, kingdom of denmark, 1-year-old human stage2018-01-14v4No1 / 20
284amnoncommon feces, homo sapiens, female, infant, state of california, age 2 months2018-01-27v4No1 / 20
284amnondominant feces, homo sapiens, female, infant, state of california, age 2 months2018-01-27v4No1 / 20
394amnondominant feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 20
484amnondominant feces, homo sapiens, united states of america, adult, state of michigan, 17-29-years-old human2019-02-13v4No1 / 20
591amnon high in parkinson's disease compared to control in feces homo sapiens united states of america adult human late adulthood stage 2020-02-17v4No1 / 20
601amnon high in control compared to type 2 diabetes mellitus in feces homo sapiens adult china 2020-03-30v4No1 / 20
629amnondominant feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, homosexual, msm2020-05-31v4No1 / 20
629amnondominant feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, heterosexual, msw2020-05-31v4No1 / 20
650amnondominant feces, homo sapiens, united states of america, adult, caucasian, state of new york, european2020-09-09v4No1 / 20
671amnondominant feces, united states of america, research facility, macaca mulatta, age 1 month, monkey, captive, rhesus macaque2020-09-27v4No1 / 20
564amnondominant feces, homo sapiens, autistic disorder, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 20
723amnoncommon feces, homo sapiens, infant, child, indonesia, municipality of yogyakarta, age 0-6 months2021-01-02v3No1 / 20
797amnoncommon feces, homo sapiens, infant, germany, breast fed, 12-month-old human stage2021-06-13v3No1 / 20
797amnondominant feces, homo sapiens, infant, germany, formula fed, age 7 months2021-06-13v3No1 / 20
797amnondominant feces, homo sapiens, infant, germany, formula fed, 3-month-old human stage2021-06-13v3No1 / 20
797amnondominant feces, homo sapiens, infant, germany, breast fed, 1-month-old human stage2021-06-13v3No1 / 20
24amnonappears on transition to cow milk ( high in mammalian milk beverage compared to breast milk in feces homo sapiens infant )2016-12-01v4No1 / 21
240amnonhigh freq. in infants age <3 years (dominant feces, homo sapiens, infant, finland, age < 3 years)2017-11-12v4No1 / 21
241amnonhigh freq. in babies age < 3 years in finland (dominant feces, homo sapiens, infant, finland, age < 3 years)2017-11-13v4No1 / 21
247amnondominant feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 21
320amnondominant feces, homo sapiens, adult, crohn's disease2018-04-19v4No1 / 21
330amnondominant feces, homo sapiens, adult, kingdom of norway, oslo, fourth decade human stage2018-05-13v4No1 / 21
390amnondominant feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 21
398amnonhigh freq. in feces of healthy adults from belgium (dominant feces, homo sapiens, control, adult, belgium)2018-11-15v4No1 / 21
591amnondominant feces, homo sapiens, united states of america, adult, parkinson's disease, human late adulthood stage2020-02-17v4No1 / 21
607amnondominant feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 21
671amnondominant feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, 3-month-old human stage2020-09-27v4No1 / 21
794amnondominant feces, homo sapiens, hiv infection, adult, kingdom of spain, human immunodeficiency virus infectious disease, municipality of logrono, antiretroviral therapy2021-06-08v4No1 / 21
185amnonhigh freq. in patients with c. diff infection before treatment (dominant feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 22
284amnondominant feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 22
293amnondominant feces, homo sapiens, united states of america, adult, american diet2018-02-07v4No1 / 22
297amnondominant feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v4No1 / 22
395amnondominant feces, homo sapiens, united states of america, child, commonwealth of pennsylvania, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 22
467amnondominant feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 22
611amnon high in control compared to ovariectomy ovariectomized female in female research facility caecum mus musculus mouse cecal content canada age 9 months 2020-04-21v4No1 / 22
629amnondominant feces, homo sapiens, female, adult, kingdom of the netherlands, amsterdam2020-05-31v4No1 / 22
650amnondominant feces, homo sapiens, united states of america, adult, african american, state of new york2020-09-09v4No1 / 22
736amnon high in child age 1-3 years 2-year-old human stage 1-year-old human stage compared to female adult in feces homo sapiens tanzania pemba island 2021-01-25v3No1 / 22
552amnondominant feces, homo sapiens, czech republic2019-09-05v3No1 / 22
655amnondominant in patients before hematopoietic stem cell transplant (dominant feces, homo sapiens, italy, before hsct)2020-09-13v3No1 / 22
655amnondominant in patients after hematopoietic stem cell transplant (dominant feces, homo sapiens, italy, after hcst, hematopoietic stem cell transplant)2020-09-13v3No1 / 22
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 22
797amnon high in 1-month-old human stage compared to 3-month-old human stage in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 22
797amnondominant feces, homo sapiens, child, germany, formula fed, 2-year-old human stage2021-06-13v3No1 / 22
10amnondominant feces, homo sapiens, toronto2016-10-27v4No1 / 23
53amnondominant feces, homo sapiens, city, el salvador, small village2017-01-21v4No1 / 23
73amnondominant feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 23
132amnondominant feces, homo sapiens, united states of america2017-04-16v4No1 / 23
