Search result for sequence:
TACGTAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCGGCTGTGAAAACTCGGGGCTCAACCCCGAGCCTGCAGTCGATACGGGCAAACTAGAGTGTGGTAGGGGAGACTGGAATTCCTGG
common ontology terms
term enrichment score
TermScore
pot expreiment0.290323
soil0.264213
lettuce0.241379
bulk soil0.222222
topsoil0.185430
thyrow0.185185
mineral fertilization0.153846
albic luvisol0.153846
npk fertilization0.142857
haplic luvisol0.142857
depth (soil) 0-10cm0.130719
switzerland0.129032
depth (soil) 0-20cm0.120950
bon portage island0.120000
burrow0.120000
svalbard archipelago0.120000
depth (soil) 0-30 cm0.120000
maize field0.120000
ph 6.40.120000
sugarcane0.113208
saccharum0.113208
permafrost0.107143
root0.101695
guangzhou city prefecture0.101695
forest ecosystem0.100000
woodland area0.090909
kingdom of norway0.088235
rhizosphere0.087912
germany0.085714
park0.085106
potting mix0.085106
oceanodroma leucorhoa0.083333
seabird0.083333
minas gerais state0.083333
campos rupestres0.083333
epiphytic material0.083333
olympic national park0.083333
canopy soil0.083333
panax notoginseng0.083333
sanqi plants0.083333
xundian county0.083333
lower saxony0.083333
sandy soil0.083333
LOWER IN organic fertilization0.083333
therwil0.083333
flood plain0.083333
sacramento0.083333
cosumnes river preserve0.083333
depth 0-12cm0.083333
hapludalf0.083333
alfisol0.083333
illinois0.083333
dekalb county0.083333
ph 6.70.080000
non-fertilized soil0.080000
yunnan province0.080000
LOWER IN manure fertilization0.080000
sandy loam0.080000
sandy loam soil0.080000
depth (soil) 20-30cm0.076923
canada0.076923
state of washington0.074074
ph 50.074074
zea mays0.074074
ph 60.071429
LOWER IN manured soil0.071429
state of illinois0.066667
bird0.055556
brazil0.048780
china0.047059
quaternary laterite soil0.044444
cucurbita moschata0.044444
pumpkin0.044444
central park0.043478
surface burrow0.043478
LOWER IN deep burrow0.043478
LOWER IN seabird0.043478
LOWER IN oceanodroma leucorhoa0.043478
LOWER IN soilwater0.043478
boechera stricta0.043478
permafrost active layer0.043478
LOWER IN depth 100-150cm0.043478
LOWER IN depth 150-200cm0.043478
temperate woodland biome0.043478
temperate deciduos forest0.043478
subpolar coniferous forest biome0.043478
boreal forest0.043478
southern temperate forest0.043478
temperate broadleaf and mixed forest biome0.043478
bank vole0.043478
myodes glareolus0.043478
ukraine0.043478
no human contact0.043478
chernobyl exclusion zone0.043478
barbacenia macrantha0.043478
LOWER IN amended with biochar0.043478
substraat arabidopsis0.043478
lentse potgrond0.043478
intact branch0.043478
severed branch0.043478
Fraction of dbbact annotations with this term covered by the query
TermScore
quaternary laterite soil1.000000
cucurbita moschata1.000000
pumpkin1.000000
park0.666667
potting mix0.666667
central park0.500000
oceanodroma leucorhoa0.500000
seabird0.500000
bon portage island0.500000
burrow0.500000
surface burrow0.500000
LOWER IN deep burrow0.500000
LOWER IN seabird0.500000
LOWER IN oceanodroma leucorhoa0.500000
LOWER IN soilwater0.500000
boechera stricta0.500000
svalbard archipelago0.500000
permafrost active layer0.500000
LOWER IN depth 100-150cm0.500000
LOWER IN depth 150-200cm0.500000
temperate woodland biome0.500000
temperate deciduos forest0.500000
subpolar coniferous forest biome0.500000
boreal forest0.500000
southern temperate forest0.500000
temperate broadleaf and mixed forest biome0.500000
bank vole0.500000
myodes glareolus0.500000
ukraine0.500000
no human contact0.500000
chernobyl exclusion zone0.500000
minas gerais state0.500000
campos rupestres0.500000
barbacenia macrantha0.500000
LOWER IN amended with biochar0.500000
substraat arabidopsis0.500000
lentse potgrond0.500000
intact branch0.500000
epiphytic material0.500000
olympic national park0.500000
canopy soil0.500000
severed branch0.500000
elevation 2000-3000m0.500000
siliceous parent material0.500000
rhone river valley0.500000
