Search result for sequence:
TACGTAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGCTGTGAAAATCCGAGGCTCAACCTCGGACCTGCAGTGGGTACGGGCAAACTAGAGTGCGGTAGGGGAGATTGGAATTCCTGG
common ontology terms
term enrichment score
TermScore
sea water0.286164
lake water0.260870
water0.258664
lake0.218182
saline water0.212766
romania0.177778
ursu lake0.177778
mangrove swamp0.150943
nan'ao island0.139535
depth 0-3m0.139535
mixolimnion0.139535
south florida0.139535
beach0.139535
san francisco bay0.139535
futian national nature reserve0.139535
zhejiang province0.131148
low salinity0.130435
pacific ocean0.125786
depth 0-20cm0.123077
state of california0.118343
china0.098476
atlantic ocean0.098361
procambarus clarkii0.097561
red swamp crayfish0.097561
manganika lake0.097561
hypereutrophic lake0.097561
sulfidic bottom water0.097561
north america0.097561
depth 25cm0.097561
shrimp farm0.097561
LOWER IN sediment0.095238
city0.093750
rice field0.093023
hokkaido0.093023
monterey bay0.093023
spartina alterniflora0.093023
fresh water0.091603
intestine0.089552
farm0.086022
marine sediment0.086022
jiangsu province0.081633
state of minnesota0.081633
surface water0.075472
state of florida0.073171
japan0.067797
fish0.063492
skin0.062500
ocean0.057971
LOWER IN lake sediment0.051282
pond0.051282
saline water aquarium0.051282
scylla paramamosain0.051282
mud crab0.051282
spring0.051282
LOWER IN depth 4-9m0.051282
LOWER IN monimolimnion0.051282
LOWER IN hypersaline water0.051282
bermuda0.051282
LOWER IN porites astreoides0.051282
shark0.051282
estuary0.051282
estuary water0.051282
salinity >20 ppt0.051282
LOWER IN salinity <5 ppt0.051282
bilbao0.051282
depth 4-9m0.051282
hypersaline water0.051282
monimolimnion0.051282
toronto zoo0.051282
LOWER IN starfish0.051282
LOWER IN asterias amurensis0.051282
LOWER IN coelomic fluid0.051282
depth 0cm0.051282
aerosol0.051282
LOWER IN megaptera novaeangliae0.051282
LOWER IN humpback whale0.051282
LOWER IN respiratory airway0.051282
LOWER IN whale blow0.051282
LOWER IN exhaled air condensate0.051282
LOWER IN influent0.051282
LOWER IN sewage0.051282
depth 5-50m0.051282
LOWER IN depth 50-100m0.051282
LOWER IN shark0.051282
deth 5-100m0.051282
orthic anthrosol0.051282
cucumis sativus0.051282
cucumber0.051282
depth 1m0.051282
lower mississippi river0.051282
LOWER IN upper mississippi river0.051282
kandelia candel0.051282
mudflat0.051282
ximendao national marine reserve0.051282
fish farm0.050000
LOWER IN high salinity0.050000
high salinity0.050000
canada0.050000
papio anubis0.050000
olive baboon0.050000
Fraction of dbbact annotations with this term covered by the query
TermScore
lake water0.666667
nan'ao island0.500000
romania0.500000
ursu lake0.500000
depth 0-3m0.500000
mixolimnion0.500000
procambarus clarkii0.500000
red swamp crayfish0.500000
manganika lake0.500000
LOWER IN lake sediment0.500000
hypereutrophic lake0.500000
sulfidic bottom water0.500000
pond0.500000
saline water0.500000
saline water aquarium0.500000
scylla paramamosain0.500000
mud crab0.500000
spring0.500000
LOWER IN depth 4-9m0.500000
LOWER IN monimolimnion0.500000
LOWER IN hypersaline water0.500000
bermuda0.500000
LOWER IN porites astreoides0.500000
south florida0.500000
shark0.500000
estuary0.500000
estuary water0.500000
salinity >20 ppt0.500000
LOWER IN salinity <5 ppt0.500000
bilbao0.500000
depth 4-9m0.500000
hypersaline water0.500000
monimolimnion0.500000
toronto zoo0.500000
LOWER IN starfish0.500000
LOWER IN asterias amurensis0.500000
LOWER IN coelomic fluid0.500000
north america0.500000
depth 25cm0.500000
depth 0cm0.500000
beach0.500000
aerosol0.500000
san francisco bay0.500000
LOWER IN megaptera novaeangliae0.500000
LOWER IN humpback whale0.500000
LOWER IN respiratory airway0.500000
LOWER IN whale blow0.500000
LOWER IN exhaled air condensate0.500000
LOWER IN influent0.500000
LOWER IN sewage0.500000
shrimp farm0.500000
depth 5-50m0.500000
LOWER IN depth 50-100m0.500000
LOWER IN shark0.500000
deth 5-100m0.500000
orthic anthrosol0.500000
cucumis sativus0.500000
cucumber0.500000
depth 1m0.500000
lower mississippi river0.500000
LOWER IN upper mississippi river0.500000
futian national nature reserve0.500000
kandelia candel0.500000
mudflat0.500000