197amnondominant feces, homo sapiens, juvenile organism, obsolete_juvenile stage, india, 13-year-old human stage2017-09-12v4No1 / 23
241amnonhigh freq. in babies age < 3 years in russia (dominant feces, homo sapiens, infant, russia, age < 3 years)2017-11-13v4No1 / 23
241amnoncommon in babies age < 3 years in finland (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-13v4No1 / 23
241amnonhigh freq. in babies age < 3 years in estonia (dominant feces, homo sapiens, infant, estonia, age < 3 years)2017-11-13v4No1 / 23
284amnondominant feces, homo sapiens, female, infant, state of california, 12-month-old human stage2018-01-27v4No1 / 23
303amnondominant feces, homo sapiens, adult, germany2018-03-12v4No1 / 23
394amnondominant feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v4No1 / 23
487amnondominant feces, homo sapiens, united states of america, metabolic syndrome x, metabolic syndrome2019-02-24v4No1 / 23
669amnondominant feces, homo sapiens, infant, sweden, 12-month-old human stage2020-09-26v4No1 / 23
830amnondominant feces, homo sapiens, peru, age 9-17 years, teenager2021-09-10v4No1 / 23
832amnondominant feces, homo sapiens, adult, nigeria, ibadan2021-09-11v4No1 / 23
797amnoncommon feces, homo sapiens, infant, germany, formula fed, 12-month-old human stage2021-06-13v3No1 / 23
797amnoncommon feces, homo sapiens, infant, germany, formula fed, age 7 months2021-06-13v3No1 / 23
843amnondominant feces, adult, italy, human adult stage, non-celiac gluten sensitivity2021-11-17v3No1 / 23
239amnondominant feces, homo sapiens, united states of america2017-11-08v4No1 / 24
241amnoncommon in babies age < 3 years in estonia (common feces, homo sapiens, infant, estonia, age < 3 years)2017-11-13v4No1 / 24
330amnondominant feces, homo sapiens, infant, kingdom of norway, oslo, age 1 year2018-05-13v4No1 / 24
365amnondominant feces, homo sapiens, child, sudan, obsolete_juvenile stage2018-08-30v4No1 / 24
395amnondominant feces, homo sapiens, control, united states of america, commonwealth of pennsylvania2018-11-14v4No1 / 24
580amnondominant feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 24
643amnondominant feces, homo sapiens, adult, south korea2020-08-30v4No1 / 24
683amnondominant feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 24
702amnondominant feces, united states of america, felis catus, state of north carolina, cat2028-04-02v4No1 / 24
713amnoncommon feces, homo sapiens, crohn's disease, active disease2028-05-21v3No1 / 24
723amnondominant feces, homo sapiens, child, indonesia, municipality of yogyakarta, 2-5 year-old child stage2021-01-02v3No1 / 24
35amnoncommon homo sapiens, hospital, dense settlement biome, breast milk, tanzania2016-12-06v4No1 / 25
53amnondominant feces, homo sapiens, city, lima, shantytown2017-01-21v4No1 / 25
284amnoncommon feces, homo sapiens, female, infant, state of california, 6-month-old human stage2018-01-27v4No1 / 25
395amnoncommon feces, homo sapiens, united states of america, child, commonwealth of pennsylvania, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 25
436amnondominant feces, united states of america, felis catus, state of colorado, cat2018-12-25v4No1 / 25
580amnondominant feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 25
683amnoncommon during antibiotics treatment in feces (common feces, homo sapiens, united states of america, antibiotic, vancomycin, adult, state of california, metronidazole, neomycin)2028-03-04v4No1 / 25
721amnondominant feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 25
721amnon high in high fiber fiber diet compared to weight loss weight loss diet high protein diet in feces homo sapiens obesity adult scotland overweight body mass index status gaz:00052100 2028-05-23v4No1 / 25
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 25
797amnondominant feces, homo sapiens, infant, germany, formula fed, 12-month-old human stage2021-06-13v3No1 / 25
62amnondominant feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 26
438amnondominant feces, homo sapiens, adult, jiangsu province, china, fourth decade human stage, fifth decade human stage2018-12-30v4No1 / 26
802amnondominant feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 26
723amnondominant feces, homo sapiens, infant, child, indonesia, municipality of yogyakarta, age 0-6 months2021-01-02v3No1 / 26
438amnondominant feces, homo sapiens, child, jiangsu province, age 8-12, china, 6-12 year-old child stage2018-12-30v4No1 / 27
659amnoncommon feces, homo sapiens, ulcerative colitis, child, acute severe colitis2020-09-19v4No1 / 27
695amnondominant feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v4No1 / 27
797amnon high in 3-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 27
319amnondominant feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 28
365amnondominant feces, homo sapiens, child, jordan, obsolete_juvenile stage2018-08-30v4No1 / 28
562amnondominant feces, child, ecuador, age 5-13 years, quito2019-11-05v4No1 / 28
620amnondominant feces, wild, chimpanzee, pan troglodytes troglodytes, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 28
438amnondominant feces, homo sapiens, jiangsu province, age 13-14, china, 13-year-old human stage, 14-year-old human stage2018-12-30v4No1 / 29
797amnon high in 3-month-old human stage compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 29
724amnon high in non-pregnant compared to pregnancy pregnancy trimester 2 in homo sapiens female vagina adult egypt ismailia age 25-45 years 2021-01-03v3No1 / 29
36amnonhigher in centernarians ( high in centererians compared to adult in feces homo sapiens sichuan province )2016-12-06v4No1 / 30
