Search result for sequence:
TACGTAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCACGTCTGCTGTGAAAATCCAAGGCTCAACCTTGGACTTGCAGTGGGTACGGGCAGGCTAGAGTGCGGTAGGGGAGATGGGAATTCCTGG
common ontology terms
term enrichment score
TermScore
sea water0.340757
fresh water0.333333
water0.325323
freshwater lake0.222222
beach0.210526
lake0.190476
pacific ocean0.177122
river0.173913
state of california0.167247
pond0.163265
free floating0.154839
atlantic ocean0.153846
state of alabama0.150943
south florida0.150943
mississippi river0.150943
saline water0.131148
nan'ao island0.117647
mud crab0.117647
scylla paramamosain0.117647
saline water aquarium0.117647
aquatic biome0.117647
fishpond0.111111
fish farm0.111111
french republic0.109589
surface water0.105263
ocean0.086957
city0.085106
LOWER IN particle0.083333
state of florida0.082474
north america0.081633
depth 25cm0.081633
shark0.081633
LOWER IN starfish0.081633
LOWER IN coelomic fluid0.081633
lake erie0.081633
river nile0.081633
depth 50cm0.081633
cairo0.081633
shrimp farm0.081633
san francisco bay0.081633
depth 0.5m0.078431
hokkaido0.078431
pond water0.075472
china0.073394
egypt0.072727
sand0.072727
spring0.065574
LOWER IN wild0.065574
intestine0.064516
summer0.063492
united states of america0.059850
japan0.059701
farm0.052632
cape cod canal0.042553
LOWER IN vancouver0.042553
LOWER IN pacific ocean0.042553
anal canal0.042553
LOWER IN patiria pectinifera0.042553
bermuda0.042553
LOWER IN porites astreoides0.042553
LOWER IN air0.042553
LOWER IN aerosol0.042553
size < 1um0.042553
LOWER IN particle bound0.042553
LOWER IN size 1-80um0.042553
algal bloom0.042553
shore0.042553
LOWER IN asterias amurensis0.042553
depth 0cm0.042553
LOWER IN megaptera novaeangliae0.042553
LOWER IN humpback whale0.042553
LOWER IN respiratory airway0.042553
LOWER IN whale blow0.042553
LOWER IN exhaled air condensate0.042553
LOWER IN influent0.042553
LOWER IN sewage0.042553
LOWER IN fish0.042553
LOWER IN ictalurus punctatus0.042553
LOWER IN channel catfish0.042553
depth 1m0.042553
LOWER IN filtered 2.7um0.042553
LOWER IN shark0.042553
bodega bay0.042553
santa cruz county0.042553
mudflat0.042553
futian national nature reserve0.042553
mangrove biome0.042553
santa cruz province0.042553
depth 10m0.041667
depth 40m0.041667
channel catfish0.041667
ictalurus punctatus0.041667
south america0.041667
LOWER IN intestine0.041667
filtered 0.2um0.041667
particle0.041667
depth 0m0.041667
hawaii0.040816
LOWER IN marine sediment0.040816
LOWER IN sand0.040816
Fraction of dbbact annotations with this term covered by the query
TermScore
pond1.000000
freshwater lake0.666667
LOWER IN particle0.666667
free floating0.600000
state of alabama0.500000
nan'ao island0.500000
mud crab0.500000
scylla paramamosain0.500000
saline water aquarium0.500000
north america0.500000
depth 25cm0.500000
cape cod canal0.500000
LOWER IN vancouver0.500000
LOWER IN pacific ocean0.500000
south florida0.500000
shark0.500000
anal canal0.500000
LOWER IN starfish0.500000
LOWER IN coelomic fluid0.500000
LOWER IN patiria pectinifera0.500000
bermuda0.500000
LOWER IN porites astreoides0.500000
beach0.500000
LOWER IN air0.500000
LOWER IN aerosol0.500000
size < 1um0.500000
LOWER IN particle bound0.500000
LOWER IN size 1-80um0.500000
lake erie0.500000
algal bloom0.500000
shore0.500000
LOWER IN asterias amurensis0.500000
river nile0.500000
depth 50cm0.500000
cairo0.500000
depth 0cm0.500000
LOWER IN megaptera novaeangliae0.500000
LOWER IN humpback whale0.500000
LOWER IN respiratory airway0.500000
LOWER IN whale blow0.500000
LOWER IN exhaled air condensate0.500000
mississippi river0.500000
aquatic biome0.500000
LOWER IN influent0.500000
LOWER IN sewage0.500000
LOWER IN fish0.500000
LOWER IN ictalurus punctatus0.500000
LOWER IN channel catfish0.500000
depth 1m0.500000
LOWER IN filtered 2.7um0.500000
shrimp farm0.500000
LOWER IN shark0.500000
bodega bay0.500000
san francisco bay0.500000
santa cruz county0.500000
mudflat0.500000
futian national nature reserve0.500000
mangrove biome0.500000
santa cruz province0.500000
fresh water0.333333
fishpond0.333333
lake0.333333
depth 0.5m0.333333
fish farm0.333333
depth 10m0.333333
depth 40m0.333333
channel catfish0.333333
ictalurus punctatus0.333333
hokkaido0.333333
south america0.333333
LOWER IN intestine0.333333
filtered 0.2um0.333333
particle0.333333
depth 0m0.333333
sea water0.310345
pond water0.250000
saline water0.250000
atlantic ocean0.250000
surface water0.250000
hawaii0.250000
river0.250000
LOWER IN marine sediment0.250000
LOWER IN sand0.250000
