Search result for sequence:
TACGTAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTCTGTCGCGTCGGCTGTGAAAACTCGGGGCTCAACTCCGAGCTTGCAGTCGATACGGGCAGGCTAGAGTTCGGCAGGGGAGACTGGAATTCCTGG
common ontology terms
term enrichment score
TermScore
soil0.357870
rhizosphere0.316114
citrus0.175299
depth (soil) 0-10cm0.148270
robinia pseudoacacia0.140351
shaanxi province0.140351
reforestation0.140351
loess plateau0.131148
china0.131096
mexico0.129964
yunwushan national natural grassland protection zone0.125000
ningxia province0.125000
calci-orthic aridisol0.125000
haplic calcisol0.125000
grazing exclusion0.125000
root0.115942
cultivated environment0.111111
silt loam0.109589
greenhouse0.109091
low sodicity0.109091
salic solonetz0.109091
da'an station0.109091
songnen plain0.109091
20 years0.109091
triticum aestivum0.100000
orchard0.098361
brazil0.098361
low salinity0.098361
myrtillocactus geometrizans0.092593
opuntia robusta0.092593
minas gerais state0.092593
campos rupestres0.092593
chrysanthemum morifolium ramat.0.092593
chrysanthemum0.092593
nanjing county0.092593
cactus0.088496
semi-arid0.088496
ph 6.90.088496
desert0.082192
state of florida0.078947
guanajuato0.075472
lu'an city prefecture0.075472
flowerpot0.075472
kellogg biological station0.075472
mesic type hapludalf0.075472
kalamazoo loam0.075472
ph 90.072727
zea mays0.067797
woodland area0.066667
depth (soil) 0-20cm0.066667
leaf0.063492
state of michigan0.057971
ph 6-6.50.057692
taxus0.057692
temperate0.057692
arachis hypogaea0.057692
peanut0.057692
agave0.057692
red soil0.057692
barbacenia macrantha0.057692
paenibacillus polymyxa0.057692
paenibacillus0.057692
compost biofilter0.057692
pig manure0.057692
soil fumigation0.057692
dazomet0.057692
ph 8.50.057692
depth 0cm0.057692
wheat0.056872
leaf surface0.056872
united states of america0.056639
northeast china0.056075
state of idaho0.056075
cambisol0.056075
bio-organic fertilizer0.056075
corn0.056075
depth (soil) 10-25cm0.056075
depth 10-20cm0.056075
ph 50.053097
hunan province0.050420
topsoil0.048000
forest ecosystem0.048000
tree0.046875
non-seleniferous0.039216
taxus media0.039216
taxus cuspidata0.039216
non-manured soil0.039216
ph 5.50.039216
agave salmiana0.039216
mature barley plants0.039216
days 1800.039216
quzhou county0.039216
compost soil0.039216
depth (soil) 80cm0.039216
LOWER IN high sodicity0.039216
dendrobium officinale0.039216
continuous corn0.039216
restored prairie0.039216
0-9 years of grazing exclusion0.039216
27-35 years of grazing exclusion0.039216
Fraction of dbbact annotations with this term covered by the query
TermScore
non-seleniferous0.500000
LOWER IN seleniferous0.500000
vero beach, fl0.500000
quincy, fl0.500000
immokalee, fl0.500000
ft. pierce, fl0.500000
gainesville, fl0.500000
central park0.500000
ph<5.50.500000
LOWER IN ph&gt;5.50.500000
merlot0.500000
grapevine0.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
ph 6-6.50.500000
root zone soil0.500000
taxus0.500000
taxus media0.500000
taxus cuspidata0.500000
temperate0.500000
LOWER IN taxus mairei0.500000
LOWER IN southeast china0.500000
arachis hypogaea0.500000
peanut0.500000
non-manured soil0.500000
ph 5.50.500000
north china plain0.500000
ph>5, ph<60.500000
moist tropical forest0.500000
ph>4.50.500000
LOWER IN ph&lt;4.50.500000
mediterranean forest biome0.500000
savanna0.500000
agave0.500000
agave deserti0.500000
agave salmiana0.500000
guanajuato0.500000
red soil0.500000
LOWER IN mediterranean0.500000
LOWER IN mature soil0.500000
southern united states0.500000
terrestrial snake0.500000
LOWER IN aquatic snake0.500000
minas gerais state0.500000
campos rupestres0.500000
vellozia epidendroides0.500000
barbacenia macrantha0.500000
urocyon littoralis0.500000
santa catalina island fox0.500000
urocyon littoralis catalinae0.500000
LOWER IN perianal skin0.500000
campinas0.500000
greenhouse0.500000
mature barley plants0.500000
days 1800.500000
quzhou county0.500000
LOWER IN unamended with biochar0.500000
fusarium0.500000
fusarium oxysporum f. sp. chrysanthemi0.500000
chrysanthemum morifolium ramat.0.500000
chrysanthemum0.500000
nanjing county0.500000
paenibacillus polymyxa0.500000
paenibacillus0.500000
compost0.500000
compost biofilter0.500000
pig manure0.500000
soil fumigation0.500000
dazomet0.500000
compost soil0.500000
deep plough0.500000
ph 8.50.500000
depth 0cm0.500000
low sodicity0.500000
salic solonetz0.500000
da'an station0.500000