284amnoncommon feces, homo sapiens, female, infant, state of california, 12-month-old human stage2018-01-27v4No1 / 30
320amnoncommon feces, homo sapiens, adult, crohn's disease2018-04-19v4No1 / 30
438amnondominant feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v4No1 / 30
695amnondominant feces, homo sapiens, child, israel, food allergy, age 4-10 years, sesame allergy2028-03-27v4No1 / 30
723amnoncommon feces, homo sapiens, child, indonesia, municipality of yogyakarta, 2-5 year-old child stage2021-01-02v3No1 / 30
45amnoncommon in feces babies age 0-2 in india (common feces, homo sapiens, infant, india)2016-12-19v4No1 / 31
401amnonhigher in endospore enriched (lysis resistant) replicates ( high in endospore enriched fraction lysis compared to control in feces homo sapiens united states of america adult )2018-11-18v4No1 / 31
655amnoncommon in patients before hematopoietic stem cell transplant (common feces, homo sapiens, italy, before hsct)2020-09-13v3No1 / 31
411amnonlower in wild baboons feeding on discarded human foods ( high in low human contact compared to human contact in feces zambia monkey wild papio kindae kinda baboon )2018-11-23v4No1 / 33
669amnon high in 14-days-old human compared to 12-month-old human stage in feces homo sapiens infant sweden 2020-09-26v4No1 / 33
12amnon high in control compared to chronic fatigue syndrome in feces homo sapiens new york county 2016-11-02v4No1 / 35
240amnonhigher in infants age<1 year compared to 1-3 years in baby feces ( high in age under-1-year-old human stage compared to 1-year-old human stage in feces homo sapiens infant finland )2017-11-12v4No1 / 35
669amnoncommon feces, homo sapiens, infant, sweden, 12-month-old human stage2020-09-26v4No1 / 35
51amnoncommon homo sapiens, united states of america, biopsy site, biopsy2017-01-19v4No1 / 36
212amnon high in obese body mass index status db/db mouse obesity compared to lean body mass in feces united states of america research facility mus musculus mouse 2017-10-22v4No1 / 36
240amnoncommon in infants age <3 years (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-12v4No1 / 36
651amnon high in parkinson's disease compared to control in feces homo sapiens united states of america adult state of alabama 2020-09-13v4No1 / 37
681amnoncommon feces, homo sapiens, adult, seoul, south korea2028-03-04v3No1 / 37
390amnoncommon feces, homo sapiens, hospital, australia, diarrhea2018-11-04v4No1 / 38
74amnonHigher in plant diet compared to animal product diet ( high in diet plant diet compared to animal product diet in feces homo sapiens united states of america )2017-02-27v4No1 / 39
131amnonnegatively correlated with age (30-80 years) ( high in age fourth decade human stage fifth decade human stage compared to human late adulthood stage in feces homo sapiens south korea )2017-04-16v4No1 / 39
330amnoncommon feces, homo sapiens, infant, kingdom of norway, oslo, age 1 year2018-05-13v4No1 / 39
526amnoncommon in bile of healthy controls (common homo sapiens, control, bile, gallbladder, adult, kingdom of spain)2019-07-14v3No1 / 39
19amnoncommon in biopsies of children (IBD study) (common homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children)2016-11-14v4No1 / 40
714amnoncommon homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 40
825amnoncommon feces, homo sapiens, control, child, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 40
835amnoncommon feces, homo sapiens, adult, japan2021-09-11v3No1 / 40
352amnoncommon feces, homo sapiens, new delhi, india2018-07-30v4No1 / 41
825amnoncommon feces, homo sapiens, type i diabetes mellitus, child, type 1 diabetes mellitus, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 41
564amnoncommon feces, homo sapiens, autistic disorder, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 42
831amnoncommon feces, homo sapiens, adult, israel, pancreatic cancer2021-09-11v3No1 / 43
69amnoncommon united states of america, research facility, bronchoalveolar lavage, canis lupus familiaris, beagle dog2017-02-21v4No1 / 44
241amnoncommon in babies age < 3 years in russia (common feces, homo sapiens, infant, russia, age < 3 years)2017-11-13v4No1 / 44
365amnoncommon feces, homo sapiens, child, sudan, obsolete_juvenile stage2018-08-30v4No1 / 44
611amnonhigher in feces of mice exposed to cigarette smoke for 6 months compared to controls ( high in nicotine dependence compared to control in research facility caecum mus musculus mouse cecal content canada age 9 months )2020-04-21v4No1 / 45
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, 1-year-old human stage2018-01-14v4No1 / 46
597amnoncommon feces, homo sapiens, control, adult, zhejiang province, china2020-03-23v3No1 / 46
797amnoncommon feces, homo sapiens, child, germany, formula fed, 2-year-old human stage2021-06-13v3No1 / 46
482amnoncommon feces, homo sapiens, child, colombia, medellin metropolitan area, daycare, 1-5-years-old human2019-02-12v4No1 / 47
591amnoncommon feces, homo sapiens, united states of america, adult, parkinson's disease, human late adulthood stage2020-02-17v4No1 / 47
830amnoncommon feces, homo sapiens, peru, age 9-17 years, teenager2021-09-10v4No1 / 47
597amnoncommon feces, homo sapiens, adult, zhejiang province, gout, china2020-03-23v3No1 / 47
666amnoncommon feces, italy, delphinus delphis, rectal swab, short beaked common dolphin2020-09-25v3No1 / 48
720amnoncommon feces, homo sapiens, adult, autoimmune hepatitis, china, zhengzhou city prefecture2028-05-23v3No1 / 48
651amnoncommon feces, homo sapiens, united states of america, adult, state of alabama, parkinson's disease2020-09-13v4No1 / 49
