Search result for sequence:
TACGTAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGCTGTGAAAATCCGAGGCTCAACCTCGGACCTGCAGTGGGTACGGGCAAACTAGAGTGCGGTAGGGGAGATTGGAATTCCTGG
common ontology terms
term enrichment score
TermScore
sea water0.292605
water0.274686
lake water0.272727
lake0.226415
saline water0.222222
ursu lake0.186047
romania0.186047
mangrove biome0.186047
zhejiang province0.156863
mangrove swamp0.156863
nan'ao island0.146341
mixolimnion0.146341
depth 0-3m0.146341
south florida0.146341
beach0.146341
san francisco bay0.146341
futian national nature reserve0.146341
depth 0-20cm0.145455
low salinity0.136364
pacific ocean0.129032
state of california0.121212
manganika lake0.102564
hypereutrophic lake0.102564
sulfidic bottom water0.102564
north america0.102564
depth 25cm0.102564
shrimp farm0.102564
atlantic ocean0.101695
LOWER IN sediment0.100000
city0.099174
farm0.098765
hokkaido0.097561
monterey bay0.097561
spartina alterniflora0.097561
fresh water0.096774
china0.094712
state of minnesota0.088889
marine sediment0.087912
state of florida0.081081
surface water0.078431
japan0.070175
skin0.066667
ocean0.059701
LOWER IN lake sediment0.054054
mud crab0.054054
scylla paramamosain0.054054
saline water aquarium0.054054
pond0.054054
LOWER IN hypersaline water0.054054
LOWER IN monimolimnion0.054054
LOWER IN depth 4-9m0.054054
bermuda0.054054
LOWER IN porites astreoides0.054054
shark0.054054
estuary0.054054
estuary water0.054054
salinity >20 ppt0.054054
LOWER IN salinity <5 ppt0.054054
bilbao0.054054
monimolimnion0.054054
hypersaline water0.054054
depth 4-9m0.054054
toronto zoo0.054054
canada0.054054
LOWER IN starfish0.054054
LOWER IN asterias amurensis0.054054
LOWER IN coelomic fluid0.054054
depth 0cm0.054054
aerosol0.054054
LOWER IN megaptera novaeangliae0.054054
LOWER IN humpback whale0.054054
LOWER IN respiratory airway0.054054
LOWER IN whale blow0.054054
LOWER IN exhaled air condensate0.054054
LOWER IN influent0.054054
LOWER IN sewage0.054054
depth 5-50m0.054054
LOWER IN depth 50-100m0.054054
LOWER IN shark0.054054
deth 5-100m0.054054
orthic anthrosol0.054054
cucumis sativus0.054054
cucumber0.054054
depth 1m0.054054
lower mississippi river0.054054
LOWER IN upper mississippi river0.054054
kandelia candel0.054054
mudflat0.054054
ximendao national marine reserve0.054054
fish farm0.052632
LOWER IN high salinity0.052632
high salinity0.052632
olive baboon0.052632
papio anubis0.052632
south america0.052632
depth 0m0.052632
particle0.052632
filtered 2.7um0.052632
mangrove0.052632
LOWER IN marine sediment0.051282
Fraction of dbbact annotations with this term covered by the query
TermScore
lake water0.666667
nan'ao island0.500000
mixolimnion0.500000
depth 0-3m0.500000
ursu lake0.500000
romania0.500000
manganika lake0.500000
LOWER IN lake sediment0.500000
hypereutrophic lake0.500000
sulfidic bottom water0.500000
mud crab0.500000
scylla paramamosain0.500000
saline water aquarium0.500000
saline water0.500000
pond0.500000
LOWER IN hypersaline water0.500000
LOWER IN monimolimnion0.500000
LOWER IN depth 4-9m0.500000
bermuda0.500000
LOWER IN porites astreoides0.500000
south florida0.500000
shark0.500000
estuary0.500000
estuary water0.500000
salinity >20 ppt0.500000
LOWER IN salinity <5 ppt0.500000
bilbao0.500000
monimolimnion0.500000
hypersaline water0.500000
depth 4-9m0.500000
toronto zoo0.500000
canada0.500000
LOWER IN starfish0.500000
LOWER IN asterias amurensis0.500000
LOWER IN coelomic fluid0.500000
north america0.500000
depth 25cm0.500000
depth 0cm0.500000
beach0.500000
aerosol0.500000
san francisco bay0.500000
LOWER IN megaptera novaeangliae0.500000
LOWER IN humpback whale0.500000
LOWER IN respiratory airway0.500000
LOWER IN whale blow0.500000
LOWER IN exhaled air condensate0.500000
LOWER IN influent0.500000
LOWER IN sewage0.500000
shrimp farm0.500000
depth 5-50m0.500000
LOWER IN depth 50-100m0.500000
LOWER IN shark0.500000
deth 5-100m0.500000
orthic anthrosol0.500000
cucumis sativus0.500000
cucumber0.500000
depth 1m0.500000
lower mississippi river0.500000
LOWER IN upper mississippi river0.500000
kandelia candel0.500000
futian national nature reserve0.500000