wastewater treatment plant0.250000
effluent0.250000
litopenaeus vannamei0.250000
pacific white shrimp0.250000
zhejiang province0.250000
mangrove swamp0.250000
water0.234043
egypt0.200000
LOWER IN sediment0.200000
depth 0-20cm0.200000
sand0.200000
pacific ocean0.176471
dry season0.166667
wet season0.166667
state of california0.157895
french republic0.142857
spring0.125000
Fraction of annotations for the query sequences containing the term
TermScore
water0.533333
united states of america0.444444
sea water0.377778
fresh water0.333333
china0.222222
state of california0.177778
pacific ocean0.177778
lake0.133333
freshwater lake0.133333
beach0.133333
river0.133333
atlantic ocean0.111111
state of alabama0.088889
research facility0.088889
french republic0.088889
saline water0.088889
pond0.088889
south florida0.088889
state of florida0.088889
free floating0.088889
mississippi river0.088889
fishpond0.066667
nan'ao island0.066667
mud crab0.066667
scylla paramamosain0.066667
fish farm0.066667
saline water aquarium0.066667
ocean0.066667
city0.066667
surface water0.066667
aquatic biome0.066667
farm0.066667
pond water0.044444
depth 0.5m0.044444
spring0.044444
intestine0.044444
north america0.044444
depth 25cm0.044444
shark0.044444
hokkaido0.044444
LOWER IN starfish0.044444
LOWER IN wild0.044444
LOWER IN coelomic fluid0.044444
japan0.044444
lake erie0.044444
summer0.044444
river nile0.044444
depth 50cm0.044444
cairo0.044444
egypt0.044444
LOWER IN particle0.044444
shrimp farm0.044444
san francisco bay0.044444
sand0.044444
depth 10m0.022222
depth 40m0.022222
channel catfish0.022222
ictalurus punctatus0.022222
cape cod canal0.022222
LOWER IN vancouver0.022222
LOWER IN pacific ocean0.022222
anal canal0.022222
LOWER IN patiria pectinifera0.022222
bermuda0.022222
control0.022222
LOWER IN porites astreoides0.022222
skin0.022222
LOWER IN air0.022222
LOWER IN aerosol0.022222
size < 1um0.022222
LOWER IN particle bound0.022222
LOWER IN size 1-80um0.022222
algal bloom0.022222
LOWER IN control0.022222
hawaii0.022222
shore0.022222
autumn0.022222
LOWER IN asterias amurensis0.022222
winter0.022222
dry season0.022222
LOWER IN sediment0.022222
LOWER IN marine sediment0.022222
wet season0.022222
depth 0cm0.022222
LOWER IN sand0.022222
LOWER IN megaptera novaeangliae0.022222
LOWER IN humpback whale0.022222
LOWER IN respiratory airway0.022222
LOWER IN whale blow0.022222
LOWER IN exhaled air condensate0.022222
south america0.022222
wastewater treatment plant0.022222
effluent0.022222
LOWER IN influent0.022222
LOWER IN sewage0.022222
LOWER IN fish0.022222
LOWER IN ictalurus punctatus0.022222
LOWER IN channel catfish0.022222
LOWER IN intestine0.022222
depth 1m0.022222
Exp. ID User ID Description Date Region Flag Sequences
481amnonhighfreq united states of america, state of alabama, research facility, water, fresh water, pond water, fishpond2019-02-12v4No1 / 10
557amnonhighfreq lake, freshwater lake, fresh water, water, french republic, depth 0.5m2019-09-14v3No1 / 17
504amnonhighfreq nan'ao island, water, sea water, china2019-03-14v4No1 / 18
579amnonhigh freq. in pond water of mud crab aquaculture (highfreq spring, mud crab, scylla paramamosain, fish farm, saline water aquarium, saline water, pond, china)2020-01-14v3No1 / 20
557amnoncommon lake, freshwater lake, fresh water, water, french republic, depth 0.5m2019-09-14v3No1 / 94
557amnoncommon lake, freshwater lake, fresh water, water, french republic, depth 10m2019-09-14v3No1 / 123
557amnoncommon lake, freshwater lake, fresh water, water, french republic, depth 40m2019-09-14v3No1 / 129
481amnoncommon united states of america, state of alabama, research facility, channel catfish, ictalurus punctatus, intestine2019-02-12v4No1 / 151
209amnon high in cape cod canal atlantic ocean compared to vancouver pacific ocean in sea water ocean north america depth 25cm 2017-10-15v4No1 / 166
323amnoncommon in shark cloaca (common atlantic ocean, south florida, state of florida, united states of america, shark, anal canal)2018-04-24v4No1 / 167
579amnoncommon in pond water of mud crab aquaculture (common spring, mud crab, scylla paramamosain, fish farm, saline water aquarium, saline water, pond, china)2020-01-14v3No1 / 173
550amnon high in sea water compared to starfish wild coelomic fluid patiria pectinifera in city hokkaido japan 2019-08-18v4No1 / 185
481amnoncommon united states of america, state of alabama, research facility, water, fresh water, pond water, fishpond2019-02-12v4No1 / 210
9amnonlower in sea water with coral ( high in control compared to porites astreoides in bermuda sea water )2016-10-27v4No1 / 211