121amnoncommon feces, homo sapiens, adult, bangladesh2017-04-13v4No1 / 50
339amnon high in infant under-1-year-old human stage compared to adult in feces homo sapiens india 2018-05-24v4No1 / 50
564amnoncommon feces, homo sapiens, control, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 50
797amnoncommon feces, homo sapiens, child, germany, breast fed, 2-year-old human stage2021-06-13v3No1 / 50
796amnoncommon feces, homo sapiens, control, adult, taiwan, republic of china, taoyuan city2021-06-10v3No1 / 51
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in antibiotic ampicillin compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v4No1 / 52
650amnoncommon feces, homo sapiens, united states of america, adult, african american, state of new york2020-09-09v4No1 / 52
797amnon high in infant 12-month-old human stage compared to child 2-year-old human stage in feces homo sapiens germany formula fed 2021-06-13v3No1 / 52
694amnoncommon feces, homo sapiens, female, obesity, adult, china, shanghai district2028-03-17v3No1 / 52
796amnoncommon feces, homo sapiens, adult, taiwan, graves' disease, republic of china, taoyuan city2021-06-10v3No1 / 52
292amnoncommon feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 53
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 53
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout gut content )2018-04-10v4No1 / 55
390amnoncommon feces, homo sapiens, hospital, salmonella gastroenteritis, australia, diarrhea2018-11-04v4No1 / 55
814amnoncommon feces, homo sapiens, female, obesity, adult, obese body mass index status, germany, high bmi, overweight body mass index status, age 50-70 years2021-06-30v4No1 / 55
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 55
45amnonhigher in younf babies compared to 2 year olds in india ( high in age under-1-year-old human stage compared to 1-year-old human stage in feces homo sapiens infant india )2016-12-19v4No1 / 56
394amnoncommon feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 56
591amnoncommon feces, homo sapiens, control, united states of america, adult, human late adulthood stage2020-02-17v4No1 / 56
650amnoncommon feces, homo sapiens, united states of america, adult, caucasian, state of new york, european2020-09-09v4No1 / 56
720amnoncommon feces, homo sapiens, control, adult, china, zhengzhou city prefecture2028-05-23v3No1 / 56
26amnon high in mucus pair of nares compared to saliva mouth in united states of america canis lupus familiaris 2016-12-05v4No1 / 57
563amnon high in control compared to hiv infection in feces homo sapiens united states of america male homosexual msm rectal swab 2019-11-18v4No1 / 58
651amnoncommon feces, homo sapiens, control, united states of america, adult, state of alabama2020-09-13v4No1 / 58
666amnoncommon feces, homo sapiens, italy2020-09-25v3No1 / 58
63amnonhigher in individuals with low physical activity ( high in little physical activity compared to physical activity in feces homo sapiens united states of america )2017-12-04v4No1 / 59
843amnoncommon feces, adult, italy, human adult stage, non-celiac gluten sensitivity2021-11-17v3No1 / 59
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, vegetarian diet2021-01-22v3No1 / 60
831amnoncommon feces, homo sapiens, control, adult, israel2021-09-11v3No1 / 60
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in diet american diet compared to cron diet caloric restriction diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 61
627amnoncommon feces, female, pregnancy, adult, china2020-05-16v3No1 / 61
637amnoncommon feces, homo sapiens, female, pregnancy, adult, china, chengdu city prefecture, gestational age 8-12 weeks2020-08-18v3No1 / 61
593amnoncommon feces, homo sapiens, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 62
380amnoncommon feces, homo sapiens, adult, tibetan plateau, tibet autonomous region2018-10-03v4No1 / 63
502amnoncommon feces, homo sapiens, united states of america, adult, schizophrenia2019-03-12v4No1 / 63
575amnoncommon in professional martial arts athletes (common feces, homo sapiens, adult, high physical activity, china, athlete, young adult stage)2020-01-05v3No1 / 63
242amnoncommon in native-americans (common feces, homo sapiens, united states of america, state of oklahoma, cheyenne, native american, arapaho)2017-11-14v4No1 / 65
365amnoncommon feces, homo sapiens, child, nigeria, obsolete_juvenile stage2018-08-30v4No1 / 66
650amnoncommon feces, homo sapiens, united states of america, adult, state of new york, asian2020-09-09v4No1 / 66
734amnoncommon feces, homo sapiens, adult, taiwan, coronary heart disease, republic of china2021-01-22v3No1 / 66
365amnoncommon feces, homo sapiens, child, jordan, obsolete_juvenile stage2018-08-30v4No1 / 67
574amnoncommon feces, homo sapiens, adult, russia2020-01-05v3No1 / 68
593amnoncommon feces, homo sapiens, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, omnivore diet2021-01-22v3No1 / 68
723amnoncommon feces, homo sapiens, female, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 69
803amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of massachusetts, type 2 diabetes mellitus, caribbean latino, human late adulthood stage2021-06-18v4No1 / 70
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
644amnoncommon feces, homo sapiens, united states of america, adult, hispanic or latin american2020-08-31v4No1 / 71
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, switzerland2020-09-22v4No1 / 71
656amnoncommon feces, homo sapiens, sri lanka, age 1-18 years, child stage, adolescent stage2020-09-13v3No1 / 71
663amnon high in poland compared to switzerland in feces homo sapiens adult 2020-09-22v4No1 / 72