ximendao national marine reserve0.500000
LOWER IN sediment0.400000
lake0.333333
low salinity0.333333
rice field0.333333
fish farm0.333333
LOWER IN high salinity0.333333
hokkaido0.333333
high salinity0.333333
canada0.333333
papio anubis0.333333
olive baboon0.333333
south america0.333333
monterey bay0.333333
depth 0m0.333333
particle0.333333
filtered 2.7um0.333333
mangrove0.333333
spartina alterniflora0.333333
LOWER IN marine sediment0.250000
wastewater treatment plant0.250000
effluent0.250000
litopenaeus vannamei0.250000
pacific white shrimp0.250000
greenhouse soil0.250000
mississippi river0.250000
downstream0.250000
LOWER IN upstream0.250000
mangrove swamp0.250000
sea water0.241379
sand0.200000
water0.180000
jiangsu province0.166667
state of minnesota0.166667
LOWER IN fresh water0.166667
zhejiang province0.166667
Fraction of annotations for the query sequences containing the term
TermScore
water0.459459
china0.378378
sea water0.351351
united states of america0.243243
lake0.162162
lake water0.162162
saline water0.135135
state of california0.135135
pacific ocean0.135135
romania0.108108
ursu lake0.108108
farm0.108108
soil0.108108
mangrove swamp0.108108
marine sediment0.108108
depth 0-20cm0.108108
zhejiang province0.108108
nan'ao island0.081081
depth 0-3m0.081081
mixolimnion0.081081
low salinity0.081081
intestine0.081081
fresh water0.081081
atlantic ocean0.081081
south florida0.081081
state of florida0.081081
city0.081081
beach0.081081
san francisco bay0.081081
futian national nature reserve0.081081
procambarus clarkii0.054054
red swamp crayfish0.054054
fish0.054054
adult0.054054
jiangsu province0.054054
rice field0.054054
state of minnesota0.054054
manganika lake0.054054
LOWER IN sediment0.054054
hypereutrophic lake0.054054
sulfidic bottom water0.054054
skin0.054054
hokkaido0.054054
japan0.054054
ocean0.054054
north america0.054054
depth 25cm0.054054
surface water0.054054
shrimp farm0.054054
monterey bay0.054054
spartina alterniflora0.054054
LOWER IN lake sediment0.027027
pond0.027027
saline water aquarium0.027027
fish farm0.027027
scylla paramamosain0.027027
mud crab0.027027
spring0.027027
LOWER IN depth 4-9m0.027027
LOWER IN high salinity0.027027
LOWER IN monimolimnion0.027027
LOWER IN hypersaline water0.027027
bermuda0.027027
control0.027027
LOWER IN porites astreoides0.027027
shark0.027027
kingdom of spain0.027027
estuary0.027027
estuary water0.027027
salinity >20 ppt0.027027
LOWER IN fresh water0.027027
LOWER IN salinity <5 ppt0.027027
bilbao0.027027
depth 4-9m0.027027
high salinity0.027027
hypersaline water0.027027
monimolimnion0.027027
canada0.027027
papio anubis0.027027
olive baboon0.027027
zoological garden0.027027
captive0.027027
toronto zoo0.027027
LOWER IN starfish0.027027
LOWER IN asterias amurensis0.027027
LOWER IN coelomic fluid0.027027
LOWER IN wild0.027027
LOWER IN marine sediment0.027027
depth 0cm0.027027
air0.027027
aerosol0.027027
LOWER IN megaptera novaeangliae0.027027
LOWER IN humpback whale0.027027
LOWER IN respiratory airway0.027027
LOWER IN whale blow0.027027
LOWER IN exhaled air condensate0.027027
south america0.027027
wastewater treatment plant0.027027
effluent0.027027
LOWER IN influent0.027027
Exp. ID User ID Description Date Region Flag Sequences
504amnondominant nan'ao island, water, sea water, china2019-03-14v4No1 / 18
577amnondominant lake, romania, ursu lake, water, lake water, depth 0-3m, mixolimnion, low salinity2020-01-09v3No1 / 20
581amnondominant in red swamp crayfish grown in flooded rice field (dominant procambarus clarkii, red swamp crayfish, fish, intestine, adult, china, jiangsu province, rice field)2020-01-21v3No1 / 21
508amnon high in water fresh water lake water lake compared to sediment lake sediment in united states of america state of minnesota manganika lake hypereutrophic lake sulfidic bottom water 2019-03-17v4No1 / 91
581amnoncommon in red swamp crayfish grown in flooded rice field (common procambarus clarkii, red swamp crayfish, fish, intestine, adult, china, jiangsu province, rice field)2020-01-21v3No1 / 122
577amnoncommon lake, romania, ursu lake, water, lake water, depth 0-3m, mixolimnion, low salinity2020-01-09v3No1 / 130