songnen plain0.500000
depth (soil) 80cm0.500000
LOWER IN depth (soil) 80cm0.500000
LOWER IN ph 10.50.500000
LOWER IN high sodicity0.500000
LOWER IN ph 100.500000
lu'an city prefecture0.500000
flowerpot0.500000
dendrobium officinale0.500000
dendrobium moniliforme0.500000
dendrobium huoshanense0.500000
kellogg biological station0.500000
mesic type hapludalf0.500000
kalamazoo loam0.500000
continuous corn0.500000
restored prairie0.500000
miscanthus0.500000
panicum virgatum0.500000
0-9 years of grazing exclusion0.500000
yunwushan national natural grassland protection zone0.500000
ningxia province0.500000
calci-orthic aridisol0.500000
haplic calcisol0.500000
grazing exclusion0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.724490
china0.489796
rhizosphere0.336735
united states of america0.153061
citrus0.112245
mexico0.091837
depth (soil) 0-10cm0.091837
root0.081633
robinia pseudoacacia0.081633
loess plateau0.081633
shaanxi province0.081633
reforestation0.081633
silt loam0.081633
cultivated environment0.071429
brazil0.071429
yunwushan national natural grassland protection zone0.071429
ningxia province0.071429
calci-orthic aridisol0.071429
haplic calcisol0.071429
grazing exclusion0.071429
state of florida0.061224
triticum aestivum0.061224
depth (soil) 0-20cm0.061224
desert0.061224
orchard0.061224
greenhouse0.061224
low salinity0.061224
low sodicity0.061224
salic solonetz0.061224
da'an station0.061224
songnen plain0.061224
20 years0.061224
myrtillocactus geometrizans0.051020
opuntia robusta0.051020
cactus0.051020
semi-arid0.051020
minas gerais state0.051020
campos rupestres0.051020
ph 6.90.051020
chrysanthemum morifolium ramat.0.051020
chrysanthemum0.051020
nanjing county0.051020
research facility0.051020
woodland area0.040816
leaf0.040816
guanajuato0.040816
zea mays0.040816
ph 90.040816
lu'an city prefecture0.040816
flowerpot0.040816
state of michigan0.040816
kellogg biological station0.040816
mesic type hapludalf0.040816
kalamazoo loam0.040816
ph 6-6.50.030612
tree0.030612
taxus0.030612
northeast china0.030612
temperate0.030612
wheat0.030612
ph 50.030612
arachis hypogaea0.030612
peanut0.030612
state of idaho0.030612
topsoil0.030612
forest ecosystem0.030612
agave0.030612
leaf surface0.030612
hunan province0.030612
red soil0.030612
cambisol0.030612
barbacenia macrantha0.030612
paenibacillus polymyxa0.030612
paenibacillus0.030612
compost biofilter0.030612
pig manure0.030612
bio-organic fertilizer0.030612
soil fumigation0.030612
dazomet0.030612
ph 8.50.030612
depth 0cm0.030612
corn0.030612
depth (soil) 10-25cm0.030612
depth 10-20cm0.030612
non-seleniferous0.020408
LOWER IN root0.020408
LOWER IN rhizosphere0.020408
taxus media0.020408
taxus cuspidata0.020408
fertilized soil0.020408
non-manured soil0.020408
LOWER IN manured soil0.020408
ph 5.50.020408
glycine max0.020408
agricultural feature0.020408
state of california0.020408
agave salmiana0.020408
ph<50.020408
mature barley plants0.020408
days 1800.020408
Exp. ID User ID Description Date Region Flag Sequences
809amnondominant lu'an city prefecture, flowerpot, research facility, greenhouse, dendrobium officinale, rhizosphere, china2021-06-20v4No1 / 3
426amnon high in sand compared to mature soil in soil tundra permafrost russia nenets autonomous okrug 2018-12-08v4No1 / 125
129amnon high in soil compared to rhizosphere in ph 6-6.5 mexico myrtillocactus geometrizans opuntia robusta cactus semi-arid 2017-04-15v4No1 / 221
628sheryoHigher in rhizosphere of barley roots after 180 days in treatments amended with biochar ( high in biochar compared to unamended with biochar in china zhejiang province quzhou county soil depth (soil) 15cm ph 4-5 hordeum vulgare rhizosphere days 180 mature barley plants )2020-05-18v4No1 / 243
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, rhizosphere, semi-arid2017-04-15v4No1 / 338
582amnon high in ear canal external acoustic meatus compared to perianal skin rectum in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 374
259amnonlower in manured soil compared to non-manured ( high in non-manured soil compared to manured soil in soil rhizosphere ph 5 arachis hypogaea peanut fertilized soil china )2017-12-02v4No1 / 397
360amnoncommon desert, soil, mexico, guanajuato2018-08-21v4No1 / 437
412amnonlower in pig manured soil with wheat-maize rotation compared to non-manured soil ( high in non-manured soil compared to manured soil in soil hunan province red soil cambisol zea mays triticum aestivum china )2018-11-26v4No1 / 437