mangrove biome0.500000
mudflat0.500000
ximendao national marine reserve0.500000
LOWER IN sediment0.400000
low salinity0.333333
lake0.333333
fish farm0.333333
LOWER IN high salinity0.333333
hokkaido0.333333
high salinity0.333333
olive baboon0.333333
papio anubis0.333333
south america0.333333
monterey bay0.333333
depth 0m0.333333
particle0.333333
filtered 2.7um0.333333
mangrove0.333333
spartina alterniflora0.333333
LOWER IN marine sediment0.250000
wastewater treatment plant0.250000
effluent0.250000
litopenaeus vannamei0.250000
pacific white shrimp0.250000
greenhouse soil0.250000
mississippi river0.250000
downstream0.250000
LOWER IN upstream0.250000
zhejiang province0.250000
mangrove swamp0.250000
sea water0.241379
state of minnesota0.200000
depth 0-20cm0.200000
sand0.200000
water0.191489
LOWER IN fresh water0.166667
captive0.166667
spring0.125000
atlantic ocean0.125000
Fraction of annotations for the query sequences containing the term
TermScore
water0.485714
sea water0.371429
china0.342857
united states of america0.257143
lake water0.171429
lake0.171429
saline water0.142857
state of california0.142857
pacific ocean0.142857
ursu lake0.114286
romania0.114286
farm0.114286
zhejiang province0.114286
mangrove biome0.114286
depth 0-20cm0.114286
marine sediment0.114286
mangrove swamp0.114286
soil0.114286
nan'ao island0.085714
low salinity0.085714
mixolimnion0.085714
depth 0-3m0.085714
fresh water0.085714
atlantic ocean0.085714
south florida0.085714
state of florida0.085714
city0.085714
beach0.085714
san francisco bay0.085714
futian national nature reserve0.085714
state of minnesota0.057143
manganika lake0.057143
LOWER IN sediment0.057143
hypereutrophic lake0.057143
sulfidic bottom water0.057143
skin0.057143
hokkaido0.057143
japan0.057143
ocean0.057143
north america0.057143
depth 25cm0.057143
surface water0.057143
shrimp farm0.057143
monterey bay0.057143
spartina alterniflora0.057143
LOWER IN lake sediment0.028571
spring0.028571
mud crab0.028571
scylla paramamosain0.028571
fish farm0.028571
saline water aquarium0.028571
pond0.028571
LOWER IN hypersaline water0.028571
LOWER IN monimolimnion0.028571
LOWER IN high salinity0.028571
LOWER IN depth 4-9m0.028571
bermuda0.028571
control0.028571
LOWER IN porites astreoides0.028571
shark0.028571
kingdom of spain0.028571
estuary0.028571
estuary water0.028571
salinity >20 ppt0.028571
LOWER IN fresh water0.028571
LOWER IN salinity <5 ppt0.028571
bilbao0.028571
monimolimnion0.028571
hypersaline water0.028571
high salinity0.028571
depth 4-9m0.028571
toronto zoo0.028571
captive0.028571
zoological garden0.028571
olive baboon0.028571
papio anubis0.028571
canada0.028571
LOWER IN starfish0.028571
LOWER IN asterias amurensis0.028571
LOWER IN coelomic fluid0.028571
LOWER IN wild0.028571
LOWER IN marine sediment0.028571
depth 0cm0.028571
air0.028571
aerosol0.028571
LOWER IN megaptera novaeangliae0.028571
LOWER IN humpback whale0.028571
LOWER IN respiratory airway0.028571
LOWER IN whale blow0.028571
LOWER IN exhaled air condensate0.028571
south america0.028571
wastewater treatment plant0.028571
effluent0.028571
LOWER IN influent0.028571
LOWER IN sewage0.028571
litopenaeus vannamei0.028571
pacific white shrimp0.028571
intestine0.028571
depth 5-50m0.028571
LOWER IN depth 50-100m0.028571
Exp. ID User ID Description Date Region Flag Sequences
504amnonhighfreq nan'ao island, water, sea water, china2019-03-14v4No1 / 18
577amnonhighfreq low salinity, mixolimnion, depth 0-3m, lake water, water, ursu lake, romania, lake2020-01-09v3No1 / 20
508amnon high in water fresh water lake water lake compared to sediment lake sediment in united states of america state of minnesota manganika lake hypereutrophic lake sulfidic bottom water 2019-03-17v4No1 / 91
577amnoncommon low salinity, mixolimnion, depth 0-3m, lake water, water, ursu lake, romania, lake2020-01-09v3No1 / 130
579amnoncommon in pond water of mud crab aquaculture (common spring, mud crab, scylla paramamosain, fish farm, saline water aquarium, saline water, pond, china)2020-01-14v3No1 / 173