depth (soil) 0-30 cm0.500000
oak0.500000
panax notoginseng0.500000
sanqi plants0.500000
xundian county0.500000
pot expreiment0.500000
bacillus amyloliquefaciens sqr90.500000
lower saxony0.500000
sandy soil0.500000
maize field0.500000
mineral fertilization0.500000
thyrow0.500000
albic luvisol0.500000
ph 6.40.500000
lettuce0.500000
organic fertilization0.500000
LOWER IN organic fertilization0.500000
therwil0.500000
LOWER IN bio-dynamic fertilizer0.500000
bretagne region0.500000
flood plain0.500000
sacramento0.500000
cosumnes river preserve0.500000
depth 0-12cm0.500000
hapludalf0.500000
alfisol0.500000
illinois0.500000
dekalb county0.500000
LOWER IN depth 12-44cm0.500000
LOWER IN depth 30-60cm0.500000
ph 5.50.500000
ph<60.333333
LOWER IN ph&gt;60.333333
province of quebec0.333333
state of idaho0.333333
LOWER IN human contact0.333333
unamended0.333333
mountain0.333333
ph 4-60.333333
ph 6.70.333333
sugarcane0.333333
saccharum0.333333
non-fertilized soil0.333333
ph 5.5-60.333333
LOWER IN ph 5.5-60.333333
quercus0.333333
yunnan province0.333333
fusarium oxysporum0.333333
bio-organic fertilizer0.333333
npk fertilization0.333333
manure fertilization0.333333
LOWER IN manure fertilization0.333333
ph 5.60.333333
haplic luvisol0.333333
cambisol0.333333
Fraction of annotations for the query sequences containing the term
TermScore
soil0.795455
pot expreiment0.204545
china0.181818
bulk soil0.181818
united states of america0.159091
depth (soil) 0-20cm0.159091
topsoil0.159091
lettuce0.159091
germany0.136364
depth (soil) 0-10cm0.113636
thyrow0.113636
canada0.090909
woodland area0.090909
forest ecosystem0.090909
rhizosphere0.090909
switzerland0.090909
mineral fertilization0.090909
npk fertilization0.090909
albic luvisol0.090909
haplic luvisol0.090909
root0.068182
bon portage island0.068182
burrow0.068182
kingdom of norway0.068182
svalbard archipelago0.068182
permafrost0.068182
sugarcane0.068182
saccharum0.068182
guangzhou city prefecture0.068182
depth (soil) 0-30 cm0.068182
maize field0.068182
ph 6.40.068182
park0.045455
bird0.045455
oceanodroma leucorhoa0.045455
seabird0.045455
depth (soil) 20-30cm0.045455
minas gerais state0.045455
campos rupestres0.045455
brazil0.045455
potting mix0.045455
epiphytic material0.045455
state of washington0.045455
olympic national park0.045455
canopy soil0.045455
ph 6.70.045455
non-fertilized soil0.045455
panax notoginseng0.045455
sanqi plants0.045455
ph 60.045455
xundian county0.045455
yunnan province0.045455
ph 50.045455
lower saxony0.045455
sandy soil0.045455
zea mays0.045455
LOWER IN manured soil0.045455
LOWER IN manure fertilization0.045455
LOWER IN organic fertilization0.045455
therwil0.045455
LOWER IN rhizosphere0.045455
flood plain0.045455
state of california0.045455
sacramento0.045455
cosumnes river preserve0.045455
depth 0-12cm0.045455
sandy loam0.045455
sandy loam soil0.045455
hapludalf0.045455
alfisol0.045455
state of illinois0.045455
illinois0.045455
dekalb county0.045455
urban biome0.022727
new york city0.022727
central park0.022727
ph0.022727
ph<60.022727
LOWER IN ph&gt;60.022727
triticum aestivum0.022727
wheat0.022727
LOWER IN bulk soil0.022727
surface burrow0.022727
LOWER IN deep burrow0.022727
LOWER IN bird0.022727
LOWER IN seabird0.022727
LOWER IN oceanodroma leucorhoa0.022727
LOWER IN soilwater0.022727
province of quebec0.022727
LOWER IN water0.022727
brassicaceae0.022727
boechera stricta0.022727
plant0.022727
state of idaho0.022727
LOWER IN leaf0.022727
permafrost active layer0.022727
LOWER IN depth 100-150cm0.022727
LOWER IN depth 150-200cm0.022727
temperate woodland biome0.022727
temperate deciduos forest0.022727
Exp. ID User ID Description Date Region Flag Sequences
762sheryoHigher in bulk soil of a pot experiment with lettuce planted in npk fertilized albic luvisol compared to organic fertilized from Germany ( high in mineral fertilization npk fertilization compared to manured soil manure fertilization organic fertilization in germany soil bulk soil thyrow albic luvisol ph 6.4 lettuce pot expreiment )2021-04-07v3No1 / 38