415amnonhigher in citrus from humid subtropical compared to mediterranean and semi-arid climate ( high in subtropical compared to mediterranean semi-arid in rhizosphere soil citrus orchard cultivated environment )2018-11-27v4No1 / 458
259amnonlower in fertilized soil (npk) compared to non-fertilized ( high in non-fertilized soil compared to fertilized soil in soil rhizosphere ph 5 arachis hypogaea peanut china )2017-12-02v4No1 / 483
360amnoncommon desert, soil, rhizosphere, agave, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 484
662amnoncommon loam soil, loam, irrigated, neve yaar, depth (soil) 0-10cm, soil, agricultural field, israel2020-09-21v3No1 / 489
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 492
415amnoncommon rhizosphere, soil, citrus, orchard, united states of america, cultivated environment2018-11-27v4No1 / 494
360amnoncommon desert, soil, mexico, guanajuato, cultivated environment2018-08-21v4No1 / 500
98amnoncommon citrus, rhizosphere, immokalee, fl, root, state of florida2017-04-01v4No1 / 543
98amnoncommon citrus, rhizosphere, vero beach, fl, root, state of florida2017-04-01v4No1 / 544
548amnoncommon in leaf surface of barbacenia macrantha (common minas gerais state, campos rupestres, brazil, barbacenia macrantha, leaf, leaf surface)2019-08-17v4No1 / 550
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf2017-04-15v4No1 / 562
357amnoncommon soil, topsoil, depth (soil) 0-10cm, mediterranean forest biome, forest ecosystem, woodland area2018-08-19v4No1 / 564
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
893amnon high in sandy loam compared to silty clay loam in raphanus sativus greenhouse radish commonwealth of virginia rhizosphere fertilized soil research facility united states of america 2022-04-11v4No1 / 582
536amnon high in terrestrial snake compared to aquatic snake in snake skin united states of america southern united states 2019-07-28v4No1 / 590
415amnoncommon rhizosphere, soil, citrus, orchard, south africa, cultivated environment2018-11-27v4No1 / 600
696amnon high in opisthostoma concinnum plectostoma concinnum compared to georissa georissa similis in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 606
357amnoncommon soil, topsoil, depth (soil) 0-10cm, savanna, forest ecosystem, woodland area2018-08-19v4No1 / 614
360amnoncommon desert, soil, state of california2018-08-21v4No1 / 637
360amnoncommon agave, desert, state of california, agave deserti, leaf, leaf surface2018-08-21v4No1 / 649
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
412amnon high in ph<5 compared to ph>5 in soil hunan province red soil cambisol zea mays triticum aestivum china 2018-11-26v4No1 / 706
809amnoncommon lu'an city prefecture, flowerpot, research facility, greenhouse, dendrobium officinale, rhizosphere, china2021-06-20v4No1 / 715
134amnon high in taxus media taxus cuspidata northeast china temperate compared to taxus mairei southeast china subtropical in rhizosphere tree taxus china 2017-04-16v4No1 / 734
415amnoncommon rhizosphere, soil, citrus, australia, orchard, cultivated environment2018-11-27v4No1 / 743
791sheryoHigher at 0cm depth compared to 80cm depth in low saline low sodicity soil in China ( high in depth (soil) 0-20cm depth 0cm compared to depth (soil) 80cm in ph 9 low salinity low sodicity soil salic solonetz da'an station china songnen plain )2021-06-08v4No1 / 748
615amnoncommon in control soil with no sugarcane (common campinas, brazil, greenhouse, soil)2020-04-27v4No1 / 780
824sheryoHigher at 0-10cm depth compared to 10-20cm depth in soil after grazing exclusion at 0-10cm depth, Ningxia china ( high in depth (soil) 0-10cm compared to depth 10-20cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 807
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph<5, china2018-11-26v4No1 / 823
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 830
583amnoncommon soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, canton of graubunden, calcareous parent material, ph 7-82020-01-28v3No1 / 830
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer in Nanjing China (common paenibacillus polymyxa, paenibacillus, compost, compost biofilter, pig manure, bio-organic fertilizer, soil, ph 6.9, chrysanthemum morifolium ramat., chrysanthemum, china, nanjing county)2021-04-14v4No1 / 866