577amnon high in low salinity mixolimnion depth 0-3m compared to hypersaline water monimolimnion high salinity depth 4-9m in lake water water ursu lake romania lake 2020-01-09v3No1 / 190
508amnoncommon united states of america, state of minnesota, manganika lake, hypereutrophic lake, sulfidic bottom water, water, lake water, fresh water, lake2019-03-17v4No1 / 196
9amnonlower in sea water with coral ( high in control compared to porites astreoides in bermuda sea water )2016-10-27v4No1 / 211
323amnoncommon in shark skin (common atlantic ocean, south florida, state of florida, united states of america, shark, skin)2018-04-24v4No1 / 213
510amnon high in saline water salinity >20 ppt compared to fresh water salinity <5 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 223
550amnoncommon city, hokkaido, sea water, japan2019-08-18v4No1 / 291
577amnoncommon monimolimnion, hypersaline water, high salinity, depth 4-9m, lake water, water, ursu lake, romania, lake2020-01-09v3No1 / 303
565amnoncommon toronto zoo, captive, zoological garden, olive baboon, papio anubis, canada, skin2019-11-21v3No1 / 368
550amnon high in sea water compared to starfish asterias amurensis coelomic fluid wild in city hokkaido japan 2019-08-18v4No1 / 389
209amnoncommon sea water, ocean, north america, depth 25cm2017-10-15v4No1 / 445
504amnoncommon nan'ao island, water, sea water, china2019-03-14v4No1 / 452
504amnon high in water sea water compared to sediment marine sediment in nan'ao island china 2019-03-14v4No1 / 462
323amnoncommon water, atlantic ocean, south florida, state of florida, united states of america, surface water, depth 0cm, sea water2018-04-24v4No1 / 504
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, san francisco bay2018-03-12v4No1 / 558
209amnonlower in whale blow condensate compared to ocean water ( high in sea water ocean depth 25cm compared to megaptera novaeangliae humpback whale respiratory airway whale blow exhaled air condensate in north america )2017-10-15v4No1 / 560
53amnonhigher in wastewater plant effluent compared to influent and sewer in south america ( high in effluent compared to influent sewage in south america city wastewater treatment plant )2017-01-21v4No1 / 657
478amnoncommon farm, litopenaeus vannamei, pacific white shrimp, intestine, china2019-02-19v4No1 / 795
478amnoncommon farm, shrimp farm, water, saline water, china2019-02-19v4No1 / 799
473amnon high in depth 5-50m compared to depth 50-100m in water saline water pacific ocean state of california monterey bay sea water 2019-01-16v4No1 / 919
323amnonlower in sharks compared to sea water ( high in water surface water depth 0m sea water compared to shark in atlantic ocean south florida state of florida united states of america )2018-04-24v4No1 / 979
473amnon high in winter compared to summer in water saline water pacific ocean state of california monterey bay deth 5-100m sea water 2019-01-16v4No1 / 1006
478amnoncommon farm, shrimp farm, sediment, china2019-02-19v4No1 / 1085
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, san francisco bay2018-03-12v4No1 / 1166
531amnoncommon rhizosphere, greenhouse soil, farm, orthic anthrosol, cucumis sativus, cucumber, china2019-07-21v3No1 / 1223
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in lower mississippi river downstream compared to upper mississippi river upstream in mississippi river water river fresh water depth 1m united states of america particle filtered 2.7um )2019-01-07v4No1 / 1418
571amnoncommon kandelia candel, mangrove, futian national nature reserve, zhejiang province, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1435
571amnoncommon mudflat, futian national nature reserve, zhejiang province, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1587
571amnoncommon spartina alterniflora, zhejiang province, ximendao national marine reserve, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1668
571amnoncommon futian national nature reserve, spartina alterniflora, zhejiang province, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1747
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, san francisco bay2018-03-12v4No1 / 1799

Problems / suggestions? Please email info AT dbbact DOT org