583amnoncommon soil, mountain, switzerland, ph 4-6, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, rhone river valley2020-01-27v3No1 / 234
602sheryohigher in rhizoshere of tomato plant roots planted in unamended potting mix ( high in unamended compared to amended with biochar in potting mix rhizosphere israel solanum lycopersicum )2020-04-05v4No1 / 252
762sheryoHigher in bulk soil of a pot experiment with lettuce planted in npk fertilized compared to organic fertilized haplic luvisol Switzerland ( high in npk fertilization mineral fertilization compared to organic fertilization bio-dynamic fertilizer manure fertilization manured soil in therwil switzerland haplic luvisol soil bulk soil lettuce pot expreiment )2021-04-07v3No1 / 347
347amnoncommon depth (soil) 0-20cm, kingdom of norway, svalbard archipelago, permafrost, soil, permafrost active layer2018-07-15v4No1 / 405
357amnoncommon soil, topsoil, depth (soil) 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 474
813amnoncommon intact branch, epiphytic material, united states of america, state of washington, olympic national park, canopy soil, soil2021-06-22v4No1 / 475
357amnoncommon soil, topsoil, depth (soil) 0-10cm, southern temperate forest, temperate broadleaf and mixed forest biome, woodland area, forest ecosystem2018-08-19v4No1 / 499
616amnon high in ph 6.7 non-fertilized soil compared to ph 5.5-6 fertilized soil in depth (soil) 0-20cm sugarcane saccharum soil topsoil china guangzhou city prefecture 2020-04-27v3No1 / 504
762sheryocommin in bulk soil of a pot experiment with lettuce planted in npk fertilzed albic luvisol from Germany (common mineral fertilization, npk fertilization, germany, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v3No1 / 531
357amnoncommon soil, topsoil, depth (soil) 0-10cm, subpolar coniferous forest biome, boreal forest, woodland area, forest ecosystem2018-08-19v4No1 / 538
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
762sheryoHigh in bulk soil comparedc to rhizosphere of a pot experiment with lettuce planted in haplic luvisol Switzerland ( high in bulk soil compared to rhizosphere in thyrow switzerland haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 577
762sheryoHigh in bulk soil compared to rhizosphere of a pot experiment with lettuce planted in albic luvisol Germany ( high in bulk soil compared to rhizosphere in thyrow albic luvisol germany haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 578
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 4-4.5, park, london, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 623
786sheryoHigher at 0-30cm depth compared to 30-60cm depth in flood plain soil near cosumnes river, california ( high in depth (soil) 0-30 cm depth (soil) 0-20cm compared to depth 30-60cm in flood plain soil united states of america state of california sacramento cosumnes river preserve )2021-09-13v3No1 / 627
813amnoncommon severed branch, epiphytic material, united states of america, state of washington, olympic national park, canopy soil, soil2021-06-22v4No1 / 633
237amnoncommon in burrow soil of seabird (common bird, oceanodroma leucorhoa, seabird, canada, bon portage island, burrow, soil)2017-11-07v4No1 / 638
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (common npk fertilization, mineral fertilization, ph 5.6, therwil, switzerland, haplic luvisol, soil, bulk soil, lettuce, pot expreiment)2021-04-07v3No1 / 648
829sheryohigher soil depth of 0-12cm compared to 12-44cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 0-12cm compared to depth 12-44cm in sandy loam sandy loam soil hapludalf alfisol united states of america soil state of illinois illinois dekalb county )2021-08-26v3No1 / 685
347amnoncommon kingdom of norway, svalbard archipelago, permafrost, soil, depth (soil) 20-30cm2018-07-15v4No1 / 698