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer and amended with soil fumigant 'Dazomet' in Nanjing China (common pig manure, compost soil, paenibacillus, paenibacillus polymyxa, compost biofilter, bio-organic fertilizer, nanjing county, china, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil, soil fumigation, dazomet)2021-04-14v4No1 / 875
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil2017-04-15v4No1 / 884
791sheryoHigher in low sodicity and low salinity soil compared to high sodicity and high salinity soil at 80cm depth in China ( high in ph 9 low sodicity low salinity compared to ph 10 high sodicity high salinity in depth (soil) 80cm soil salic solonetz da'an station china songnen plain )2021-06-08v4No1 / 895
767sheryocommon in soil planted with Chrysanthemum, infested with fusarium in Nanjing China (common soil, fusarium, fusarium oxysporum f. sp. chrysanthemi, ph 6.9, chrysanthemum morifolium ramat., chrysanthemum, china, nanjing county)2021-04-14v4No1 / 922
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
791sheryoHigher in low sodicity and low salinity soil compared to high sodicity and high salinity soil at 0cm depth in China ( high in ph 8.5 low sodicity low salinity compared to ph 10.5 high sodicity high salinity in depth (soil) 0-20cm depth 0cm soil salic solonetz da'an station china songnen plain )2021-06-08v4No1 / 932
767sheryoCommon in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (common nanjing county, china, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil, soil fumigation, dazomet)2021-04-14v4No1 / 946
98amnoncommon citrus, rhizosphere, quincy, fl, root, state of florida2017-04-01v4No1 / 950
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, root zone soil2017-04-15v4No1 / 968
266amnoncommon in soil from MIL garden (common soil, united states of america, state of idaho, ph 6.5)2017-12-18v4No1 / 980
809amnoncommon dendrobium moniliforme, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1002
824sheryoHigher at 20-40cm depth compared to 40-60cm depth in soil after grazing exclusion, Ningxia china ( high in depth 20-40cm compared to depth 40-60cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 1025
266amnoncommon in soil from PAR garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1032
791sheryoCommon at 0cm depth in low saline low sodicity soil in China (common depth (soil) 0-20cm, ph 8.5, depth 0cm, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-07v4No1 / 1035
824sheryoHigher at 10-20cm depth compared to 20-40cm depth in soil after grazing exclusion, Ningxia china ( high in depth 10-20cm compared to depth 20-40cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 1038
548amnoncommon minas gerais state, campos rupestres, brazil, rhizosphere, vellozia epidendroides2019-08-15v4No1 / 1040
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
767sheryocommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' and deep plough in Nanjing China (common dazomet, soil fumigation, soil, ph 6.9, chrysanthemum morifolium ramat., chrysanthemum, china, nanjing county, bio-organic fertilizer, compost biofilter, paenibacillus polymyxa, paenibacillus, compost soil, pig manure, conventional tillage, deep plough)2021-04-18v4No1 / 1109
791sheryoCommon at 80cm depth in low saline low sodicity soil in China (common depth (soil) 80cm, ph 9, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-08v4No1 / 1128
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus cuspidata, china2017-04-16v4No1 / 1141
791sheryoCommon at 20cm depth in low saline low sodicity soil in China (common ph 9, depth 20cm, ph 8.5, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-08v4No1 / 1155
628sheryocommon in rhizosphere of barley roots after 180 days in treatments amended with biochar (common mature barley plants, days 180, rhizosphere, hordeum vulgare, biochar, ph 4-5, depth (soil) 15cm, china, quzhou county, zhejiang province, soil)2020-05-18v4No1 / 1192
821sheryoCommon in soil of restored prairie at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1241
134amnoncommon rhizosphere, tree, taxus, taxus media, northeast china, temperate, china2017-04-16v4No1 / 1251
837sheryoCommon in soil at 0-40-100cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common depth 40-100cm, 20 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1294