579amnoncommon in pond water of mud crab aquaculture (common china, pond, saline water, saline water aquarium, fish farm, scylla paramamosain, mud crab, spring)2020-01-14v3No1 / 173
577amnon high in depth 0-3m mixolimnion low salinity compared to depth 4-9m high salinity monimolimnion hypersaline water in lake romania ursu lake water lake water 2020-01-09v3No1 / 190
508amnoncommon united states of america, state of minnesota, manganika lake, hypereutrophic lake, sulfidic bottom water, water, lake water, fresh water, lake2019-03-17v4No1 / 196
9amnonlower in sea water with coral ( high in control compared to porites astreoides in bermuda sea water )2016-10-27v4No1 / 211
323amnoncommon in shark skin (common atlantic ocean, south florida, state of florida, united states of america, shark, skin)2018-04-24v4No1 / 213
510amnon high in saline water salinity >20 ppt compared to fresh water salinity <5 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 223
550amnoncommon city, hokkaido, sea water, japan2019-08-18v4No1 / 291
577amnoncommon lake, romania, ursu lake, water, lake water, depth 4-9m, high salinity, hypersaline water, monimolimnion2020-01-09v3No1 / 303
565amnoncommon skin, canada, papio anubis, olive baboon, zoological garden, captive, toronto zoo2019-11-21v3No1 / 368
550amnon high in sea water compared to starfish asterias amurensis coelomic fluid wild in city hokkaido japan 2019-08-18v4No1 / 389
209amnoncommon sea water, ocean, north america, depth 25cm2017-10-15v4No1 / 445
504amnoncommon nan'ao island, water, sea water, china2019-03-14v4No1 / 452
504amnon high in water sea water compared to sediment marine sediment in nan'ao island china 2019-03-14v4No1 / 462
323amnoncommon water, atlantic ocean, south florida, state of florida, united states of america, surface water, depth 0cm, sea water2018-04-24v4No1 / 504
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, san francisco bay2018-03-12v4No1 / 558
209amnonlower in whale blow condensate compared to ocean water ( high in sea water ocean depth 25cm compared to megaptera novaeangliae humpback whale respiratory airway whale blow exhaled air condensate in north america )2017-10-15v4No1 / 560
53amnonhigher in wastewater plant effluent compared to influent and sewer in south america ( high in effluent compared to influent sewage in south america city wastewater treatment plant )2017-01-21v4No1 / 657
478amnoncommon farm, litopenaeus vannamei, pacific white shrimp, intestine, china2019-02-19v4No1 / 795
478amnoncommon farm, shrimp farm, water, saline water, china2019-02-19v4No1 / 799
473amnon high in depth 5-50m compared to depth 50-100m in water saline water pacific ocean state of california monterey bay sea water 2019-01-16v4No1 / 919
323amnonlower in sharks compared to sea water ( high in water surface water depth 0m sea water compared to shark in atlantic ocean south florida state of florida united states of america )2018-04-24v4No1 / 979
473amnon high in winter compared to summer in water saline water pacific ocean state of california monterey bay deth 5-100m sea water 2019-01-16v4No1 / 1006
478amnoncommon farm, shrimp farm, sediment, china2019-02-19v4No1 / 1085
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, san francisco bay2018-03-12v4No1 / 1166
531amnoncommon rhizosphere, greenhouse soil, farm, orthic anthrosol, cucumis sativus, cucumber, china2019-07-21v3No1 / 1223
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in lower mississippi river downstream compared to upper mississippi river upstream in mississippi river water river fresh water depth 1m united states of america particle filtered 2.7um )2019-01-07v4No1 / 1418
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1435
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mudflat2019-12-16v4No1 / 1587
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, ximendao national marine reserve, zhejiang province, spartina alterniflora2019-12-16v4No1 / 1668
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, spartina alterniflora, futian national nature reserve2019-12-16v4No1 / 1747
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, san francisco bay2018-03-12v4No1 / 1799

Problems / suggestions? Please email info AT dbbact DOT org