425amnoncommon feces, homo sapiens, child, africa, madagascar, antananarivo2018-12-08v4No1 / 73
832amnoncommon feces, homo sapiens, adult, nigeria, ibadan2021-09-11v4No1 / 74
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 74
395amnoncommon feces, homo sapiens, control, united states of america, commonwealth of pennsylvania2018-11-14v4No1 / 75
794amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, human immunodeficiency virus infectious disease, municipality of logrono, antiretroviral therapy2021-06-08v4No1 / 75
74amnoncommon feces, homo sapiens, united states of america2017-02-27v4No1 / 76
484amnoncommon feces, homo sapiens, united states of america, adult, state of michigan, 17-29-years-old human2019-02-13v4No1 / 76
666amnoncommon feces, tursiops truncatus, italy, rectal swab, common bottlenose dolphin2020-09-25v3No1 / 76
516amnoncommon feces, homo sapiens, united states of america, adult, state of ohio2019-05-29v4No1 / 77
644amnonlower in individuals born in latin america compared to indivuals born in usa ( high in usa born compared to non usa born in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 77
799amnoncommon in obese participant fecal samples before ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi)2021-06-13v3No1 / 77
630amnoncommon feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 78
401amnoncommon feces, homo sapiens, united states of america, adult2018-11-18v4No1 / 79
404amnoncommon feces, homo sapiens, city, adult, colombia2018-11-20v4No1 / 79
671amnon high in age 6 months 3-month-old human stage compared to age 8 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 79
529amnoncommon feces, homo sapiens, control, adult, taipei city, taiwan2019-07-18v3No1 / 79
732amnoncommon feces, homo sapiens, adult, kingdom of spain, municipality of reus2021-01-11v3No1 / 79
695amnoncommon feces, homo sapiens, child, israel, food allergy, age 4-10 years, sesame allergy2028-03-27v4No1 / 80
339amnoncommon feces, homo sapiens, adult, india2018-05-24v4No1 / 81
643amnoncommon feces, homo sapiens, adult, south korea2020-08-30v4No1 / 81
671amnoncommon feces, united states of america, research facility, macaca mulatta, age 1 month, monkey, captive, rhesus macaque2020-09-27v4No1 / 81
344amnoncommon in feces of heterosexuals (common feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of virginia2018-09-03v4No1 / 82
562amnoncommon feces, child, ecuador, age 5-13 years, quito2019-11-05v4No1 / 82
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 82
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in feces homo sapiens adult nanning city prefecture china sixth decade human stage )2018-01-27v4No1 / 83
502amnoncommon feces, homo sapiens, control, united states of america, adult2019-03-12v4No1 / 83
777amnon high in 18-month-old human stage compared to 3-year-old human stage in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 83
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v4No1 / 84
663amnoncommon homo sapiens, lung, bronchoalveolar lavage, adult, poland2020-09-22v4No1 / 84
247amnoncommon feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 85
663amnoncommon feces, homo sapiens, adult, switzerland, low bmi2020-09-22v4No1 / 85
680amnoncommon feces, homo sapiens, obesity, adult, russia, novosibirsk2028-03-04v3No1 / 85
26amnon high in mucus pair of nares compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
249amnoncommon feces, homo sapiens, united states of america2017-11-22v4No1 / 86
394amnoncommon feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v4No1 / 86
841amnoncommon feces, homo sapiens, united states of america, adult, state of texas, human adult stage2021-11-08v4No1 / 86
344amnoncommon in feces of homosexual males (common feces, homo sapiens, united states of america, state of colorado, denver, gay, homosexual, msm)2018-05-31v4No1 / 87
430amnoncommon feces, homo sapiens, united states of america, city, adult, state of arizona, 20-year-old human stage2018-12-15v4No1 / 87
487amnoncommon feces, homo sapiens, united states of america, metabolic syndrome x, metabolic syndrome2019-02-24v4No1 / 88
660amnonhigher in the cross cutcu population (more modern) comparen to upano valley (less modern) ( high in cross-cutucu compared to upano valley in feces homo sapiens ecuador rural community village shuar population )2020-09-20v4No1 / 88
293amnoncommon feces, homo sapiens, united states of america, adult, american diet2018-02-07v4No1 / 89
629amnoncommon feces, homo sapiens, female, adult, kingdom of the netherlands, amsterdam2020-05-31v4No1 / 89
803amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of massachusetts, caribbean latino, human late adulthood stage2021-06-18v4No1 / 89
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 92
303amnoncommon feces, homo sapiens, adult, germany2018-03-12v4No1 / 93
428amnoncommon feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v4No1 / 93
601amnoncommon feces, homo sapiens, control, adult, china2020-03-30v4No1 / 93
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 93
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, gay, homosexual, msm2018-11-06v4No1 / 94
695amnoncommon feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v4No1 / 94
400amnoncommon in feces of european american females (common feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 95
238amnoncommon feces, homo sapiens, colombia2017-11-07v4No1 / 96
365amnoncommon feces, homo sapiens, child, azerbaijan, obsolete_juvenile stage2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, right colon, biopsy site, adult, biopsy2018-11-22v4No1 / 97