837sheryoCommon in soil at 100-300cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common depth 100-300cm, 20 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1317
837sheryoCommon in soil at 0-40cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common 20 years, depth 0-40cm, robinia pseudoacacia, loess plateau, shaanxi province, china, reforestation, silt loam, soil)2021-09-26v4No1 / 1323
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
98amnoncommon citrus, rhizosphere, ft. pierce, fl, root, state of florida2017-04-01v4No1 / 1340
809amnoncommon dendrobium huoshanense, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1356
98amnoncommon citrus, rhizosphere, gainesville, fl, root, state of florida2017-04-01v4No1 / 1371
821sheryoCommon in soil of continuous corn field at 0-10cm depth, Michigan USA (common united states of america, state of michigan, kellogg biological station, ph 5.9, mesic type hapludalf, kalamazoo loam, depth (soil) 0-10cm, continuous corn, corn, soil)2021-07-28v4No1 / 1380
824sheryoCommon in soil after 0-9 years of grazing exclusion at 10-20cm depth, Ningxia china (common depth 10-20cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1397
76amnoncommon in non-seleniferous soil (common soil, rhizosphere, united states of america, non-seleniferous, state of florida)2017-02-28v4No1 / 1414
414amnon high in ph>6 compared to ph<6 npk fertilizer in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 1451
266amnoncommon in soil from JAM garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1456
824sheryoCommon in soil after 27-35 years of grazing exclusion at 10-20cm depth, Ningxia china (common depth 10-20cm, 27-35 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1477
145amnoncommon soil, rhizosphere, oryza sativa, rice, united states of america, ph 5.62017-04-19v4No1 / 1515
101amnon high in rhizosphere compared to root in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 1588
76amnonhigher in non-seleniferous soil compared to seleniferous soil ( high in non-seleniferous compared to selenium seleniferous in soil united states of america rhizosphere woodland area )2017-02-28v4No1 / 1621
821sheryoCommon in soil of continuous corn field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 1649
824sheryoCommon in soil after 27-35 years of grazing exclusion at 0-10cm depth, Ningxia china (common yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, 27-35 years of grazing exclusion, grazing exclusion, china, depth (soil) 0-10cm, soil)2021-08-08v4No1 / 1659
696amnon high in alycaeus jagori compared to georissa similis georissa in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 1698
821sheryoHigher at 10-25cm depth compared to 25-50cm depth in soil in Michigan USA ( high in depth (soil) 10-25cm compared to depth (soil) 25-50cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 1704
155amnonhigher in tightly bound root soil compared to loose soil and bulk soil ( high in root compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 1714
824sheryoCommon in soil after 0-9 years of grazing exclusion at 0-10cm depth, Ningxia china (common depth (soil) 0-10cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1903
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
357amnon high in ph>4.5 compared to ph<4.5 in soil topsoil depth (soil) 0-10cm moist tropical forest woodland area forest ecosystem 2018-08-18v4No1 / 2773
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>5, ph<6, china2018-02-11v4No1 / 3508
837sheryoHigher in soil after 20 years compared to 30 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 30 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 3893
100amnon high in ph ph<5.5 compared to ph>5.5 in soil urban biome park new york city central park 2017-04-03v4No1 / 4262
271amnon high in soil compared to rhizosphere glycine max soybean in depth (soil) 0-20cm china 2018-01-09v4No1 / 4853
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 20 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5270
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 30 years compared to zea mays triticum aestivum agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5596
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 20 years compared to triticum aestivum zea mays agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 5661
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org