754sheryoCommon in soil planted with cucmber, fertilized with bioorganic fertilizer (Bacillus amyloliquefaciens SQR 9) and infected with Fusarium oxysporum f. sp. cucumerinum (common bacillus amyloliquefaciens sqr9, zhejiang province, cucumber, fusarium oxysporum, bio-organic fertilizer, soil, china)2021-03-15v3No1 / 701
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol from Germany (common manured soil, manure fertilization, germany, organic fertilization, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v3No1 / 704
752sheryoCommon in soil planted with Panax notoginseng (common panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 730
829sheryoCommon in soil depth of 0-12m in Alfisol soil, Dekalb, Illinois, united states of america (common depth 0-12cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 737
761sheryoCommon in maize rhizosphere sandy soil maize field in Germany (common zea mays, rhizosphere, ph 5, lower saxony, sandy soil, germany, maize field)2021-04-06v3No1 / 742
709sheryoCommon in potting mix soil from the Netherlands, substraat arabidopsis, Lentse Potgrond (common substraat arabidopsis, lentse potgrond, soil, potting mix, kingdom of the netherlands)2028-05-16v4No1 / 752
752sheryoCommon in soil planted with Panax notoginseng amended with2% biochar (common biochar, panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 783
761sheryoCommon in bulk sandy soil maize field in Germany (common ph 5, lower saxony, sandy soil, germany, maize field, bulk soil)2021-04-06v3No1 / 835
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
933amnoncommon guangxi zhuang autonomous region, ph 5.5, quaternary laterite soil, research facility, china, cucurbita moschata, pumpkin, rhizosphere2022-09-11v3No1 / 1002
768sheryoCommon in maize fields in Brittany, France (common zea mays, maize field, cambisol, bretagne region, french republic, soil)2021-04-18v3No1 / 1034
786sheryocommon in flood plain soil near cosumnes river, california, at 0-30cm depth (common depth (soil) 0-30 cm, depth (soil) 0-20cm, flood plain, soil, united states of america, state of california, sacramento, cosumnes river preserve)2021-05-18v3No1 / 1048
347amnon high in depth (soil) 20-30cm compared to depth 100-150cm depth 150-200cm in kingdom of norway svalbard archipelago permafrost soil 2018-07-15v4No1 / 1080
357amnon high in ph<5 compared to ph>5 in soil topsoil depth (soil) 0-10cm temperate woodland biome temperate deciduos forest woodland area forest ecosystem 2018-08-18v4No1 / 1104
423amnon high in no human contact chernobyl exclusion zone compared to human contact in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 1229
237amnonlower deep in burrow compared to burrow entrance ( high in surface burrow compared to deep burrow in bird oceanodroma leucorhoa seabird canada bon portage island burrow soil )2017-11-07v4No1 / 1247
616amnoncommon in topsoil of non-fertilized sugarcane field (common depth (soil) 0-20cm, ph 6.7, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture, non-fertilized soil)2020-04-27v3No1 / 1277
616amnoncommon in topsoil of PK/NP/NPK/NK fertilized sugarcane field (common depth (soil) 0-20cm, fertilized soil, ph 5.5-6, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture)2020-04-27v3No1 / 1710
155amnonhigher in tightly bound root soil compared to loose soil and bulk soil ( high in root compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 1714
265amnon high in soil compared to soilwater water in canada province of quebec 2017-12-11v4No1 / 2715
237amnonhigher in burrow soil compared to bird ( high in soil burrow compared to bird seabird oceanodroma leucorhoa in canada bon portage island )2017-11-07v4No1 / 3656
100amnon high in ph ph<6 compared to ph>6 in soil urban biome park new york city central park 2017-04-03v4No1 / 5770
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5886

Problems / suggestions? Please email info AT dbbact DOT org