323amnoncommon in shark skin (common atlantic ocean, south florida, state of florida, united states of america, shark, skin)2018-04-24v4No1 / 213
304amnonhigher in seawater compared sea spray aerosol ( high in water sea water compared to air aerosol in united states of america state of california beach pacific ocean )2018-03-12v4No1 / 260
505amnon high in free floating size < 1um compared to particle bound size 1-80um in water pacific ocean state of california surface water sea water 2019-03-14v4No1 / 283
226amnonhigher in algal bloom period in lake erie ( high in algal bloom compared to control in water lake lake erie united states of america freshwater lake fresh water )2017-10-29v4No1 / 301
226amnoncommon water, lake, lake erie, united states of america, freshwater lake, fresh water2017-10-29v4No1 / 316
93amnoncommon in seawater near the shore in hawaii (common hawaii, sea water, shore)2017-03-12v4No1 / 345
579amnoncommon in pond water of mud crab aquaculture (common autumn, summer, mud crab, scylla paramamosain, fish farm, saline water aquarium, saline water, pond, china)2020-01-14v3No1 / 374
550amnon high in sea water compared to starfish asterias amurensis coelomic fluid wild in city hokkaido japan 2019-08-18v4No1 / 389
366amnoncommon river nile, water, river, fresh water, depth 50cm, cairo, egypt, winter, dry season2018-08-31v4No1 / 403
504amnoncommon nan'ao island, water, sea water, china2019-03-14v4No1 / 452
504amnon high in water sea water compared to sediment marine sediment in nan'ao island china 2019-03-14v4No1 / 462
366amnoncommon river nile, water, river, fresh water, depth 50cm, cairo, egypt, summer, wet season2018-08-31v4No1 / 474
323amnoncommon water, atlantic ocean, south florida, state of florida, united states of america, surface water, depth 0cm, sea water2018-04-24v4No1 / 504
304amnonhigher in seawater compared to beach sand ( high in sea water water compared to sand in united states of america state of california beach pacific ocean )2018-03-12v4No1 / 547
209amnonlower in whale blow condensate compared to ocean water ( high in sea water ocean depth 25cm compared to megaptera novaeangliae humpback whale respiratory airway whale blow exhaled air condensate in north america )2017-10-15v4No1 / 560
103amnonlower in particle bound fraction compared to free floating bacteria in mississippi river ( high in free floating compared to particle in river united states of america mississippi river fresh water aquatic biome )2017-04-05v4No1 / 653
53amnonhigher in wastewater plant effluent compared to influent and sewer in south america ( high in effluent compared to influent sewage in south america city wastewater treatment plant )2017-01-21v4No1 / 657
481amnonlower in channel catfish intestine compared to the growing pond water ( high in pond water fresh water fishpond compared to fish ictalurus punctatus channel catfish intestine in united states of america state of alabama research facility )2019-02-12v4No1 / 741
443amnon high in free floating filtered 0.2um compared to particle filtered 2.7um in water river fresh water depth 1m united states of america mississippi river 2019-01-07v4No1 / 755
478amnoncommon farm, litopenaeus vannamei, pacific white shrimp, intestine, china2019-02-19v4No1 / 795
478amnoncommon farm, shrimp farm, water, saline water, china2019-02-19v4No1 / 799
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, particle2017-04-05v4No1 / 909
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, free floating2017-04-05v4No1 / 909
323amnonlower in sharks compared to sea water ( high in water surface water depth 0m sea water compared to shark in atlantic ocean south florida state of florida united states of america )2018-04-24v4No1 / 979
478amnoncommon farm, shrimp farm, sediment, china2019-02-19v4No1 / 1085
236amnoncommon ocean, state of california, pacific ocean, bodega bay, water, sea water2017-11-07v4No1 / 1156
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, san francisco bay2018-03-12v4No1 / 1166
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, santa cruz county2018-03-12v4No1 / 1425
571amnoncommon mudflat, futian national nature reserve, zhejiang province, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1587
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, san francisco bay2018-03-12v4No1 / 1799
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, santa cruz province2018-03-12v4No1 / 1838

Problems / suggestions? Please email info AT dbbact DOT org