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, heterosexual, msw2020-05-31v4No1 / 97
663amnoncommon feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 98
438amnoncommon feces, homo sapiens, china, young adult stage2018-12-30v4No1 / 101
477amnoncommon feces, homo sapiens, united states of america, adult2019-01-28v4No1 / 103
563amnoncommon feces, homo sapiens, control, united states of america, homosexual, msm, male, rectal swab2019-11-18v4No1 / 103
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 103
284amnoncommon feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 105
683amnoncommon feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 105
438amnoncommon feces, homo sapiens, child, jiangsu province, age 8-12, china, 6-12 year-old child stage2018-12-30v4No1 / 106
215amnoncommon feces, homo sapiens, united states of america2017-10-23v4No1 / 107
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 107
273amnon high in age 1-month-old human stage compared to age one week 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 107
393amnon high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america city adult state of colorado 2018-11-06v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common feces, homo sapiens, control, adult, belgium)2018-11-15v4No1 / 107
695amnon high in milk allergy compared to sesame allergy in feces homo sapiens child israel food allergy age 4-10 years 2028-03-27v4No1 / 107
409amnoncommon feces, homo sapiens, united states of america, adult2018-11-22v4No1 / 108
436amnoncommon feces, united states of america, felis catus, state of colorado, cat2018-12-25v4No1 / 108
802amnoncommon feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 108
289amnoncommon feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 109
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v4No1 / 109
53amnoncommon feces, homo sapiens, city, lima, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in feces homo sapiens united states of america child )2018-11-22v4No1 / 110
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, 65-79 year-old human stage2018-12-30v4No1 / 111
563amnoncommon feces, homo sapiens, united states of america, hiv infection, homosexual, msm, male, rectal swab2019-11-18v4No1 / 111
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 112
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, poland2020-09-22v4No1 / 112
517amnoncommon feces, homo sapiens, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 113
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, fourth decade human stage, fifth decade human stage2018-12-30v4No1 / 115
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age 3-month-old human stage compared to age 1 week 1-month-old human stage in homo sapiens hypopharynx infant kingdom of denmark )2017-01-19v4No1 / 116
195amnoncommon in boston subway surfaces (common city, urban biome, boston, train)2017-09-07v4No1 / 116
239amnoncommon feces, homo sapiens, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v4No1 / 118
294amnoncommon feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
777amnon high in 5-year-old human stage compared to 3-year-old human stage in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, small intestine, duodenum, new delhi, india)2018-07-30v4No1 / 121
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china, ninth decade human stage, tenth decade human stage2018-12-30v4No1 / 121
517amnoncommon homo sapiens, arm, skin, forearm, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 121
660amnoncommon feces, homo sapiens, ecuador, rural community, village, shuar population2020-09-20v4No1 / 123
449amnoncommon feces, homo sapiens, colombia2019-01-09v4No1 / 124
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in feces homo sapiens toronto )2016-10-27v4No1 / 125
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to child obsolete_juvenile stage crohn's disease in feces homo sapiens glasgow )2017-02-26v4No1 / 125
392amnon high in pre pupae insect diet compared to larvae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 125
607amnoncommon feces, homo sapiens, germany, parkinson's disease2020-04-19v4No1 / 125
67amnoncommon in dry processing of coffee beans (common coffea arabica, ecuador, dry processing)2017-02-19v4No1 / 126
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, pre-pupae insect diet2018-11-05v4No1 / 126
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to rectum biopsy site biopsy in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 126
131amnoncommon feces, homo sapiens, south korea2017-04-16v4No1 / 128
607amnoncommon feces, homo sapiens, control, germany2020-04-19v4No1 / 128
330amnoncommon feces, homo sapiens, adult, kingdom of norway, oslo, fourth decade human stage2018-05-13v4No1 / 130
721amnoncommon feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 131
39amnoncommon in obese lepr-db mice (common feces, research facility, mus musculus, obesity)2016-12-09v4No1 / 132
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
625amnoncommon feces, united states of america, zoological garden, state of minnesota, saguinus imperator, como zoo, emperor tamarin2020-05-16v4No1 / 132
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 132
711amnon high in adult compared to child age 8-12 years in homo sapiens united states of america oral cavity state of colorado mouth 2028-05-21v4No1 / 133
794amnoncommon feces, homo sapiens, control, adult, kingdom of spain, municipality of logrono2021-06-08v4No1 / 133
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
392amnon high in pre pupae insect diet compared to defatted larvae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 134
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china, 13-year-old human stage, 14-year-old human stage2018-12-30v4No1 / 134
607amnoncommon feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 134
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, 13-year-old human stage2017-09-12v4No1 / 136
212amnoncommon feces, united states of america, research facility, mus musculus, obese body mass index status, mouse, db/db mouse, obesity2017-10-22v4No1 / 137
294amnoncommon in non-IBS healthy controls (common feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 137
10amnoncommon feces, homo sapiens, toronto2016-10-27v4No1 / 138
797amnon high in child 2-year-old human stage compared to infant 12-month-old human stage in feces homo sapiens germany formula fed 2021-06-13v3No1 / 139
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 140
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, homosexual, msm2020-05-31v4No1 / 141
212amnonhigher in obese mice fed quinoa diet compared to ain-93g rodent diet ( high in diet quinoa food product compared to ain-93g rodent diet in feces united states of america research facility mus musculus obese body mass index status mouse db/db mouse obesity )2017-10-22v4No1 / 143
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 146
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
411amnon high in wild papio kindae papio ursinus compared to zoological garden papio anubis in feces papio zambia monkey baboon 2018-11-23v4No1 / 151
392amnon high in pre pupae insect diet compared to fishmeal diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 153
780amnon high in small intestine duodenum jejunum compared to caecum in research facility gallus gallus chicken china jinzhou city prefecture 2021-04-28v3No1 / 153
594amnoncommon feces, homo sapiens, city, adult, cameroon, yaounde2020-03-12v4No1 / 154
53amnoncommon feces, homo sapiens, city, el salvador, small village2017-01-21v4No1 / 155
273amnon high in age 1-month-old human stage compared to 1-year-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, bile, gallbladder, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
122amnoncommon feces, homo sapiens, united kingdom2017-04-13v4No1 / 157
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, 3-month-old human stage2020-09-27v4No1 / 170
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 183
75amnoncommon homo sapiens, arm, skin, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 190
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces state of florida central america alouatta pigra howler monkey 2017-03-03v4No1 / 193
371amnoncommon homo sapiens, skin, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 195
620amnoncommon feces, gorilla gorilla, wild, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 196
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
411amnoncommon feces, zambia, monkey, wild, papio kindae, kinda baboon2018-11-23v4No1 / 200
6amnoncommon homo sapiens, urine, female, pregnancy, state of tennessee2016-10-13v4No1 / 201
438amnonlower in centenarians compared to adults ( high in 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to age >94 ninth decade human stage tenth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 203
120amnoncommon feces, homo sapiens, brazil2017-04-12v4No1 / 208
150amnoncommon feces, united states of america, canis lupus familiaris, dog2017-04-26v4No1 / 208
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens stomach adult zhejiang province china )2019-06-26v3No1 / 214
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
578amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens hiv infection adult kingdom of spain sweden male )2020-01-14v3No1 / 220
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
411amnoncommon feces, zambia, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 224
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
780amnoncommon research facility, small intestine, duodenum, jejunum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 232
53amnon high in lima shantytown compared to el salado small village in feces homo sapiens city 2017-01-21v4No1 / 236
404amnon high in bogota medellin metropolitan area compared to municipality of santiago de cali bucaramanga barranquilla in feces homo sapiens city adult colombia 2018-11-20v4No1 / 237
620amnoncommon feces, wild, chimpanzee, pan troglodytes troglodytes, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 238
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v4No1 / 239
161amnoncommon in barn swallows in colorado (common feces, united states of america, state of colorado, hirundo rustica, barn swallow)2017-07-12v4No1 / 245
398amnon high in control compared to crohn's disease in feces homo sapiens belgium 2018-11-15v4No1 / 248
425amnon high in madagascar antananarivo compared to central african republic bangui in feces homo sapiens child africa 2018-12-08v4No1 / 248
351amnoncommon united states of america, research facility, coelomic fluid, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 249
63amnon high in male compared to female in feces homo sapiens united states of america 2017-12-04v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, adult, peru, small village, tunapuco, rural community2018-01-22v4No1 / 263
160amnoncommon in river water upstream of WTP effluent in spring in china (common river, water, china, spring)2017-07-12v4No1 / 278
438amnon high in child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage compared to adult 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china 2018-12-30v4No1 / 279
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v4No1 / 281
428amnon high in control compared to acute pancreatitis pancreatitis in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 288
411amnoncommon feces, united states of america, zoological garden, papio anubis, monkey, olive baboon2018-11-23v4No1 / 292
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v4No1 / 295
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 306
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces state of florida central america alouatta palliata mantled howler monkey 2017-03-03v4No1 / 314
510amnoncommon estuary, water, fresh water, kingdom of spain, estuary water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
650amnon high in asian compared to caucasian european in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 317
311amnoncommon in floor of kimchi production facility (common united states of america, food processing factory, state of rhode island, floor)2018-04-09v4No1 / 324
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in myanmar karen compared to hmong china in feces homo sapiens thailand rural community )2018-11-18v4No1 / 329
351amnoncommon in artificial sea water where sea urchins were grown (common united states of america, research facility, sea water, state of florida, lytechinus variegatus, sea urchin, artificial seawater)2018-07-30v4No1 / 338
666amnoncommon feces, equus caballus, italy, horse2020-09-25v3No1 / 341
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
620amnon high in wild pan troglodytes troglodytes republic of congo nouabale-ndoki national park compared to united states of america zoological garden pan troglodytes in feces chimpanzee 2020-05-06v4No1 / 351
254amnonhigher in river when close to populated region compared to downstream ( high in populated place city upstream compared to downstream in river water fresh water fujian province depth (soil) 50cm jiulong river china )2017-11-23v4No1 / 356
620amnon high in wild republic of congo nouabale-ndoki national park compared to united states of america zoological garden in feces gorilla gorilla gorilla 2020-05-06v4No1 / 368
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
256amnoncommon duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
274amnoncommon feces, chlorocebus aethiops, ethiopia, monkey, grivet monkey2018-01-16v4No1 / 440
274amnoncommon feces, chlorocebus aethiops, ethiopia, monkey, vervet monkey2018-01-16v4No1 / 446
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
111amnon high in rectum caecum colon ileum compared to ruminant reticulum omasum rumen in ovis aries mongolian sheep china 2017-04-09v4No1 / 464
160amnoncommon in wastewater treatment plant effluent in autumn in china (common wastewater treatment plant, effluent, autumn, china)2017-07-12v4No1 / 469
620amnon high in chimpanzee pan troglodytes troglodytes compared to gorilla gorilla in feces wild republic of congo nouabale-ndoki national park 2020-05-06v4No1 / 478
274amnoncommon feces, ethiopia, monkey, chlorocebus djamdjamensis, bale monkey2018-01-16v4No1 / 489
329amnoncommon rumen, ovis aries, kingdom of norway, sheep2018-05-13v4No1 / 506
671amnon high in state of oregon compared to state of california in feces united states of america female research facility adult macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 534
160amnoncommon in wastewater treatment plant effluent in spring in china (common wastewater treatment plant, effluent, china, spring)2017-07-12v4No1 / 573
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in estuary water kingdom of spain estuary water bilbao 2019-03-20v4No1 / 592
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium officinale, flowerpot2021-06-20v4No1 / 715
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 752
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela amerindian hunter gatherer compared to united states of america city in homo sapiens skin )2018-09-06v4No1 / 854
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer in Nanjing China (common soil, compost biofilter, compost, pig manure, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa)2021-04-14v4No1 / 866
767sheryoCommon in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (common soil, china, nanjing county, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil fumigation, dazomet)2021-04-14v4No1 / 946
671amnon high in female adult compared to age 8 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 947
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium moniliforme, flowerpot2021-06-20v4No1 / 1002
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
252amnoncommon in river rock biofilm (common river, rock, biofilm, kingdom of spain, epilithic, biofilm)2017-11-22v4No1 / 1081
5amnoncommon periplaneta americana, digestive system, united states of america, wild type2016-10-13v4No1 / 1142
252amnoncommon in river sand biofilm (common river, biofilm, sand, kingdom of spain, biofilm)2017-11-22v4No1 / 1181
783sheryocommon in desert soil in mongolia without water addition treatment (common soil, mongolia, sandy desert, bajada, china, dengkou county, ph 7.85, ulan buh desert, cambic arenosols, luvic gypsisols, ambient precipitation, no water addition)2021-05-11v4No1 / 1324
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium huoshanense, flowerpot2021-06-20v4No1 / 1356
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162

Problems / suggestions? Please email info AT dbbact DOT org